ClinVar Miner

List of variants in gene TBC1D24 reported as benign for infancy electroclinical syndrome

Included ClinVar conditions (46):

Angelman syndrome; Developmental and epileptic encephalopathy, 2
Autism; Seizures, benign familial infantile, 3; Episodic ataxia, type 9; Developmental and epileptic encephalopathy, 76
Benign familial infantile epilepsy
Benign familial neonatal-infantile seizures 1; Developmental and epileptic encephalopathy, 11; Intellectual disability
Benign familial neonatal-infantile seizures 1; Seizures, benign familial infantile, 3; Developmental and epileptic encephalopathy, 11; SCN2A-related generalized epilepsy with febrile seizures plus
Cognitive impairment with or without cerebellar ataxia; Developmental and epileptic encephalopathy, 13; Seizures, benign familial infantile, 5
Cognitive impairment with or without cerebellar ataxia; Developmental and epileptic encephalopathy, 13; Seizures, benign familial infantile, 5; Myoclonus, familial, 2
Developmental and epileptic encephalopathy, 1
Developmental and epileptic encephalopathy, 12
Developmental and epileptic encephalopathy, 13; Seizures, benign familial infantile, 5
Developmental and epileptic encephalopathy, 13; Seizures, benign familial infantile, 5; Myoclonus, familial, 2
Developmental and epileptic encephalopathy, 15
Developmental and epileptic encephalopathy, 1; Autosomal dominant nonsyndromic hearing loss 65; Caused by mutation in the TBC1 domain family, member 24
Developmental and epileptic encephalopathy, 1; Autosomal recessive spinocerebellar ataxia 12
Developmental and epileptic encephalopathy, 1; Congenital disorder of glycosylation
Developmental and epileptic encephalopathy, 1; Developmental and epileptic encephalopathy, 2; Angelman syndrome-like
Developmental and epileptic encephalopathy, 1; Intellectual disability, X-linked, with or without seizures, arx-related
Developmental and epileptic encephalopathy, 1; Intellectual disability, X-linked, with or without seizures, arx-related; Corpus callosum agenesis-abnormal genitalia syndrome; Partington syndrome
Developmental and epileptic encephalopathy, 1; Intellectual disability, X-linked, with or without seizures, arx-related; Corpus callosum agenesis-abnormal genitalia syndrome; X-linked lissencephaly with abnormal genitalia; Partington syndrome
Developmental and epileptic encephalopathy, 2
Developmental and epileptic encephalopathy, 27
Developmental and epileptic encephalopathy, 2; Angelman syndrome-like
Developmental and epileptic encephalopathy, 30
Developmental and epileptic encephalopathy, 40
Developmental and epileptic encephalopathy, 4; West syndrome; Cerebellar vermis hypoplasia
Developmental and epileptic encephalopathy, 5
Developmental and epileptic encephalopathy, 5; Neuronopathy, distal hereditary motor, autosomal dominant 11; Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia; Developmental delay with or without epilepsy
Generalized epilepsy with febrile seizures plus, type 1; Developmental and epileptic encephalopathy, 1; Atrial fibrillation, familial, 1; Brugada syndrome 5
Infantile spasms
Intellectual disability, autosomal dominant 6; Developmental and epileptic encephalopathy, 27
Intellectual disability, autosomal dominant 6; West syndrome; Lennox-Gastaut syndrome; GRIN2B-related developmental delay, intellectual disability and autism spectrum disorder
Intellectual disability, autosomal recessive 12; Developmental and epileptic encephalopathy, 15
Seizures, benign familial infantile, 2
Seizures, benign familial infantile, 2; Episodic kinesigenic dyskinesia 1
Seizures, benign familial infantile, 2; Episodic kinesigenic dyskinesia 1; Infantile convulsions and choreoathetosis
Seizures, benign familial infantile, 3
Seizures, benign familial infantile, 3; Developmental and epileptic encephalopathy, 11
Seizures, benign familial infantile, 3; Developmental and epileptic encephalopathy, 11; Episodic ataxia, type 9
Seizures, benign familial infantile, 3; Developmental and epileptic encephalopathy, 11; Episodic ataxia, type 9; Complex neurodevelopmental disorder
Seizures, benign familial infantile, 3; Developmental and epileptic encephalopathy, 1; Autism spectrum disorder; SCN2A-related generalized epilepsy with febrile seizures plus; West syndrome; Myoclonic-astatic epilepsy; Non-syndromic intellectual disability; Lennox-Gastaut syndrome; Continuous spikes and waves during sleep
Seizures, benign familial infantile, 3; SCN2A-related generalized epilepsy with febrile seizures plus
Seizures, benign familial infantile, 5
West syndrome
West syndrome; Early infantile epileptic encephalopathy with suppression bursts
West syndrome; Lennox-Gastaut syndrome
West syndrome; Tubulinopathy-associated dysgyria

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 21

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_001199107.2(TBC1D24):c.207T>C (p.Pro69=)	rs13339237	0.06245
NM_001199107.2(TBC1D24):c.1440G>A (p.Ser480=)	rs12373107	0.02286
NM_001199107.2(TBC1D24):c.1143-6C>T	rs73490287	0.02047
NM_001199107.2(TBC1D24):c.1526-20C>T	rs114367256	0.01755
NM_001199107.2(TBC1D24):c.1509C>T (p.Ser503=)	rs189089167	0.01110
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu)	rs72768728	0.00609
NM_001199107.2(TBC1D24):c.1500G>A (p.Ala500=)	rs201059992	0.00334
NM_001199107.2(TBC1D24):c.1326C>T (p.Tyr442=)	rs184639841	0.00324
NM_001199107.2(TBC1D24):c.1427C>A (p.Ala476Asp)	rs202216463	0.00304
NM_001199107.2(TBC1D24):c.441C>T (p.Asp147=)	rs149371169	0.00200
NM_001199107.2(TBC1D24):c.1142+17C>A	rs199499346	0.00163
NM_001199107.2(TBC1D24):c.1002C>T (p.Ala334=)	rs184389316	0.00160
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys)	rs202162520	0.00121
NM_001199107.2(TBC1D24):c.657G>A (p.Glu219=)	rs587781187	0.00109
NM_001199107.2(TBC1D24):c.1473C>G (p.Pro491=)	rs370427146	0.00071
NM_001199107.2(TBC1D24):c.204G>A (p.Thr68=)	rs201374999	0.00038
NM_001199107.2(TBC1D24):c.1074C>T (p.Pro358=)	rs75961715	0.00021
NM_001199107.2(TBC1D24):c.663C>T (p.Pro221=)	rs148670169	0.00019
NM_001199107.2(TBC1D24):c.1207-16C>G	rs201618854	0.00016
NM_001199107.2(TBC1D24):c.965+11G>A	rs568663296	0.00002
NM_001199107.2(TBC1D24):c.1206+20CCAGGGCTGGCTCTGATGGGCT[2]	rs777798547

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.