ClinVar Miner

List of variants in gene USH1C reported as benign for auditory system disease

Included ClinVar conditions (549):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 21
Download table as spreadsheet
HGVS dbSNP
NM_153676.4(USH1C):c.*186C>T rs1055577
NM_153676.4(USH1C):c.*211A>G rs1055581
NM_153676.4(USH1C):c.*419_*420insAACA rs10626485
NM_153676.4(USH1C):c.*46T>C rs1055574
NM_153676.4(USH1C):c.-60T>C rs371444878
NM_153676.4(USH1C):c.1086-12G>A rs11024318
NM_153676.4(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.4(USH1C):c.1211-1134G>A rs115931035
NM_153676.4(USH1C):c.1211-1152G>A rs116996553
NM_153676.4(USH1C):c.2226+12C>T rs17703528
NM_153676.4(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_153676.4(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.4(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.4(USH1C):c.2490+12G>C rs2072232
NM_153676.4(USH1C):c.294C>T (p.Leu98=) rs34055234
NM_153676.4(USH1C):c.324T>C (p.Phe108=) rs549758189
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.651A>G (p.Val217=) rs75977878
NM_153676.4(USH1C):c.819+10G>C rs41282936

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.