ClinVar Miner

List of variants studied for acute hepatic porphyria

Included ClinVar conditions (14):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 413
Download table as spreadsheet
HGVS dbSNP
ALAD, IVS3AS, C-A, -11
HMBS, 2-BP DEL, 218AG
HMBS, 2-BP DEL, 847TG
HMBS, 9-BP DEL, EX10
HMBS, ALU INS
HMBS, EX12DEL
HMBS, IVS14DS, G-A, +1
NC_000001.9:g.157610062_160185096del2575035
NM_000031.6(ALAD):c.*106C>G rs8177820
NM_000031.6(ALAD):c.*127C>T rs561104906
NM_000031.6(ALAD):c.*1464A>G rs559359572
NM_000031.6(ALAD):c.*1470G>A rs886063360
NM_000031.6(ALAD):c.*1511T>C rs745513769
NM_000031.6(ALAD):c.*1631G>A rs886063359
NM_000031.6(ALAD):c.*1675C>T rs756771103
NM_000031.6(ALAD):c.*1741G>A rs886063358
NM_000031.6(ALAD):c.*1811_*1812del rs142213018
NM_000031.6(ALAD):c.*1864A>C rs886063357
NM_000031.6(ALAD):c.*1915del rs886063356
NM_000031.6(ALAD):c.*1950G>A rs818706
NM_000031.6(ALAD):c.*381G>A rs886063363
NM_000031.6(ALAD):c.*400G>A rs557867804
NM_000031.6(ALAD):c.*422G>T rs41276805
NM_000031.6(ALAD):c.*438G>C rs886063362
NM_000031.6(ALAD):c.*459_*463del rs886063361
NM_000031.6(ALAD):c.*471C>T rs818708
NM_000031.6(ALAD):c.*613G>A rs818707
NM_000031.6(ALAD):c.*676dup rs532401659
NM_000031.6(ALAD):c.*813A>G rs138705750
NM_000031.6(ALAD):c.*871C>A rs8177822
NM_000031.6(ALAD):c.-131C>T rs531786276
NM_000031.6(ALAD):c.-4C>T rs755977870
NM_000031.6(ALAD):c.-76+15G>T rs756965057
NM_000031.6(ALAD):c.15C>T (p.Ser5=) rs144608303
NM_000031.6(ALAD):c.165-11C>T rs749066913
NM_000031.6(ALAD):c.168T>C (p.Tyr56=) rs1139488
NM_000031.6(ALAD):c.16G>A (p.Val6Ile) rs766501537
NM_000031.6(ALAD):c.177G>C (p.Lys59Asn) rs1800435
NM_000031.6(ALAD):c.1A>G (p.Met1Val) rs752500552
NM_000031.6(ALAD):c.264C>T (p.Asp88=) rs377534006
NM_000031.6(ALAD):c.29G>C (p.Gly10Ala) rs199655229
NM_000031.6(ALAD):c.397+12C>T rs8177805
NM_000031.6(ALAD):c.397G>A (p.Gly133Arg) rs121912980
NM_000031.6(ALAD):c.414C>T (p.Asn138=) rs2228083
NM_000031.6(ALAD):c.439C>T (p.Arg147Cys) rs777664535
NM_000031.6(ALAD):c.463T>C (p.Leu155=) rs8177807
NM_000031.6(ALAD):c.501G>A (p.Pro167=) rs376714503
NM_000031.6(ALAD):c.520C>T (p.Arg174Cys) rs758622234
NM_000031.6(ALAD):c.521G>A (p.Arg174His) rs750462706
NM_000031.6(ALAD):c.678G>T (p.Leu226=) rs190497588
NM_000031.6(ALAD):c.715-14C>A rs201135240
NM_000031.6(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000031.6(ALAD):c.724G>A (p.Val242Ile) rs200180791
NM_000031.6(ALAD):c.72C>T (p.Thr24=) rs1805314
NM_000031.6(ALAD):c.820G>A (p.Ala274Thr) rs121912983
NM_000031.6(ALAD):c.823G>A (p.Val275Met) rs121912981
NM_000031.6(ALAD):c.897C>T (p.Ala299=) rs370242589
NM_000031.6(ALAD):c.931+15G>A rs886063364
NM_000031.6(ALAD):c.940A>G (p.Ile314Val) rs557510313
NM_000032.5(ALAS2):c.1642C>T (p.Gln548Ter) rs397514730
NM_000032.5(ALAS2):c.1651_1676del (p.Ser551fs) rs879255567
NM_000032.5(ALAS2):c.1699_1700del (p.Met567fs) rs387906473
NM_000032.5(ALAS2):c.1702_1705AGTG[1] (p.Glu569fs) rs387906472
NM_000032.5(ALAS2):c.1757A>T (p.Tyr586Phe) rs139596860
NM_000097.7(CPOX):c.*1072C>T rs148251059
NM_000097.7(CPOX):c.*1076G>A rs775384142
NM_000097.7(CPOX):c.*1105A>G rs73133922
NM_000097.7(CPOX):c.*1153G>C rs886058941
NM_000097.7(CPOX):c.*1174G>A rs886058940
NM_000097.7(CPOX):c.*136G>C rs142440038
NM_000097.7(CPOX):c.*162A>C rs1051712
NM_000097.7(CPOX):c.*194G>T rs886058946
NM_000097.7(CPOX):c.*227G>A rs146214523
NM_000097.7(CPOX):c.*28del rs144234554
NM_000097.7(CPOX):c.*329G>C rs72924727
NM_000097.7(CPOX):c.*340A>G rs886058945
NM_000097.7(CPOX):c.*381C>T rs141236816
NM_000097.7(CPOX):c.*475T>A rs72924726
NM_000097.7(CPOX):c.*498_*499insCA rs886058944
NM_000097.7(CPOX):c.*506C>T rs886058943
NM_000097.7(CPOX):c.*578_*579insTTCTTA rs3840202
NM_000097.7(CPOX):c.*633A>C rs886058942
NM_000097.7(CPOX):c.*66G>A rs886058947
NM_000097.7(CPOX):c.*679G>A rs72924722
NM_000097.7(CPOX):c.*73T>C rs139447447
NM_000097.7(CPOX):c.*927G>A rs7103
NM_000097.7(CPOX):c.*939A>G rs539237301
NM_000097.7(CPOX):c.*95G>A rs2229123
NM_000097.7(CPOX):c.-10G>A rs867711777
NM_000097.7(CPOX):c.-43G>C rs763595872
NM_000097.7(CPOX):c.-54C>T rs75986763
NM_000097.7(CPOX):c.-55G>C rs115030377
NM_000097.7(CPOX):c.-56G>C rs184287214
NM_000097.7(CPOX):c.1054C>T (p.Arg352Cys) rs11921054
NM_000097.7(CPOX):c.1108A>G (p.Lys370Glu) rs778583962
NM_000097.7(CPOX):c.1172+14A>G rs16839985
NM_000097.7(CPOX):c.125G>C (p.Ser42Thr) rs886058951
NM_000097.7(CPOX):c.1266T>A (p.Pro422=) rs563304155
NM_000097.7(CPOX):c.130G>T (p.Ala44Ser) rs886058950
NM_000097.7(CPOX):c.1339C>T (p.Arg447Cys) rs28931603
NM_000097.7(CPOX):c.156C>G (p.Gly52=) rs886058949
NM_000097.7(CPOX):c.165C>T (p.Gly55=) rs563975822
NM_000097.7(CPOX):c.167C>T (p.Thr56Met) rs886058948
NM_000097.7(CPOX):c.252G>A (p.Gly84=) rs376917019
NM_000097.7(CPOX):c.284A>G (p.His95Arg) rs192332456
NM_000097.7(CPOX):c.299A>T (p.Glu100Val) rs367822877
NM_000097.7(CPOX):c.337C>T (p.Leu113=) rs146543713
NM_000097.7(CPOX):c.33C>T (p.Gly11=) rs60690253
NM_000097.7(CPOX):c.348G>C (p.Pro116=) rs140566686
NM_000097.7(CPOX):c.395C>T (p.Ala132Val) rs147219463
NM_000097.7(CPOX):c.487G>T (p.Val163Leu) rs535432218
NM_000097.7(CPOX):c.556+9G>A rs184983281
NM_000097.7(CPOX):c.612G>A (p.Gly204=) rs149384011
NM_000097.7(CPOX):c.651A>G (p.Glu217=) rs138479596
NM_000097.7(CPOX):c.814A>C (p.Asn272His) rs1131857
NM_000097.7(CPOX):c.86A>C (p.Gln29Pro) rs886058952
NM_000097.7(CPOX):c.880G>A (p.Val294Ile) rs2228056
NM_000097.7(CPOX):c.990A>G (p.Glu330=) rs1729995
NM_000140.3(FECH):c.1078_1137del rs879255507
NM_000140.3(FECH):c.195_314del rs786205246
NM_000140.3(FECH):c.68_194del rs786205247
NM_000140.3(FECH):c.[1224T>A;1225C>T;1231T>G]
NM_000140.4(FECH):c.*1032G>A rs140863287
NM_000140.4(FECH):c.*1039G>A rs185134664
NM_000140.4(FECH):c.*1054T>C rs192343321
NM_000140.4(FECH):c.*1071C>G rs886053992
NM_000140.4(FECH):c.*1170T>A rs886053991
NM_000140.4(FECH):c.*1170_*1176delinsAAATCTTCTATGTTTGTATTACTCTCTGGTAA rs886053988
NM_000140.4(FECH):c.*1173A>T rs868017208
NM_000140.4(FECH):c.*1175G>A rs886053990
NM_000140.4(FECH):c.*1176G>A rs886053989
NM_000140.4(FECH):c.*117C>T rs8099115
NM_000140.4(FECH):c.*1287T>A rs113654252
NM_000140.4(FECH):c.*1287_*1288insTA rs59569925
NM_000140.4(FECH):c.*1287_*1288insTTTA rs59569925
NM_000140.4(FECH):c.*1348T>G rs886053987
NM_000140.4(FECH):c.*136G>C rs886053995
NM_000140.4(FECH):c.*1453T>C rs886053986
NM_000140.4(FECH):c.*1479T>C rs112062178
NM_000140.4(FECH):c.*1508G>A rs540286571
NM_000140.4(FECH):c.*1567A>G rs574153215
NM_000140.4(FECH):c.*1622T>C rs78359676
NM_000140.4(FECH):c.*1915G>T rs148459563
NM_000140.4(FECH):c.*1950A>G rs886053985
NM_000140.4(FECH):c.*1966G>T rs779669357
NM_000140.4(FECH):c.*2060C>T rs886053984
NM_000140.4(FECH):c.*2079C>T rs886053983
NM_000140.4(FECH):c.*2371T>G rs1062010
NM_000140.4(FECH):c.*2436_*2440GTTTT[2] rs886053981
NM_000140.4(FECH):c.*2441G>T rs886053982
NM_000140.4(FECH):c.*2443T>G rs201834035
NM_000140.4(FECH):c.*2446G>T rs4940895
NM_000140.4(FECH):c.*2450_*2451insG rs886053980
NM_000140.4(FECH):c.*2451T>G rs55769459
NM_000140.4(FECH):c.*2451_*2452insG rs1555678907
NM_000140.4(FECH):c.*2459_*2461dup rs529946604
NM_000140.4(FECH):c.*2461dup rs529946604
NM_000140.4(FECH):c.*248C>T rs8339
NM_000140.4(FECH):c.*2513G>A rs886053978
NM_000140.4(FECH):c.*2526T>C rs2723680
NM_000140.4(FECH):c.*2599C>T rs886053977
NM_000140.4(FECH):c.*2600G>A rs886053976
NM_000140.4(FECH):c.*2644A>G rs558443758
NM_000140.4(FECH):c.*2739T>C rs111695226
NM_000140.4(FECH):c.*2782G>T rs886053975
NM_000140.4(FECH):c.*2788G>A rs145954113
NM_000140.4(FECH):c.*2825A>G rs8090261
NM_000140.4(FECH):c.*2840C>T rs568628377
NM_000140.4(FECH):c.*3129C>T rs137955859
NM_000140.4(FECH):c.*3170T>C rs75976774
NM_000140.4(FECH):c.*3339G>A rs113928110
NM_000140.4(FECH):c.*3377G>T rs480942
NM_000140.4(FECH):c.*347G>A rs113392534
NM_000140.4(FECH):c.*3567G>A rs556538397
NM_000140.4(FECH):c.*3601A>G rs73453635
NM_000140.4(FECH):c.*3656C>T rs886053974
NM_000140.4(FECH):c.*3691C>T rs148141502
NM_000140.4(FECH):c.*3716C>T rs567960865
NM_000140.4(FECH):c.*3719C>T rs886053973
NM_000140.4(FECH):c.*3753_*3754insT rs886053972
NM_000140.4(FECH):c.*3788A>G rs886053971
NM_000140.4(FECH):c.*3804G>A rs190604320
NM_000140.4(FECH):c.*3841C>T rs143797631
NM_000140.4(FECH):c.*394C>G rs781751487
NM_000140.4(FECH):c.*3976C>T rs886053970
NM_000140.4(FECH):c.*4056C>T rs181920623
NM_000140.4(FECH):c.*4077C>T rs548648988
NM_000140.4(FECH):c.*4106A>G rs72940306
NM_000140.4(FECH):c.*422T>A rs3760612
NM_000140.4(FECH):c.*4237A>G rs886053969
NM_000140.4(FECH):c.*4336A>G rs769571284
NM_000140.4(FECH):c.*4337G>A rs747976113
NM_000140.4(FECH):c.*4363G>A rs375097125
NM_000140.4(FECH):c.*4367C>T rs146417207
NM_000140.4(FECH):c.*4368G>A rs543603003
NM_000140.4(FECH):c.*443A>C rs886053994
NM_000140.4(FECH):c.*4445G>A rs578202706
NM_000140.4(FECH):c.*4449A>G rs886053968
NM_000140.4(FECH):c.*4458C>T rs113000324
NM_000140.4(FECH):c.*4463A>G rs7228449
NM_000140.4(FECH):c.*4528C>T rs564734119
NM_000140.4(FECH):c.*4563G>T rs663774
NM_000140.4(FECH):c.*4597T>C rs147684323
NM_000140.4(FECH):c.*4598T>G rs886053967
NM_000140.4(FECH):c.*4720T>C rs760022638
NM_000140.4(FECH):c.*4793_*4795TTA[1] rs137860528
NM_000140.4(FECH):c.*481A>G rs3760613
NM_000140.4(FECH):c.*4829C>T rs565989254
NM_000140.4(FECH):c.*4883_*4884insC rs201434287
NM_000140.4(FECH):c.*4886T>G rs7238897
NM_000140.4(FECH):c.*4891dup rs146687823
NM_000140.4(FECH):c.*4971A>G rs114530851
NM_000140.4(FECH):c.*5090G>A rs776370345
NM_000140.4(FECH):c.*5139C>T rs151197779
NM_000140.4(FECH):c.*5140G>A rs55987829
NM_000140.4(FECH):c.*5143C>T rs139987131
NM_000140.4(FECH):c.*5170T>C rs886053966
NM_000140.4(FECH):c.*5247T>C rs375220859
NM_000140.4(FECH):c.*5349C>T rs189146107
NM_000140.4(FECH):c.*5394G>T rs145935279
NM_000140.4(FECH):c.*5588G>A rs78224804
NM_000140.4(FECH):c.*55C>T rs886053997
NM_000140.4(FECH):c.*5628C>A rs13732
NM_000140.4(FECH):c.*571G>A rs114617188
NM_000140.4(FECH):c.*5801T>G rs139119026
NM_000140.4(FECH):c.*592C>T rs577112809
NM_000140.4(FECH):c.*60T>C rs886053996
NM_000140.4(FECH):c.*696C>T rs76175837
NM_000140.4(FECH):c.*825T>C rs886053993
NM_000140.4(FECH):c.*892T>C rs13271
NM_000140.4(FECH):c.*936C>T rs144709743
NM_000140.4(FECH):c.1001C>T (p.Pro334Leu) rs150146721
NM_000140.4(FECH):c.1077+1G>A rs786205245
NM_000140.4(FECH):c.1085T>G (p.Val362Gly) rs118204040
NM_000140.4(FECH):c.1136del (p.Lys379fs) rs764466739
NM_000140.4(FECH):c.1137+3A>G rs202147607
NM_000140.4(FECH):c.1250T>C (p.Phe417Ser) rs118204039
NM_000140.4(FECH):c.132C>T (p.Ala44=) rs147500247
NM_000140.4(FECH):c.139A>G (p.Thr47Ala) rs144831860
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000140.4(FECH):c.185C>G (p.Pro62Arg) rs150830931
NM_000140.4(FECH):c.202A>G (p.Lys68Glu) rs756377185
NM_000140.4(FECH):c.287G>A (p.Arg96Gln) rs1041951
NM_000140.4(FECH):c.314+2T>G rs149067146
NM_000140.4(FECH):c.315-48T>C rs2272783
NM_000140.4(FECH):c.362A>G (p.Glu121Gly) rs141813907
NM_000140.4(FECH):c.385G>A (p.Gly129Arg) rs138714094
NM_000140.4(FECH):c.514G>A (p.Glu172Lys) rs200650502
NM_000140.4(FECH):c.553G>A (p.Ala185Thr) rs397514476
NM_000140.4(FECH):c.580_584del (p.Tyr194fs) rs786205248
NM_000140.4(FECH):c.598+12T>A rs370521491
NM_000140.4(FECH):c.68-23C>T rs2269219
NM_000140.4(FECH):c.798C>G (p.Pro266=) rs536765
NM_000140.4(FECH):c.801G>A (p.Met267Ile) rs118204037
NM_000140.4(FECH):c.819C>T (p.Gly273=) rs138840143
NM_000140.4(FECH):c.820G>A (p.Asp274Asn) rs146269992
NM_000140.4(FECH):c.854A>G (p.Gln285Arg) rs370708663
NM_000140.4(FECH):c.912+14A>G rs886053999
NM_000140.4(FECH):c.913-13A>G rs200538834
NM_000140.4(FECH):c.913-7C>T rs369538477
NM_000140.4(FECH):c.913G>T (p.Val305Phe) rs765518889
NM_000140.4(FECH):c.921A>G (p.Pro307=) rs536560
NM_000140.4(FECH):c.935G>T (p.Gly312Val) rs886053998
NM_000190.3:c.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT rs1555206402
NM_000190.4(HMBS):c.*101G>A rs565181447
NM_000190.4(HMBS):c.*194A>G rs886047756
NM_000190.4(HMBS):c.*94T>C rs886047755
NM_000190.4(HMBS):c.-28A>C rs201349602
NM_000190.4(HMBS):c.-65C>T rs589925
NM_000190.4(HMBS):c.100C>A (p.Gln34Lys) rs118204105
NM_000190.4(HMBS):c.1020C>T (p.Asn340=) rs146585331
NM_000190.4(HMBS):c.1026G>A (p.Leu342=) rs199845143
NM_000190.4(HMBS):c.105G>C (p.Thr35=) rs370081222
NM_000190.4(HMBS):c.1075G>A (p.Asp359Asn) rs144949995
NM_000190.4(HMBS):c.135G>A (p.Ser45=) rs146801283
NM_000190.4(HMBS):c.163G>T (p.Ala55Ser) rs118204106
NM_000190.4(HMBS):c.174del (p.Thr59fs) rs1565754285
NM_000190.4(HMBS):c.181dup (p.Asp61fs) rs1565754296
NM_000190.4(HMBS):c.210+5C>A rs79983883
NM_000190.4(HMBS):c.211-1G>A rs1565754452
NM_000190.4(HMBS):c.242T>C (p.Leu81Pro) rs118204119
NM_000190.4(HMBS):c.257A>T (p.Glu86Val) rs150763621
NM_000190.4(HMBS):c.266+1G>C rs1565754565
NM_000190.4(HMBS):c.303C>T (p.Pro101=) rs139147408
NM_000190.4(HMBS):c.331G>A (p.Gly111Arg) rs118204107
NM_000190.4(HMBS):c.345-9C>T rs772934410
NM_000190.4(HMBS):c.346C>T (p.Arg116Trp) rs118204094
NM_000190.4(HMBS):c.445C>T (p.Arg149Ter) rs118204120
NM_000190.4(HMBS):c.446G>A (p.Arg149Gln) rs118204098
NM_000190.4(HMBS):c.463C>T (p.Gln155Ter) rs118204097
NM_000190.4(HMBS):c.499-1G>A rs1565756481
NM_000190.4(HMBS):c.499C>T (p.Arg167Trp) rs118204101
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.500G>T (p.Arg167Leu) rs118204095
NM_000190.4(HMBS):c.518G>A (p.Arg173Gln) rs118204096
NM_000190.4(HMBS):c.530T>G (p.Leu177Arg) rs118204108
NM_000190.4(HMBS):c.532G>A (p.Asp178Asn) rs536814318
NM_000190.4(HMBS):c.583C>T (p.Arg195Cys) rs34413634
NM_000190.4(HMBS):c.593G>A (p.Trp198Ter) rs118204100
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.606G>T (p.Val202=) rs1131488
NM_000190.4(HMBS):c.612+4G>A rs745705652
NM_000190.4(HMBS):c.613-19C>A rs1784304
NM_000190.4(HMBS):c.615C>G (p.Ile205Met) rs774594843
NM_000190.4(HMBS):c.647G>A (p.Gly216Asp) rs118204116
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000190.4(HMBS):c.669_698del (p.Glu223_Leu232del) rs1555206128
NM_000190.4(HMBS):c.674G>A (p.Arg225Gln) rs142459647
NM_000190.4(HMBS):c.717C>T (p.His239=) rs114025170
NM_000190.4(HMBS):c.723C>T (p.Pro241=) rs202067277
NM_000190.4(HMBS):c.728_729CT[1] (p.Leu244fs) rs1565757839
NM_000190.4(HMBS):c.734T>G (p.Leu245Arg) rs118204099
NM_000190.4(HMBS):c.734_741dup (p.Ile248fs) rs1565757857
NM_000190.4(HMBS):c.737G>A (p.Arg246His) rs201909197
NM_000190.4(HMBS):c.739T>C (p.Cys247Arg) rs118204111
NM_000190.4(HMBS):c.748G>A (p.Glu250Lys) rs118204112
NM_000190.4(HMBS):c.754G>A (p.Ala252Thr) rs118204113
NM_000190.4(HMBS):c.755C>T (p.Ala252Val) rs118204114
NM_000190.4(HMBS):c.766C>A (p.His256Asn) rs118204115
NM_000190.4(HMBS):c.771+1G>C rs1565758008
NM_000190.4(HMBS):c.77G>A (p.Arg26His) rs118204103
NM_000190.4(HMBS):c.815A>C (p.Lys272Thr) rs1057519252
NM_000190.4(HMBS):c.849G>A (p.Trp283Ter) rs118204117
NM_000190.4(HMBS):c.88-14G>A rs17075
NM_000190.4(HMBS):c.891dup (p.Thr298fs) rs1565758795
NM_000190.4(HMBS):c.900del (p.His300fs) rs1565758825
NM_000190.4(HMBS):c.91G>A (p.Ala31Thr) rs118204104
NM_000190.4(HMBS):c.962G>A (p.Arg321His) rs150428209
NM_000374.4(UROD):c.*80A>G rs144315045
NM_000374.4(UROD):c.-51T>C rs370067756
NM_000374.4(UROD):c.-52C>A rs41269103
NM_000374.4(UROD):c.-67G>A rs767012968
NM_000374.5(UROD):c.*3G>A rs74349352
NM_000374.5(UROD):c.*45C>T rs371078664
NM_000374.5(UROD):c.-134T>G rs7536892
NM_000374.5(UROD):c.-1C>T rs886046364
NM_000374.5(UROD):c.-57dup rs777548921
NM_000374.5(UROD):c.185C>T (p.Pro62Leu) rs121918060
NM_000374.5(UROD):c.346C>T (p.Gln116Ter) rs397514765
NM_000374.5(UROD):c.450G>A (p.Pro150=) rs2234479
NM_000374.5(UROD):c.474+15G>C rs369108963
NM_000374.5(UROD):c.494T>G (p.Met165Arg) rs121918063
NM_000374.5(UROD):c.499G>A (p.Glu167Lys) rs121918058
NM_000374.5(UROD):c.578G>C (p.Arg193Pro) rs143823335
NM_000374.5(UROD):c.583C>T (p.Leu195Phe) rs121918064
NM_000374.5(UROD):c.603A>G (p.Pro201=) rs2228084
NM_000374.5(UROD):c.636+1G>C rs145195562
NM_000374.5(UROD):c.693G>A (p.Lys231=) rs143180539
NM_000374.5(UROD):c.6_15del (p.Glu2fs) rs397514764
NM_000374.5(UROD):c.738C>T (p.Ala246=) rs757178659
NM_000374.5(UROD):c.758T>A (p.Leu253Gln) rs36033115
NM_000374.5(UROD):c.842G>A (p.Gly281Glu) rs121918057
NM_000374.5(UROD):c.842G>T (p.Gly281Val) rs121918057
NM_000374.5(UROD):c.874C>G (p.Arg292Gly) rs121918059
NM_000374.5(UROD):c.912C>A (p.Asn304Lys) rs121918065
NM_000374.5(UROD):c.932A>G (p.Tyr311Cys) rs121918061
NM_000374.5(UROD):c.942G>A (p.Glu314=) rs121918062
NM_000374.5(UROD):c.995G>A (p.Arg332His) rs121918066
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_001003945.2(ALAD):c.-234C>G rs7026518
NM_001003945.2(ALAD):c.-234dup rs143518565
NM_001003945.2(ALAD):c.-235C>A rs562413861
NM_001003945.2(ALAD):c.-235_-234dup rs143518565
NM_001003945.2(ALAD):c.-235_-234insGC rs879417667
NM_001003945.2(ALAD):c.-237_-234dup rs143518565
NM_001003945.2(ALAD):c.-239_-238insA rs886063365
NM_001003945.2(ALAD):c.-256C>T rs28550589
NM_001003945.2(ALAD):c.-276G>T rs376588496
NM_001122764.3(PPOX):c.-128C>G rs72714915
NM_001122764.3(PPOX):c.-149G>T rs186428034
NM_001122764.3(PPOX):c.-151G>T rs115158839
NM_001122764.3(PPOX):c.-174A>G rs886045451
NM_001122764.3(PPOX):c.-180T>C rs886045450
NM_001122764.3(PPOX):c.-1C>T rs148045152
NM_001122764.3(PPOX):c.-246G>T rs114493458
NM_001122764.3(PPOX):c.-247C>A rs2301286
NM_001122764.3(PPOX):c.-251G>C rs368129128
NM_001122764.3(PPOX):c.-2G>T rs779526273
NM_001122764.3(PPOX):c.1062T>C (p.Pro354=) rs771215757
NM_001122764.3(PPOX):c.1087C>G (p.Leu363Val) rs886045455
NM_001122764.3(PPOX):c.1248+4A>G rs775748399
NM_001122764.3(PPOX):c.1303C>T (p.Gln435Ter) rs754313121
NM_001122764.3(PPOX):c.175C>T (p.Arg59Trp) rs121918324
NM_001122764.3(PPOX):c.199del (p.Ala66_Leu67insTer) rs786204784
NM_001122764.3(PPOX):c.338+9A>G rs886045453
NM_001122764.3(PPOX):c.35T>C (p.Ile12Thr) rs28936677
NM_001122764.3(PPOX):c.360C>T (p.Pro120=) rs148730591
NM_001122764.3(PPOX):c.471+3G>A rs200920978
NM_001122764.3(PPOX):c.502C>T (p.Arg168Cys) rs121918325
NM_001122764.3(PPOX):c.503G>A (p.Arg168His) rs41270025
NM_001122764.3(PPOX):c.522C>T (p.Asn174=) rs886045454
NM_001122764.3(PPOX):c.590T>C (p.Ile197Thr) rs1553238545
NM_001122764.3(PPOX):c.59A>C (p.His20Pro) rs121918326
NM_001122764.3(PPOX):c.617-6C>T rs200192089
NM_001122764.3(PPOX):c.646A>G (p.Ile216Val) rs758572020
NM_001122764.3(PPOX):c.694G>C (p.Gly232Arg) rs121918323
NM_001122764.3(PPOX):c.69G>T (p.Arg23=) rs886045452
NM_001122764.3(PPOX):c.869-3_869-2del rs1558033572
NM_001122764.3(PPOX):c.87+13C>T rs201155115
NM_001122764.3(PPOX):c.911G>A (p.Arg304His) rs36013429
NM_001122764.3(PPOX):c.936G>A (p.Val312=) rs751511778
NM_001382.4(DPAGT1):c.*159G>A rs74992671
NM_001382.4(DPAGT1):c.*184G>A rs8551
NM_001382.4(DPAGT1):c.*265A>G rs28990974
NM_001382.4(DPAGT1):c.*417T>C rs7759
NM_001382.4(DPAGT1):c.*427T>G rs28990975
NM_001382.4(DPAGT1):c.1177A>G (p.Ile393Val) rs643788
NM_001382.4(DPAGT1):c.994T>G (p.Phe332Val) rs138544311
NM_006660.5(CLPX):c.893G>A (p.Gly298Asp) rs1555412542
PPOX, 1-BP INS, 1022G
PPOX, 2-BP DEL, 537AT
PPOX, 5-BP DEL, NT1239

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.