ClinVar Miner

List of variants in gene combination RTEL1, RTEL1-TNFRSF6B reported as likely pathogenic for anemia (disease)

Included ClinVar conditions (262):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 39
Download table as spreadsheet
HGVS dbSNP
NM_001283009.1(RTEL1):c.3713_3714TC[1] (p.Ala1240fs)
NM_016434.3(RTEL1):c.1037+1G>T rs895722334
NM_016434.3(RTEL1):c.1476G>T (p.Met492Ile) rs370343781
NM_016434.3(RTEL1):c.1482-1G>A rs863225129
NM_016434.3(RTEL1):c.1596-1G>A rs1555811386
NM_016434.3(RTEL1):c.1596-1_1596delinsAA
NM_016434.3(RTEL1):c.1963dup (p.Arg655fs) rs1555811742
NM_016434.3(RTEL1):c.2021dup (p.Gln675fs) rs1263776141
NM_016434.3(RTEL1):c.2260C>T (p.Arg754Ter) rs377024903
NM_016434.3(RTEL1):c.2265+2T>A rs1555811966
NM_016434.3(RTEL1):c.2413+1G>C rs776744306
NM_016434.3(RTEL1):c.2414-2A>G rs1555812178
NM_016434.3(RTEL1):c.2533del (p.Ala845fs) rs1555812228
NM_016434.3(RTEL1):c.2587_2590del (p.Ser863fs) rs752833281
NM_016434.3(RTEL1):c.2614C>T (p.Arg872Ter) rs961593162
NM_016434.3(RTEL1):c.2635del (p.Arg879fs) rs1555812480
NM_016434.3(RTEL1):c.2653-2A>C rs1555812834
NM_016434.3(RTEL1):c.2812del (p.Leu938fs) rs1449687529
NM_016434.3(RTEL1):c.2851+1G>T rs1421904176
NM_016434.3(RTEL1):c.2858del (p.Tyr953fs) rs1555813123
NM_016434.3(RTEL1):c.2869C>T (p.Arg957Trp) rs398123018
NM_016434.3(RTEL1):c.2881A>T (p.Lys961Ter) rs1555813144
NM_016434.3(RTEL1):c.3104dup (p.Thr1036fs) rs1555814044
NM_016434.3(RTEL1):c.3110-2A>C rs377461417
NM_016434.3(RTEL1):c.3110-2A>T rs377461417
NM_016434.3(RTEL1):c.3130C>T (p.Gln1044Ter) rs1415449695
NM_016434.3(RTEL1):c.3334del (p.Leu1112fs) rs1555814334
NM_016434.3(RTEL1):c.3344-2A>G rs980695424
NM_016434.3(RTEL1):c.3376C>T (p.Gln1126Ter) rs778734749
NM_016434.3(RTEL1):c.458_459del (p.Gln153fs) rs773025155
NM_016434.3(RTEL1):c.49C>T (p.Pro17Ser) rs1555899096
NM_016434.3(RTEL1):c.525C>A (p.Tyr175Ter) rs1161373315
NM_016434.3(RTEL1):c.630C>A (p.Tyr210Ter) rs1555901000
NM_016434.3(RTEL1):c.649C>T (p.Gln217Ter) rs780546933
NM_016434.3(RTEL1):c.897del (p.Phe299fs) rs1555901832
NM_032957.4(RTEL1):c.3028C>T rs373740199
NM_032957.4(RTEL1):c.973_991+72delGCGGACTCCCCCAGCCCAGGTGCGTTCATAGCCAGACTGCTTGGTCCTGAGGCCTGCGCTGCTGCAGGGTGAGCCCCACCCGGAGTTCAGC
NM_032957.4(RTEL1):c.[1346T>C];[3028C>T]
RTEL1:c.2402G>A (p.Arg801His) rs201540674

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.