ClinVar Miner

List of variants reported as uncertain significance for Bethlem myopathy 1 by Invitae

Included ClinVar conditions (4):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 635
Download table as spreadsheet
HGVS dbSNP
NC_000002.11:g.(?_237481970)_(238305480_?)dup
NC_000021.8:g.(?_47401745)_(47532511_?)dup
NC_000021.8:g.(?_47401755)_(47546465_?)dup
NM_001848.2(COL6A1):c.1002+6_1002+88delTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGAC rs1556425727
NM_001848.2(COL6A1):c.1015T>C (p.Tyr339His) rs186775751
NM_001848.2(COL6A1):c.1030G>C (p.Gly344Arg) rs1569518250
NM_001848.2(COL6A1):c.1043C>T (p.Ser348Leu) rs142882745
NM_001848.2(COL6A1):c.1056+5G>A rs886044511
NM_001848.2(COL6A1):c.1095_1096inv (p.Ala366Thr)
NM_001848.2(COL6A1):c.1122C>T (p.Gly374=) rs373535692
NM_001848.2(COL6A1):c.1160G>A (p.Ser387Asn)
NM_001848.2(COL6A1):c.1182+5G>C rs1473206283
NM_001848.2(COL6A1):c.1190C>T (p.Pro397Leu) rs746386684
NM_001848.2(COL6A1):c.1231G>A (p.Asp411Asn)
NM_001848.2(COL6A1):c.1271G>A (p.Arg424Gln) rs761729281
NM_001848.2(COL6A1):c.1294C>A (p.Pro432Thr) rs1436272876
NM_001848.2(COL6A1):c.1315C>T (p.Arg439Trp)
NM_001848.2(COL6A1):c.1342G>A (p.Ala448Thr) rs886057153
NM_001848.2(COL6A1):c.1378G>T (p.Val460Phe) rs375452881
NM_001848.2(COL6A1):c.1379T>C (p.Val460Ala) rs140735590
NM_001848.2(COL6A1):c.1397C>T (p.Pro466Leu) rs746962124
NM_001848.2(COL6A1):c.1447C>T (p.Pro483Ser)
NM_001848.2(COL6A1):c.1459G>A (p.Glu487Lys)
NM_001848.2(COL6A1):c.14G>A (p.Arg5His) rs1556423460
NM_001848.2(COL6A1):c.1508G>A (p.Gly503Glu) rs1556428597
NM_001848.2(COL6A1):c.1540G>A (p.Ala514Thr) rs760815168
NM_001848.2(COL6A1):c.1553C>A (p.Thr518Asn) rs201935658
NM_001848.2(COL6A1):c.1555G>A (p.Glu519Lys) rs754384963
NM_001848.2(COL6A1):c.1603G>A (p.Gly535Arg) rs764556767
NM_001848.2(COL6A1):c.1619A>G (p.Lys540Arg)
NM_001848.2(COL6A1):c.1666G>A (p.Gly556Arg) rs886043521
NM_001848.2(COL6A1):c.1681G>A (p.Asp561Asn) rs140517685
NM_001848.2(COL6A1):c.1684A>G (p.Ile562Val) rs374315921
NM_001848.2(COL6A1):c.170C>A (p.Ala57Asp) rs143502850
NM_001848.2(COL6A1):c.1712A>C (p.Lys571Thr) rs751040647
NM_001848.2(COL6A1):c.1729G>A (p.Glu577Lys) rs552634753
NM_001848.2(COL6A1):c.1732G>A (p.Gly578Ser)
NM_001848.2(COL6A1):c.1742G>C (p.Gly581Ala)
NM_001848.2(COL6A1):c.1745C>T (p.Pro582Leu) rs766478019
NM_001848.2(COL6A1):c.1782C>T (p.Cys594=) rs745847824
NM_001848.2(COL6A1):c.1825T>C (p.Cys609Arg)
NM_001848.2(COL6A1):c.1829A>C (p.Lys610Thr) rs768906709
NM_001848.2(COL6A1):c.1845_1847CCT[1] (p.Leu617del) rs1085307560
NM_001848.2(COL6A1):c.1855G>A (p.Val619Met) rs150938324
NM_001848.2(COL6A1):c.185T>G (p.Val62Gly)
NM_001848.2(COL6A1):c.1877T>C (p.Ile626Thr) rs781626943
NM_001848.2(COL6A1):c.1908C>G (p.Asp636Glu) rs886042572
NM_001848.2(COL6A1):c.1930C>T (p.Arg644Trp) rs146622557
NM_001848.2(COL6A1):c.1945G>A (p.Glu649Lys) rs764129993
NM_001848.2(COL6A1):c.1959C>G (p.Phe653Leu)
NM_001848.2(COL6A1):c.1979C>T (p.Ala660Val)
NM_001848.2(COL6A1):c.1982G>A (p.Gly661Asp)
NM_001848.2(COL6A1):c.2009T>C (p.Met670Thr) rs776241591
NM_001848.2(COL6A1):c.2021T>G (p.Val674Gly)
NM_001848.2(COL6A1):c.202C>T (p.Arg68Cys) rs137964147
NM_001848.2(COL6A1):c.2044C>T (p.Arg682Trp) rs777378283
NM_001848.2(COL6A1):c.2045G>A (p.Arg682Gln) rs148962954
NM_001848.2(COL6A1):c.2050G>A (p.Val684Met)
NM_001848.2(COL6A1):c.2191C>T (p.Arg731Cys) rs398123635
NM_001848.2(COL6A1):c.2200A>G (p.Thr734Ala) rs562898957
NM_001848.2(COL6A1):c.2343G>A (p.Gln781=) rs755487987
NM_001848.2(COL6A1):c.2434+4C>T rs202147670
NM_001848.2(COL6A1):c.2437A>G (p.Lys813Glu) rs936641232
NM_001848.2(COL6A1):c.2464+1G>A
NM_001848.2(COL6A1):c.2481G>A (p.Pro827=)
NM_001848.2(COL6A1):c.2518G>A (p.Val840Met)
NM_001848.2(COL6A1):c.2554G>C (p.Ala852Pro) rs748327110
NM_001848.2(COL6A1):c.2561G>A (p.Arg854His) rs200732314
NM_001848.2(COL6A1):c.2569G>A (p.Glu857Lys) rs570688674
NM_001848.2(COL6A1):c.2603C>T (p.Ala868Val)
NM_001848.2(COL6A1):c.2611G>A (p.Val871Met) rs374685631
NM_001848.2(COL6A1):c.2614C>T (p.Arg872Trp) rs368561027
NM_001848.2(COL6A1):c.2615G>A (p.Arg872Gln) rs377586358
NM_001848.2(COL6A1):c.2642C>T (p.Thr881Met) rs150432347
NM_001848.2(COL6A1):c.2663G>A (p.Arg888Gln) rs138351067
NM_001848.2(COL6A1):c.269C>T (p.Ala90Val)
NM_001848.2(COL6A1):c.2705G>A (p.Ser902Asn) rs757422397
NM_001848.2(COL6A1):c.2713G>A (p.Asp905Asn)
NM_001848.2(COL6A1):c.2743G>A (p.Asp915Asn)
NM_001848.2(COL6A1):c.2746G>A (p.Val916Ile) rs563043611
NM_001848.2(COL6A1):c.2768T>G (p.Val923Gly)
NM_001848.2(COL6A1):c.2783G>T (p.Arg928Leu)
NM_001848.2(COL6A1):c.2784C>T (p.Arg928=) rs775569169
NM_001848.2(COL6A1):c.2785G>A (p.Glu929Lys) rs145846228
NM_001848.2(COL6A1):c.2803G>A (p.Ala935Thr) rs766416007
NM_001848.2(COL6A1):c.2821C>T (p.Leu941Phe) rs147882179
NM_001848.2(COL6A1):c.2852C>T (p.Thr951Met) rs371111712
NM_001848.2(COL6A1):c.2857G>A (p.Ala953Thr) rs150378645
NM_001848.2(COL6A1):c.2857G>T (p.Ala953Ser)
NM_001848.2(COL6A1):c.285C>G (p.Asp95Glu) rs145811554
NM_001848.2(COL6A1):c.2863A>G (p.Ile955Val) rs373070436
NM_001848.2(COL6A1):c.286G>A (p.Glu96Lys) rs759023976
NM_001848.2(COL6A1):c.2873C>A (p.Ala958Asp) rs763228065
NM_001848.2(COL6A1):c.2875G>A (p.Val959Met) rs200959957
NM_001848.2(COL6A1):c.2876T>C (p.Val959Ala) rs144814689
NM_001848.2(COL6A1):c.2890C>T (p.Arg964Trp) rs375007666
NM_001848.2(COL6A1):c.2899A>G (p.Ile967Val) rs777671647
NM_001848.2(COL6A1):c.2920G>A (p.Val974Met)
NM_001848.2(COL6A1):c.2941C>A (p.Pro981Thr) rs1569519253
NM_001848.2(COL6A1):c.2950C>T (p.Arg984Cys)
NM_001848.2(COL6A1):c.2963C>G (p.Thr988Ser)
NM_001848.2(COL6A1):c.2996G>A (p.Gly999Asp)
NM_001848.2(COL6A1):c.3029A>G (p.Gln1010Arg) rs141605607
NM_001848.2(COL6A1):c.3040C>T (p.Arg1014Cys)
NM_001848.2(COL6A1):c.3041G>A (p.Arg1014His)
NM_001848.2(COL6A1):c.3056A>G (p.Gln1019Arg) rs751518356
NM_001848.2(COL6A1):c.325G>A (p.Gly109Ser) rs368580280
NM_001848.2(COL6A1):c.331G>A (p.Asp111Asn) rs1309822720
NM_001848.2(COL6A1):c.334G>A (p.Ala112Thr)
NM_001848.2(COL6A1):c.344G>A (p.Ser115Asn)
NM_001848.2(COL6A1):c.356C>T (p.Ala119Val) rs571641824
NM_001848.2(COL6A1):c.375G>C (p.Lys125Asn)
NM_001848.2(COL6A1):c.377G>T (p.Gly126Val) rs1300015385
NM_001848.2(COL6A1):c.509G>C (p.Gly170Ala)
NM_001848.2(COL6A1):c.539A>G (p.Lys180Arg) rs756141940
NM_001848.2(COL6A1):c.554A>G (p.Lys185Arg) rs754667407
NM_001848.2(COL6A1):c.596G>A (p.Arg199His)
NM_001848.2(COL6A1):c.5G>A (p.Arg2Lys) rs1305504243
NM_001848.2(COL6A1):c.621C>A (p.His207Gln) rs866987981
NM_001848.2(COL6A1):c.623C>T (p.Thr208Met) rs372199631
NM_001848.2(COL6A1):c.631C>G (p.Arg211Gly) rs375217284
NM_001848.2(COL6A1):c.631C>T (p.Arg211Cys) rs375217284
NM_001848.2(COL6A1):c.665G>A (p.Arg222His) rs780638665
NM_001848.2(COL6A1):c.680C>T (p.Ala227Val)
NM_001848.2(COL6A1):c.697G>A (p.Asp233Asn)
NM_001848.2(COL6A1):c.717+4A>G rs762867111
NM_001848.2(COL6A1):c.750C>A (p.Phe250Leu) rs748153811
NM_001848.2(COL6A1):c.763G>A (p.Ala255Thr) rs145473829
NM_001848.2(COL6A1):c.821C>T (p.Pro274Leu) rs201093313
NM_001848.2(COL6A1):c.85G>A (p.Val29Met)
NM_001848.2(COL6A1):c.880C>G (p.Pro294Ala) rs141572895
NM_001848.2(COL6A1):c.903+4C>T
NM_001848.2(COL6A1):c.903+5G>A
NM_001848.2(COL6A1):c.931-6C>A
NM_001848.2(COL6A1):c.956A>G (p.Lys319Arg) rs794727059
NM_001848.2(COL6A1):c.98-6G>A rs886042599
NM_001849.3(COL6A2):c.*5G>A rs377195134
NM_001849.3(COL6A2):c.-91_3071dup
NM_001849.3(COL6A2):c.1012C>T (p.Arg338Cys) rs775751831
NM_001849.3(COL6A2):c.1037_1038delinsTT (p.Gly346Val) rs1568930426
NM_001849.3(COL6A2):c.1053+3A>T rs1555873388
NM_001849.3(COL6A2):c.1053+6G>A rs373181368
NM_001849.3(COL6A2):c.1060G>A (p.Asp354Asn) rs188184732
NM_001849.3(COL6A2):c.1071G>A (p.Pro357=) rs746727003
NM_001849.3(COL6A2):c.1078G>T (p.Ala360Ser) rs1555873523
NM_001849.3(COL6A2):c.1095G>T (p.Glu365Asp) rs374673302
NM_001849.3(COL6A2):c.1111G>A (p.Gly371Ser)
NM_001849.3(COL6A2):c.1112G>T (p.Gly371Val)
NM_001849.3(COL6A2):c.1117-3C>T rs772428654
NM_001849.3(COL6A2):c.1118G>C (p.Gly373Ala)
NM_001849.3(COL6A2):c.1130G>A (p.Arg377His) rs148552966
NM_001849.3(COL6A2):c.1138C>T (p.Arg380Cys) rs142880107
NM_001849.3(COL6A2):c.116-3C>T
NM_001849.3(COL6A2):c.1162G>A (p.Gly388Arg) rs727503883
NM_001849.3(COL6A2):c.1181G>C (p.Gly394Ala)
NM_001849.3(COL6A2):c.1199G>T (p.Gly400Val) rs1555873827
NM_001849.3(COL6A2):c.1225G>A (p.Gly409Arg) rs1568931875
NM_001849.3(COL6A2):c.1263C>T (p.Gly421=)
NM_001849.3(COL6A2):c.1277G>C (p.Arg426Thr)
NM_001849.3(COL6A2):c.1288G>A (p.Gly430Ser) rs765430501
NM_001849.3(COL6A2):c.1336G>A (p.Asp446Asn) rs535007570
NM_001849.3(COL6A2):c.1336G>C (p.Asp446His) rs535007570
NM_001849.3(COL6A2):c.1346C>G (p.Pro449Arg) rs886044030
NM_001849.3(COL6A2):c.1348G>C (p.Glu450Gln) rs757846451
NM_001849.3(COL6A2):c.1357C>T (p.Arg453Cys)
NM_001849.3(COL6A2):c.1358G>A (p.Arg453His) rs878854386
NM_001849.3(COL6A2):c.1396-26_1396-10delCCCCAAATTCCTCCCCT
NM_001849.3(COL6A2):c.1447C>T (p.Pro483Ser)
NM_001849.3(COL6A2):c.1466G>C (p.Arg489Pro) rs61735828
NM_001849.3(COL6A2):c.1477G>A (p.Gly493Ser)
NM_001849.3(COL6A2):c.1493G>A (p.Arg498His) rs267606749
NM_001849.3(COL6A2):c.1498G>C (p.Asp500His) rs770222615
NM_001849.3(COL6A2):c.1568C>G (p.Ala523Gly)
NM_001849.3(COL6A2):c.1600G>A (p.Gly534Ser)
NM_001849.3(COL6A2):c.1616G>A (p.Arg539Gln)
NM_001849.3(COL6A2):c.1621G>A (p.Asp541Asn)
NM_001849.3(COL6A2):c.1641_1667del (p.Gly549_Pro557del) rs1555874762
NM_001849.3(COL6A2):c.1666G>A (p.Glu556Lys) rs368878639
NM_001849.3(COL6A2):c.167G>A (p.Ser56Asn) rs1555871311
NM_001849.3(COL6A2):c.1685C>T (p.Pro562Leu) rs370775804
NM_001849.3(COL6A2):c.1762G>A (p.Gly588Ser) rs139488626
NM_001849.3(COL6A2):c.1769C>T (p.Thr590Met) rs142709940
NM_001849.3(COL6A2):c.1770G>A (p.Thr590=) rs150999832
NM_001849.3(COL6A2):c.1792G>A (p.Val598Met) rs149731632
NM_001849.3(COL6A2):c.181T>C (p.Ser61Pro) rs990733473
NM_001849.3(COL6A2):c.1870G>A (p.Glu624Lys) rs387906607
NM_001849.3(COL6A2):c.1912_1914del (p.Val638del)
NM_001849.3(COL6A2):c.1913T>G (p.Val638Gly) rs141919484
NM_001849.3(COL6A2):c.1921G>A (p.Val641Met) rs1032420539
NM_001849.3(COL6A2):c.1925T>C (p.Val642Ala) rs760227367
NM_001849.3(COL6A2):c.1937G>A (p.Gly646Asp)
NM_001849.3(COL6A2):c.1969+4A>C rs775997945
NM_001849.3(COL6A2):c.2002G>A (p.Glu668Lys) rs138948335
NM_001849.3(COL6A2):c.2083G>A (p.Glu695Lys) rs377376395
NM_001849.3(COL6A2):c.2129C>A (p.Ala710Asp) rs1555875708
NM_001849.3(COL6A2):c.2134G>T (p.Asp712Tyr) rs375608173
NM_001849.3(COL6A2):c.2153G>A (p.Ser718Asn)
NM_001849.3(COL6A2):c.2171G>T (p.Arg724Leu) rs145450812
NM_001849.3(COL6A2):c.2173G>T (p.Val725Leu) rs1555875749
NM_001849.3(COL6A2):c.2181G>A (p.Ala727=)
NM_001849.3(COL6A2):c.2189T>G (p.Ile730Ser) rs1555875759
NM_001849.3(COL6A2):c.2237C>T (p.Ala746Val) rs761863452
NM_001849.3(COL6A2):c.2243G>A (p.Cys748Tyr) rs200072495
NM_001849.3(COL6A2):c.2251G>A (p.Asp751Asn) rs375884809
NM_001849.3(COL6A2):c.2278G>A (p.Gly760Arg)
NM_001849.3(COL6A2):c.2293G>A (p.Glu765Lys)
NM_001849.3(COL6A2):c.229T>C (p.Phe77Leu) rs199736749
NM_001849.3(COL6A2):c.2318A>C (p.Tyr773Ser)
NM_001849.3(COL6A2):c.2326G>A (p.Ala776Thr) rs759293889
NM_001849.3(COL6A2):c.2334C>A (p.Asp778Glu) rs764165623
NM_001849.3(COL6A2):c.2371G>A (p.Asp791Asn) rs1273249543
NM_001849.3(COL6A2):c.2375T>C (p.Leu792Pro) rs1568940864
NM_001849.3(COL6A2):c.2386_2388del (p.Lys796del) rs747378168
NM_001849.3(COL6A2):c.2407G>A (p.Asp803Asn) rs761913437
NM_001849.3(COL6A2):c.2410G>A (p.Val804Ile) rs199896699
NM_001849.3(COL6A2):c.2420C>T (p.Pro807Leu)
NM_001849.3(COL6A2):c.2422+6C>T rs371950486
NM_001849.3(COL6A2):c.2425C>T (p.Pro809Ser)
NM_001849.3(COL6A2):c.2435T>C (p.Val812Ala) rs886044025
NM_001849.3(COL6A2):c.2470G>A (p.Val824Met) rs758758266
NM_001849.3(COL6A2):c.2471T>C (p.Val824Ala) rs1259128571
NM_001849.3(COL6A2):c.2483C>T (p.Thr828Met) rs755782924
NM_001849.3(COL6A2):c.2508C>A (p.Phe836Leu) rs727502835
NM_001849.3(COL6A2):c.2524G>A (p.Glu842Lys) rs571051982
NM_001849.3(COL6A2):c.2527C>T (p.Arg843Trp) rs376880198
NM_001849.3(COL6A2):c.2528G>A (p.Arg843Gln) rs201736323
NM_001849.3(COL6A2):c.2557C>T (p.Arg853Trp)
NM_001849.3(COL6A2):c.2561G>A (p.Arg854His)
NM_001849.3(COL6A2):c.2575G>A (p.Val859Met) rs370446082
NM_001849.3(COL6A2):c.2584C>T (p.Arg862Trp) rs777822883
NM_001849.3(COL6A2):c.2591C>T (p.Thr864Met) rs200488881
NM_001849.3(COL6A2):c.2599C>A (p.Arg867=) rs144484744
NM_001849.3(COL6A2):c.2623G>A (p.Ala875Thr) rs199606147
NM_001849.3(COL6A2):c.2627G>A (p.Arg876His) rs1012567148
NM_001849.3(COL6A2):c.2628C>T (p.Arg876=)
NM_001849.3(COL6A2):c.2629G>A (p.Val877Met) rs369396198
NM_001849.3(COL6A2):c.2633C>T (p.Ala878Val) rs774521989
NM_001849.3(COL6A2):c.2656G>A (p.Gly886Ser) rs571488000
NM_001849.3(COL6A2):c.2659G>A (p.Glu887Lys) rs886043283
NM_001849.3(COL6A2):c.2671G>A (p.Ala891Thr)
NM_001849.3(COL6A2):c.267G>C (p.Gln89His) rs1452398707
NM_001849.3(COL6A2):c.2698G>A (p.Ala900Thr)
NM_001849.3(COL6A2):c.2707G>A (p.Glu903Lys) rs373611722
NM_001849.3(COL6A2):c.2711C>T (p.Ala904Val) rs376665722
NM_001849.3(COL6A2):c.2738_2740del (p.Ser913del) rs777696289
NM_001849.3(COL6A2):c.2749G>A (p.Val917Met) rs145381639
NM_001849.3(COL6A2):c.2761G>A (p.Val921Met) rs398123650
NM_001849.3(COL6A2):c.2769C>A (p.His923Gln)
NM_001849.3(COL6A2):c.2770G>A (p.Ala924Thr) rs771749652
NM_001849.3(COL6A2):c.2773A>C (p.Ile925Leu) rs772894756
NM_001849.3(COL6A2):c.2785G>A (p.Val929Met) rs145527336
NM_001849.3(COL6A2):c.2788C>T (p.Arg930Cys) rs886057168
NM_001849.3(COL6A2):c.2798G>A (p.Arg933His) rs374384263
NM_001849.3(COL6A2):c.2802C>T (p.Gly934=) rs151295731
NM_001849.3(COL6A2):c.2804G>A (p.Gly935Glu)
NM_001849.3(COL6A2):c.2809C>T (p.Arg937Trp) rs755352246
NM_001849.3(COL6A2):c.2810G>A (p.Arg937Gln) rs777354703
NM_001849.3(COL6A2):c.2843C>G (p.Thr948Arg) rs367980010
NM_001849.3(COL6A2):c.2846_2857dup (p.Asp949_Thr952dup)
NM_001849.3(COL6A2):c.2848G>A (p.Gly950Ser) rs147054208
NM_001849.3(COL6A2):c.284G>A (p.Arg95His) rs886042690
NM_001849.3(COL6A2):c.2855C>G (p.Thr952Arg)
NM_001849.3(COL6A2):c.2863G>A (p.Asp955Asn)
NM_001849.3(COL6A2):c.2875G>C (p.Glu959Gln) rs150168522
NM_001849.3(COL6A2):c.2877G>T (p.Glu959Asp) rs1274304291
NM_001849.3(COL6A2):c.2887T>G (p.Ser963Ala)
NM_001849.3(COL6A2):c.2892G>A (p.Met964Ile)
NM_001849.3(COL6A2):c.2893C>T (p.Arg965Cys) rs201188174
NM_001849.3(COL6A2):c.2894G>C (p.Arg965Pro) rs201854898
NM_001849.3(COL6A2):c.289G>A (p.Gly97Ser) rs750027302
NM_001849.3(COL6A2):c.2902_2934dup (p.Asn968_Ser978dup) rs1568948073
NM_001849.3(COL6A2):c.2905G>A (p.Val969Met) rs763443381
NM_001849.3(COL6A2):c.2917G>A (p.Val973Met) rs145959270
NM_001849.3(COL6A2):c.2922G>A (p.Leu974=) rs556385546
NM_001849.3(COL6A2):c.2927T>C (p.Leu976Ser) rs200200671
NM_001849.3(COL6A2):c.2935G>A (p.Asp979Asn) rs141579198
NM_001849.3(COL6A2):c.2938G>A (p.Val980Met)
NM_001849.3(COL6A2):c.2950G>A (p.Val984Met) rs752700701
NM_001849.3(COL6A2):c.2960C>T (p.Thr987Met) rs199955442
NM_001849.3(COL6A2):c.2977C>T (p.Arg993Cys)
NM_001849.3(COL6A2):c.2986G>A (p.Val996Met) rs142432514
NM_001849.3(COL6A2):c.2988dup (p.Phe997fs) rs1555877364
NM_001849.3(COL6A2):c.2995G>A (p.Glu999Lys) rs142296092
NM_001849.3(COL6A2):c.3004T>C (p.Tyr1002His) rs527236952
NM_001849.3(COL6A2):c.3007G>A (p.Asp1003Asn)
NM_001849.3(COL6A2):c.3026G>T (p.Gly1009Val) rs1157175258
NM_001849.3(COL6A2):c.3029T>G (p.Phe1010Cys) rs1051148162
NM_001849.3(COL6A2):c.3047G>A (p.Arg1016His) rs376368468
NM_001849.3(COL6A2):c.340G>A (p.Asp114Asn) rs969934621
NM_001849.3(COL6A2):c.422T>C (p.Met141Thr) rs1568925911
NM_001849.3(COL6A2):c.460G>A (p.Val154Ile)
NM_001849.3(COL6A2):c.484G>A (p.Asp162Asn)
NM_001849.3(COL6A2):c.487G>A (p.Gly163Ser) rs769456044
NM_001849.3(COL6A2):c.544G>A (p.Glu182Lys)
NM_001849.3(COL6A2):c.545A>G (p.Glu182Gly) rs760509198
NM_001849.3(COL6A2):c.556C>T (p.Arg186Trp)
NM_001849.3(COL6A2):c.557G>A (p.Arg186Gln)
NM_001849.3(COL6A2):c.581A>G (p.Gln194Arg) rs113509166
NM_001849.3(COL6A2):c.582G>C (p.Gln194His)
NM_001849.3(COL6A2):c.623C>T (p.Pro208Leu)
NM_001849.3(COL6A2):c.628G>A (p.Glu210Lys) rs113017484
NM_001849.3(COL6A2):c.638G>A (p.Arg213His) rs368064647
NM_001849.3(COL6A2):c.643G>A (p.Asp215Asn) rs563449281
NM_001849.3(COL6A2):c.673G>A (p.Glu225Lys)
NM_001849.3(COL6A2):c.679G>C (p.Asp227His) rs35881321
NM_001849.3(COL6A2):c.697C>T (p.Arg233Cys) rs1379543505
NM_001849.3(COL6A2):c.698G>A (p.Arg233His) rs146742517
NM_001849.3(COL6A2):c.730G>A (p.Gly244Arg) rs199806576
NM_001849.3(COL6A2):c.790C>T (p.Arg264Cys) rs760263812
NM_001849.3(COL6A2):c.791G>A (p.Arg264His) rs148029276
NM_001849.3(COL6A2):c.80C>T (p.Ser27Leu)
NM_001849.3(COL6A2):c.827C>T (p.Pro276Leu) rs757488307
NM_001849.3(COL6A2):c.83C>G (p.Pro28Arg)
NM_001849.3(COL6A2):c.863C>T (p.Pro288Leu) rs745566911
NM_001849.3(COL6A2):c.881T>C (p.Ile294Thr) rs1568928972
NM_001849.3(COL6A2):c.904G>A (p.Val302Ile)
NM_001849.3(COL6A2):c.946G>A (p.Gly316Ser)
NM_001849.3(COL6A2):c.961C>T (p.Pro321Ser)
NM_001849.3(COL6A2):c.988G>A (p.Asp330Asn) rs139399166
NM_004369.3(COL6A3):c.1006C>T (p.Arg336Trp) rs200720222
NM_004369.3(COL6A3):c.1061G>A (p.Ser354Asn) rs1416475329
NM_004369.3(COL6A3):c.1069C>A (p.Pro357Thr) rs1174559820
NM_004369.3(COL6A3):c.107C>T (p.Ala36Val) rs572020866
NM_004369.3(COL6A3):c.1120G>A (p.Val374Met) rs780353083
NM_004369.3(COL6A3):c.1131C>G (p.Phe377Leu)
NM_004369.3(COL6A3):c.1150G>A (p.Ala384Thr) rs374267444
NM_004369.3(COL6A3):c.1204G>C (p.Val402Leu) rs746277006
NM_004369.3(COL6A3):c.1292C>T (p.Pro431Leu) rs144746928
NM_004369.3(COL6A3):c.1385A>G (p.Asn462Ser) rs200250810
NM_004369.3(COL6A3):c.1538G>A (p.Arg513Gln) rs139498556
NM_004369.3(COL6A3):c.1575G>A (p.Thr525=)
NM_004369.3(COL6A3):c.1639G>A (p.Glu547Lys) rs1278327904
NM_004369.3(COL6A3):c.1727G>A (p.Ser576Asn)
NM_004369.3(COL6A3):c.1735G>A (p.Ala579Thr)
NM_004369.3(COL6A3):c.1740T>G (p.Phe580Leu) rs1553562483
NM_004369.3(COL6A3):c.1785C>G (p.Ile595Met) rs114278376
NM_004369.3(COL6A3):c.1791C>A (p.Phe597Leu)
NM_004369.3(COL6A3):c.1826G>A (p.Arg609Gln)
NM_004369.3(COL6A3):c.1867C>T (p.Pro623Ser) rs372022185
NM_004369.3(COL6A3):c.1906A>G (p.Asn636Asp)
NM_004369.3(COL6A3):c.1958C>A (p.Thr653Asn)
NM_004369.3(COL6A3):c.2000A>G (p.Asn667Ser)
NM_004369.3(COL6A3):c.2029C>T (p.Arg677Cys) rs137923508
NM_004369.3(COL6A3):c.2066C>T (p.Thr689Met)
NM_004369.3(COL6A3):c.2144C>T (p.Ser715Leu)
NM_004369.3(COL6A3):c.2147G>A (p.Gly716Asp) rs144514259
NM_004369.3(COL6A3):c.2148C>T (p.Gly716=) rs1204913393
NM_004369.3(COL6A3):c.2180A>G (p.Tyr727Cys)
NM_004369.3(COL6A3):c.218A>G (p.Glu73Gly)
NM_004369.3(COL6A3):c.2195C>T (p.Thr732Met)
NM_004369.3(COL6A3):c.2206G>A (p.Gly736Ser) rs150008830
NM_004369.3(COL6A3):c.2219G>A (p.Arg740His) rs529827991
NM_004369.3(COL6A3):c.2231C>T (p.Pro744Leu) rs199504304
NM_004369.3(COL6A3):c.2305G>A (p.Ala769Thr) rs142719863
NM_004369.3(COL6A3):c.2306C>T (p.Ala769Val) rs753966526
NM_004369.3(COL6A3):c.2307G>A (p.Ala769=)
NM_004369.3(COL6A3):c.2342C>T (p.Ala781Val)
NM_004369.3(COL6A3):c.2374A>G (p.Asn792Asp)
NM_004369.3(COL6A3):c.2393T>C (p.Leu798Pro)
NM_004369.3(COL6A3):c.2416C>T (p.Pro806Ser)
NM_004369.3(COL6A3):c.2444C>A (p.Pro815His) rs199601240
NM_004369.3(COL6A3):c.2502C>G (p.Ser834Arg) rs767437328
NM_004369.3(COL6A3):c.253G>A (p.Gly85Arg)
NM_004369.3(COL6A3):c.2546T>A (p.Val849Glu)
NM_004369.3(COL6A3):c.260C>G (p.Pro87Arg)
NM_004369.3(COL6A3):c.262C>T (p.His88Tyr)
NM_004369.3(COL6A3):c.2666G>A (p.Arg889His)
NM_004369.3(COL6A3):c.2707G>A (p.Val903Met)
NM_004369.3(COL6A3):c.2722A>T (p.Ile908Phe)
NM_004369.3(COL6A3):c.2729C>T (p.Thr910Met)
NM_004369.3(COL6A3):c.2822T>C (p.Leu941Pro)
NM_004369.3(COL6A3):c.2845G>A (p.Ala949Thr)
NM_004369.3(COL6A3):c.2864G>A (p.Arg955His) rs112172548
NM_004369.3(COL6A3):c.2895G>T (p.Gln965His) rs775993027
NM_004369.3(COL6A3):c.289C>T (p.Arg97Cys)
NM_004369.3(COL6A3):c.2908C>G (p.Pro970Ala)
NM_004369.3(COL6A3):c.290G>A (p.Arg97His) rs201249839
NM_004369.3(COL6A3):c.2958C>G (p.Ile986Met) rs145203676
NM_004369.3(COL6A3):c.2959G>A (p.Val987Met)
NM_004369.3(COL6A3):c.2972C>T (p.Ala991Val) rs202185764
NM_004369.3(COL6A3):c.3040A>G (p.Lys1014Glu) rs114284669
NM_004369.3(COL6A3):c.3055G>A (p.Gly1019Arg) rs370664069
NM_004369.3(COL6A3):c.3071-7C>G
NM_004369.3(COL6A3):c.3118G>A (p.Val1040Ile) rs78427077
NM_004369.3(COL6A3):c.3164T>A (p.Val1055Glu)
NM_004369.3(COL6A3):c.3169A>T (p.Ser1057Cys) rs1553560705
NM_004369.3(COL6A3):c.3190C>T (p.Arg1064Trp) rs369810455
NM_004369.3(COL6A3):c.3199G>A (p.Val1067Met) rs148175795
NM_004369.3(COL6A3):c.3223C>T (p.Arg1075Trp) rs201962257
NM_004369.3(COL6A3):c.3271G>A (p.Val1091Ile)
NM_004369.3(COL6A3):c.3274G>A (p.Val1092Ile) rs576798969
NM_004369.3(COL6A3):c.3311C>T (p.Pro1104Leu)
NM_004369.3(COL6A3):c.3319A>G (p.Asn1107Asp)
NM_004369.3(COL6A3):c.3331G>A (p.Ala1111Thr) rs151021451
NM_004369.3(COL6A3):c.3336G>A (p.Leu1112=) rs1553560545
NM_004369.3(COL6A3):c.3357C>G (p.Ile1119Met)
NM_004369.3(COL6A3):c.3371C>T (p.Ala1124Val) rs374447921
NM_004369.3(COL6A3):c.3424G>A (p.Asp1142Asn) rs777599612
NM_004369.3(COL6A3):c.3445C>T (p.Arg1149Trp) rs113360085
NM_004369.3(COL6A3):c.3463G>A (p.Val1155Met)
NM_004369.3(COL6A3):c.3545C>T (p.Pro1182Leu) rs768064422
NM_004369.3(COL6A3):c.3549C>G (p.Asp1183Glu) rs762240306
NM_004369.3(COL6A3):c.3556G>A (p.Val1186Met)
NM_004369.3(COL6A3):c.3598G>T (p.Val1200Phe) rs779028054
NM_004369.3(COL6A3):c.3651G>T (p.Gln1217His)
NM_004369.3(COL6A3):c.3664C>T (p.Pro1222Ser) rs1553560314
NM_004369.3(COL6A3):c.3668T>C (p.Leu1223Pro) rs772944531
NM_004369.3(COL6A3):c.3679+5G>T
NM_004369.3(COL6A3):c.3700G>A (p.Val1234Met)
NM_004369.3(COL6A3):c.3725A>C (p.Gln1242Pro) rs1553559646
NM_004369.3(COL6A3):c.3741G>C (p.Glu1247Asp) rs577927810
NM_004369.3(COL6A3):c.3790G>A (p.Val1264Met)
NM_004369.3(COL6A3):c.3809G>A (p.Arg1270Gln) rs1057518127
NM_004369.3(COL6A3):c.3852C>A (p.Phe1284Leu) rs148561729
NM_004369.3(COL6A3):c.3893C>T (p.Ala1298Val)
NM_004369.3(COL6A3):c.3901C>T (p.Arg1301Trp) rs150430813
NM_004369.3(COL6A3):c.3902G>A (p.Arg1301Gln) rs148038440
NM_004369.3(COL6A3):c.3922C>T (p.Arg1308Trp)
NM_004369.3(COL6A3):c.3923G>A (p.Arg1308Gln) rs774461787
NM_004369.3(COL6A3):c.3932A>G (p.Asn1311Ser) rs200592625
NM_004369.3(COL6A3):c.3989G>T (p.Ser1330Ile)
NM_004369.3(COL6A3):c.3991C>A (p.Arg1331Ser)
NM_004369.3(COL6A3):c.4007T>C (p.Val1336Ala)
NM_004369.3(COL6A3):c.4041G>T (p.Lys1347Asn)
NM_004369.3(COL6A3):c.4048G>A (p.Asp1350Asn)
NM_004369.3(COL6A3):c.4085T>A (p.Phe1362Tyr)
NM_004369.3(COL6A3):c.4103C>T (p.Thr1368Met) rs116505603
NM_004369.3(COL6A3):c.4108G>A (p.Ala1370Thr) rs372234605
NM_004369.3(COL6A3):c.410G>A (p.Arg137Gln) rs779126378
NM_004369.3(COL6A3):c.4121A>T (p.Asp1374Val) rs766488017
NM_004369.3(COL6A3):c.413C>T (p.Ala138Val) rs1167973119
NM_004369.3(COL6A3):c.4145C>T (p.Ser1382Leu)
NM_004369.3(COL6A3):c.4240G>C (p.Glu1414Gln) rs539986030
NM_004369.3(COL6A3):c.4270C>T (p.Arg1424Cys) rs768522226
NM_004369.3(COL6A3):c.4271G>A (p.Arg1424His) rs149838946
NM_004369.3(COL6A3):c.4306G>C (p.Asp1436His) rs1168273415
NM_004369.3(COL6A3):c.4309A>T (p.Ile1437Phe) rs144314743
NM_004369.3(COL6A3):c.4318C>G (p.Leu1440Val)
NM_004369.3(COL6A3):c.4324G>A (p.Asp1442Asn) rs772700553
NM_004369.3(COL6A3):c.439G>A (p.Val147Ile)
NM_004369.3(COL6A3):c.4432G>A (p.Val1478Met) rs374493032
NM_004369.3(COL6A3):c.4436A>T (p.Gln1479Leu) rs369449472
NM_004369.3(COL6A3):c.4503C>A (p.Asp1501Glu)
NM_004369.3(COL6A3):c.4510C>T (p.Arg1504Trp) rs144223596
NM_004369.3(COL6A3):c.4534T>A (p.Ser1512Thr) rs1553557796
NM_004369.3(COL6A3):c.4604G>A (p.Arg1535His)
NM_004369.3(COL6A3):c.460T>A (p.Ser154Thr) rs1559279425
NM_004369.3(COL6A3):c.461C>T (p.Ser154Leu) rs147701785
NM_004369.3(COL6A3):c.4678G>A (p.Ala1560Thr) rs371631320
NM_004369.3(COL6A3):c.4684G>T (p.Val1562Leu) rs1553557605
NM_004369.3(COL6A3):c.4691G>A (p.Arg1564His) rs368151192
NM_004369.3(COL6A3):c.4729A>G (p.Asn1577Asp) rs1559239453
NM_004369.3(COL6A3):c.4742C>G (p.Thr1581Arg) rs1156524068
NM_004369.3(COL6A3):c.4765G>A (p.Asp1589Asn)
NM_004369.3(COL6A3):c.4787T>C (p.Val1596Ala) rs1559239279
NM_004369.3(COL6A3):c.4817A>T (p.Glu1606Val)
NM_004369.3(COL6A3):c.4849G>A (p.Ala1617Thr) rs200433282
NM_004369.3(COL6A3):c.4873G>T (p.Val1625Leu) rs398124121
NM_004369.3(COL6A3):c.4888C>T (p.Pro1630Ser) rs145560772
NM_004369.3(COL6A3):c.4917C>G (p.Asp1639Glu) rs1553556773
NM_004369.3(COL6A3):c.4922T>A (p.Val1641Glu) rs1559237565
NM_004369.3(COL6A3):c.4950C>G (p.Phe1650Leu)
NM_004369.3(COL6A3):c.4994T>C (p.Ile1665Thr) rs1034783532
NM_004369.3(COL6A3):c.5019C>T (p.Gly1673=) rs140516220
NM_004369.3(COL6A3):c.5068G>A (p.Glu1690Lys) rs144451523
NM_004369.3(COL6A3):c.5095A>C (p.Lys1699Gln) rs1311406995
NM_004369.3(COL6A3):c.5128G>A (p.Val1710Ile) rs773631759
NM_004369.3(COL6A3):c.5165G>A (p.Gly1722Asp) rs1553556546
NM_004369.3(COL6A3):c.5179C>T (p.Arg1727Trp) rs143074017
NM_004369.3(COL6A3):c.5180G>A (p.Arg1727Gln)
NM_004369.3(COL6A3):c.5222A>T (p.Gln1741Leu)
NM_004369.3(COL6A3):c.5224C>T (p.Arg1742Trp)
NM_004369.3(COL6A3):c.5244T>A (p.Phe1748Leu)
NM_004369.3(COL6A3):c.5252C>T (p.Thr1751Met) rs201147199
NM_004369.3(COL6A3):c.5308G>C (p.Gly1770Arg)
NM_004369.3(COL6A3):c.5326G>T (p.Val1776Phe) rs754788931
NM_004369.3(COL6A3):c.5341A>G (p.Ile1781Val) rs145447965
NM_004369.3(COL6A3):c.5348C>T (p.Ser1783Leu) rs1271500443
NM_004369.3(COL6A3):c.5369C>T (p.Ala1790Val)
NM_004369.3(COL6A3):c.5387C>T (p.Ala1796Val)
NM_004369.3(COL6A3):c.5393G>A (p.Arg1798His) rs371441617
NM_004369.3(COL6A3):c.5419G>A (p.Glu1807Lys)
NM_004369.3(COL6A3):c.5470C>T (p.Leu1824Phe) rs114131542
NM_004369.3(COL6A3):c.5504G>C (p.Cys1835Ser) rs1559235332
NM_004369.3(COL6A3):c.550G>A (p.Ala184Thr) rs767499336
NM_004369.3(COL6A3):c.5534G>C (p.Gly1845Ala) rs747200439
NM_004369.3(COL6A3):c.5552T>C (p.Val1851Ala) rs1559235183
NM_004369.3(COL6A3):c.5635G>A (p.Gly1879Ser) rs760603443
NM_004369.3(COL6A3):c.5657G>A (p.Arg1886His) rs368379003
NM_004369.3(COL6A3):c.5678C>T (p.Thr1893Met)
NM_004369.3(COL6A3):c.5680C>T (p.Pro1894Ser) rs112540218
NM_004369.3(COL6A3):c.5681C>T (p.Pro1894Leu)
NM_004369.3(COL6A3):c.5690C>T (p.Pro1897Leu) rs370806359
NM_004369.3(COL6A3):c.5734G>A (p.Glu1912Lys) rs113251155
NM_004369.3(COL6A3):c.5743C>T (p.Arg1915Trp) rs201938007
NM_004369.3(COL6A3):c.5752C>A (p.Arg1918Ser) rs750367811
NM_004369.3(COL6A3):c.5768A>G (p.Tyr1923Cys)
NM_004369.3(COL6A3):c.5794G>A (p.Val1932Ile) rs113817270
NM_004369.3(COL6A3):c.5804A>G (p.Asn1935Ser)
NM_004369.3(COL6A3):c.581A>G (p.Asn194Ser)
NM_004369.3(COL6A3):c.5838+5G>A rs1553555753
NM_004369.3(COL6A3):c.5839-3C>T rs112825341
NM_004369.3(COL6A3):c.5869G>A (p.Gly1957Arg) rs554219567
NM_004369.3(COL6A3):c.5909G>A (p.Arg1970His) rs368635334
NM_004369.3(COL6A3):c.5953G>A (p.Val1985Met) rs200478135
NM_004369.3(COL6A3):c.5977C>T (p.His1993Tyr) rs1559231403
NM_004369.3(COL6A3):c.6001A>G (p.Met2001Val)
NM_004369.3(COL6A3):c.6054G>A (p.Ala2018=)
NM_004369.3(COL6A3):c.6068A>G (p.Asn2023Ser)
NM_004369.3(COL6A3):c.6086G>A (p.Cys2029Tyr)
NM_004369.3(COL6A3):c.6094G>T (p.Val2032Phe) rs1316305394
NM_004369.3(COL6A3):c.6117G>C (p.Gln2039His) rs750063736
NM_004369.3(COL6A3):c.611C>A (p.Thr204Asn)
NM_004369.3(COL6A3):c.6130G>A (p.Gly2044Arg) rs1559229322
NM_004369.3(COL6A3):c.6167G>A (p.Gly2056Glu) rs1064795558
NM_004369.3(COL6A3):c.6182G>A (p.Arg2061Gln) rs376715966
NM_004369.3(COL6A3):c.6199G>A (p.Glu2067Lys) rs760446904
NM_004369.3(COL6A3):c.6201G>C (p.Glu2067Asp)
NM_004369.3(COL6A3):c.6210C>T (p.Pro2070=) rs774374140
NM_004369.3(COL6A3):c.6211-4A>G rs398124127
NM_004369.3(COL6A3):c.6224C>T (p.Pro2075Leu)
NM_004369.3(COL6A3):c.6239G>T (p.Gly2080Val)
NM_004369.3(COL6A3):c.6242C>G (p.Thr2081Ser) rs1364892747
NM_004369.3(COL6A3):c.6263C>T (p.Pro2088Leu)
NM_004369.3(COL6A3):c.6289C>T (p.Arg2097Trp) rs148252611
NM_004369.3(COL6A3):c.6308A>G (p.Lys2103Arg)
NM_004369.3(COL6A3):c.6356G>A (p.Gly2119Glu)
NM_004369.3(COL6A3):c.6422C>A (p.Pro2141His) rs369169235
NM_004369.3(COL6A3):c.6443G>A (p.Arg2148Lys)
NM_004369.3(COL6A3):c.6451G>C (p.Val2151Leu) rs768565928
NM_004369.3(COL6A3):c.6452T>C (p.Val2151Ala)
NM_004369.3(COL6A3):c.6591+5G>A
NM_004369.3(COL6A3):c.6592G>A (p.Gly2198Ser) rs1257553370
NM_004369.3(COL6A3):c.6613C>A (p.Pro2205Thr) rs748768672
NM_004369.3(COL6A3):c.661G>A (p.Val221Met)
NM_004369.3(COL6A3):c.6640G>A (p.Gly2214Ser) rs777454204
NM_004369.3(COL6A3):c.6677C>T (p.Thr2226Ile) rs376621780
NM_004369.3(COL6A3):c.6715C>G (p.Pro2239Ala)
NM_004369.3(COL6A3):c.6730G>C (p.Glu2244Gln)
NM_004369.3(COL6A3):c.6749C>T (p.Pro2250Leu) rs140728855
NM_004369.3(COL6A3):c.6769G>A (p.Ala2257Thr) rs372154635
NM_004369.3(COL6A3):c.6799G>A (p.Gly2267Ser) rs749855513
NM_004369.3(COL6A3):c.6832C>A (p.Pro2278Thr)
NM_004369.3(COL6A3):c.6868C>T (p.Arg2290Cys) rs116608946
NM_004369.3(COL6A3):c.686C>T (p.Thr229Met) rs141586922
NM_004369.3(COL6A3):c.6898G>A (p.Gly2300Arg) rs763348222
NM_004369.3(COL6A3):c.6899G>A (p.Gly2300Glu) rs145572916
NM_004369.3(COL6A3):c.6902T>C (p.Val2301Ala)
NM_004369.3(COL6A3):c.6920G>C (p.Arg2307Thr) rs778845754
NM_004369.3(COL6A3):c.6930+4C>T rs375657891
NM_004369.3(COL6A3):c.6956C>T (p.Pro2319Leu) rs751617505
NM_004369.3(COL6A3):c.6966+4A>C rs373940717
NM_004369.3(COL6A3):c.6982C>A (p.Pro2328Thr) rs371637449
NM_004369.3(COL6A3):c.707C>T (p.Thr236Ile) rs886044270
NM_004369.3(COL6A3):c.709G>A (p.Ala237Thr) rs1553564820
NM_004369.3(COL6A3):c.7103G>A (p.Gly2368Asp) rs746420745
NM_004369.3(COL6A3):c.7114G>A (p.Asp2372Asn) rs142002241
NM_004369.3(COL6A3):c.7173C>T (p.Tyr2391=) rs114248590
NM_004369.3(COL6A3):c.7192G>A (p.Val2398Ile)
NM_004369.3(COL6A3):c.7256G>C (p.Gly2419Ala) rs1339553173
NM_004369.3(COL6A3):c.7290T>G (p.Asn2430Lys)
NM_004369.3(COL6A3):c.7311C>G (p.Ser2437Arg) rs781087176
NM_004369.3(COL6A3):c.7328C>T (p.Ala2443Val)
NM_004369.3(COL6A3):c.7331G>C (p.Arg2444Pro) rs895701604
NM_004369.3(COL6A3):c.7356C>G (p.Asn2452Lys)
NM_004369.3(COL6A3):c.7357G>A (p.Glu2453Lys) rs886044364
NM_004369.3(COL6A3):c.7375C>T (p.Arg2459Trp) rs371066956
NM_004369.3(COL6A3):c.7376G>A (p.Arg2459Gln) rs777496872
NM_004369.3(COL6A3):c.7402G>A (p.Val2468Ile) rs527516269
NM_004369.3(COL6A3):c.7441A>G (p.Thr2481Ala) rs201467603
NM_004369.3(COL6A3):c.7447A>G (p.Lys2483Glu) rs139260335
NM_004369.3(COL6A3):c.7475C>T (p.Ser2492Leu) rs754480145
NM_004369.3(COL6A3):c.7513G>A (p.Gly2505Arg) rs545819982
NM_004369.3(COL6A3):c.7514G>T (p.Gly2505Val) rs794727591
NM_004369.3(COL6A3):c.764G>A (p.Ser255Asn)
NM_004369.3(COL6A3):c.7660G>A (p.Ala2554Thr) rs786205870
NM_004369.3(COL6A3):c.7668G>T (p.Gln2556His) rs1553547891
NM_004369.3(COL6A3):c.7669-3C>T
NM_004369.3(COL6A3):c.7670T>A (p.Ile2557Asn)
NM_004369.3(COL6A3):c.7685T>C (p.Val2562Ala) rs143631346
NM_004369.3(COL6A3):c.7687G>A (p.Gly2563Arg) rs780964113
NM_004369.3(COL6A3):c.776C>T (p.Ala259Val) rs149924028
NM_004369.3(COL6A3):c.7948G>A (p.Asp2650Asn) rs890268146
NM_004369.3(COL6A3):c.8009C>T (p.Ala2670Val) rs142851023
NM_004369.3(COL6A3):c.8045C>T (p.Pro2682Leu)
NM_004369.3(COL6A3):c.8137A>G (p.Arg2713Gly) rs772602377
NM_004369.3(COL6A3):c.8168T>C (p.Ile2723Thr) rs373108028
NM_004369.3(COL6A3):c.8201G>A (p.Arg2734Gln) rs115116398
NM_004369.3(COL6A3):c.8243C>T (p.Pro2748Leu) rs115595706
NM_004369.3(COL6A3):c.8257G>A (p.Glu2753Lys)
NM_004369.3(COL6A3):c.8308G>A (p.Val2770Met) rs886044644
NM_004369.3(COL6A3):c.8359G>A (p.Ala2787Thr) rs763395740
NM_004369.3(COL6A3):c.8416G>A (p.Glu2806Lys)
NM_004369.3(COL6A3):c.8437G>A (p.Gly2813Arg) rs146131332
NM_004369.3(COL6A3):c.8440A>T (p.Arg2814Trp) rs1553546042
NM_004369.3(COL6A3):c.8522G>A (p.Gly2841Glu)
NM_004369.3(COL6A3):c.8615C>T (p.Thr2872Met) rs759009226
NM_004369.3(COL6A3):c.8621C>T (p.Thr2874Met) rs779335085
NM_004369.3(COL6A3):c.8627C>T (p.Pro2876Leu)
NM_004369.3(COL6A3):c.8632A>G (p.Thr2878Ala) rs761653490
NM_004369.3(COL6A3):c.8634_8651del (p.2875_2880KPVTTT[1]) rs780678900
NM_004369.3(COL6A3):c.8636C>T (p.Thr2879Met) rs150907698
NM_004369.3(COL6A3):c.8644C>T (p.Pro2882Ser) rs1553544899
NM_004369.3(COL6A3):c.8645C>T (p.Pro2882Leu)
NM_004369.3(COL6A3):c.8744C>T (p.Ala2915Val) rs751532649
NM_004369.3(COL6A3):c.8750C>A (p.Pro2917His) rs1559194476
NM_004369.3(COL6A3):c.8754G>A (p.Val2918=)
NM_004369.3(COL6A3):c.8759C>A (p.Ala2920Asp)
NM_004369.3(COL6A3):c.878T>C (p.Met293Thr) rs1361910233
NM_004369.3(COL6A3):c.8804C>A (p.Ala2935Glu)
NM_004369.3(COL6A3):c.8819C>T (p.Thr2940Met) rs200626456
NM_004369.3(COL6A3):c.8846C>T (p.Pro2949Leu) rs376021820
NM_004369.3(COL6A3):c.8861C>T (p.Pro2954Leu)
NM_004369.3(COL6A3):c.8966-3C>A rs190667494
NM_004369.3(COL6A3):c.8977C>T (p.Arg2993Cys)
NM_004369.3(COL6A3):c.898_900del (p.Ser300del) rs554176183
NM_004369.3(COL6A3):c.9041C>T (p.Pro3014Leu) rs758774990
NM_004369.3(COL6A3):c.9059A>G (p.Tyr3020Cys)
NM_004369.3(COL6A3):c.9061_9063del (p.Asp3021del) rs756150789
NM_004369.3(COL6A3):c.9087T>A (p.Asp3029Glu) rs1553544136
NM_004369.3(COL6A3):c.9116C>T (p.Thr3039Met) rs116655315
NM_004369.3(COL6A3):c.9209A>G (p.Tyr3070Cys) rs368568929
NM_004369.3(COL6A3):c.9229+4A>C
NM_004369.3(COL6A3):c.9250C>T (p.Pro3084Ser) rs1468004640
NM_004369.3(COL6A3):c.9344C>T (p.Pro3115Leu) rs138109666
NM_004369.3(COL6A3):c.9358A>C (p.Thr3120Pro) rs141050617
NM_004369.3(COL6A3):c.9374T>C (p.Ile3125Thr) rs1385929254
NM_004369.3(COL6A3):c.9380A>G (p.Lys3127Arg)
NM_004369.3(COL6A3):c.9407G>A (p.Ser3136Asn) rs759514583
NM_004369.3(COL6A3):c.9451A>G (p.Lys3151Glu) rs371468515
NM_004369.3(COL6A3):c.9487G>A (p.Ala3163Thr) rs553486570
NM_004369.3(COL6A3):c.9494-2A>G
NM_004369.3(COL6A3):c.9508G>A (p.Gly3170Arg) rs568632361
NM_004369.3(COL6A3):c.98A>G (p.Lys33Arg)
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.