ClinVar Miner

List of variants in gene MED12 reported as uncertain significance for X-linked disease

Included ClinVar conditions (313):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 92
Download table as spreadsheet
NM_005120.3(MED12):c.1022C>T (p.Thr341Ile)
NM_005120.3(MED12):c.1030A>C (p.Thr344Pro) rs1556334571
NM_005120.3(MED12):c.1039A>G (p.Ser347Gly) rs752300879
NM_005120.3(MED12):c.1208A>G (p.Asn403Ser) rs1602295395
NM_005120.3(MED12):c.1264C>T (p.Arg422Trp) rs368913305
NM_005120.3(MED12):c.1376C>T (p.Thr459Ile)
NM_005120.3(MED12):c.1485+5G>A rs1006276729
NM_005120.3(MED12):c.1619G>A (p.Arg540His) rs774363039
NM_005120.3(MED12):c.1682C>T (p.Pro561Leu) rs766485358
NM_005120.3(MED12):c.1744+4C>T rs780750721
NM_005120.3(MED12):c.1744+5G>A rs368353373
NM_005120.3(MED12):c.1924G>A (p.Asp642Asn) rs1556335288
NM_005120.3(MED12):c.1963A>G (p.Ser655Gly) rs1569481250
NM_005120.3(MED12):c.2023C>T (p.Leu675Phe)
NM_005120.3(MED12):c.2068A>G (p.Thr690Ala) rs878854752
NM_005120.3(MED12):c.2129T>C (p.Val710Ala)
NM_005120.3(MED12):c.2203G>A (p.Ala735Thr)
NM_005120.3(MED12):c.2227-4G>A rs751157238
NM_005120.3(MED12):c.2383C>T (p.Pro795Ser) rs1602297729
NM_005120.3(MED12):c.2422+6T>G rs1569481413
NM_005120.3(MED12):c.2450G>A (p.Arg817His) rs749801457
NM_005120.3(MED12):c.2545T>C (p.Ser849Pro) rs1135401775
NM_005120.3(MED12):c.281C>T (p.Pro94Leu) rs1602293842
NM_005120.3(MED12):c.3110C>T (p.Thr1037Met) rs377078179
NM_005120.3(MED12):c.3125G>A (p.Ser1042Asn) rs1556336419
NM_005120.3(MED12):c.3149G>A (p.Arg1050His)
NM_005120.3(MED12):c.3210-27C>T rs752463122
NM_005120.3(MED12):c.3587C>A (p.Thr1196Lys) rs1556336812
NM_005120.3(MED12):c.3691+4C>T rs373381746
NM_005120.3(MED12):c.3693G>T (p.Gly1231=) rs965896553
NM_005120.3(MED12):c.3721A>G (p.Thr1241Ala) rs1028631372
NM_005120.3(MED12):c.3745C>T (p.Leu1249Phe) rs1422779785
NM_005120.3(MED12):c.3762_3764AGG[1] (p.Gly1257del) rs1602300077
NM_005120.3(MED12):c.3769G>A (p.Gly1257Ser) rs776373565
NM_005120.3(MED12):c.3796C>T (p.Arg1266Cys) rs1060502168
NM_005120.3(MED12):c.3985C>G (p.Arg1329Gly)
NM_005120.3(MED12):c.4021C>T (p.Arg1341Trp) rs777250096
NM_005120.3(MED12):c.4028G>A (p.Arg1343His) rs201044355
NM_005120.3(MED12):c.4154C>T (p.Ala1385Val) rs771349148
NM_005120.3(MED12):c.4231A>G (p.Ser1411Gly) rs961569982
NM_005120.3(MED12):c.4238C>A (p.Thr1413Asn) rs759532414
NM_005120.3(MED12):c.4253+4G>A rs750162341
NM_005120.3(MED12):c.4651A>G (p.Thr1551Ala) rs1375497967
NM_005120.3(MED12):c.5017_5019AAG[1] (p.Lys1674del)
NM_005120.3(MED12):c.503C>T (p.Ala168Val) rs1602294043
NM_005120.3(MED12):c.5192G>A (p.Arg1731Lys) rs1569482278
NM_005120.3(MED12):c.5252C>T (p.Pro1751Leu) rs748064846
NM_005120.3(MED12):c.5258C>T (p.Ala1753Val) rs1246253918
NM_005120.3(MED12):c.5336C>T (p.Thr1779Ile) rs1556338856
NM_005120.3(MED12):c.5345G>A (p.Arg1782His) rs1060502167
NM_005120.3(MED12):c.5360C>G (p.Thr1787Ser) rs1444442163
NM_005120.3(MED12):c.5423G>A (p.Arg1808Gln) rs1432487094
NM_005120.3(MED12):c.5476C>T (p.Pro1826Ser) rs867576281
NM_005120.3(MED12):c.5585G>A (p.Arg1862His) rs773713291
NM_005120.3(MED12):c.5593A>G (p.Met1865Val) rs587778438
NM_005120.3(MED12):c.5602C>G (p.Leu1868Val) rs1326683020
NM_005120.3(MED12):c.5653G>A (p.Val1885Ile) rs762659794
NM_005120.3(MED12):c.568A>G (p.Ile190Val) rs374780236
NM_005120.3(MED12):c.5878G>A (p.Ala1960Thr)
NM_005120.3(MED12):c.5989G>T (p.Gly1997Cys) rs1556339260
NM_005120.3(MED12):c.6017A>C (p.Tyr2006Ser) rs769232520
NM_005120.3(MED12):c.6046T>C (p.Phe2016Leu)
NM_005120.3(MED12):c.6079A>G (p.Ile2027Val)
NM_005120.3(MED12):c.6094C>G (p.Pro2032Ala)
NM_005120.3(MED12):c.6097A>G (p.Met2033Val) rs372606012
NM_005120.3(MED12):c.6103G>A (p.Ala2035Thr) rs1602306821
NM_005120.3(MED12):c.6150_6152GCA[7] (p.Gln2076dup) rs769857818
NM_005120.3(MED12):c.616C>G (p.Arg206Gly) rs1556334331
NM_005120.3(MED12):c.6177_6191del (p.Gln2072_Gln2076del) rs767827315
NM_005120.3(MED12):c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del) rs773709991
NM_005120.3(MED12):c.6186_6188GCA[3] (p.Gln2075_Gln2076del) rs754533796
NM_005120.3(MED12):c.6239G>A (p.Arg2080Gln) rs1602306967
NM_005120.3(MED12):c.6241_6243CAG[5] (p.Gln2086del) rs786200971
NM_005120.3(MED12):c.6241_6243CAG[7] (p.Gln2086dup) rs786200971
NM_005120.3(MED12):c.6267+166G>A rs1247198443
NM_005120.3(MED12):c.6273_6278dup (p.Gln2115_His2116insGlnGln) rs748394417
NM_005120.3(MED12):c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup) rs761195801
NM_005120.3(MED12):c.6288_6290GCA[5] (p.Gln2114_Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[6] (p.Gln2115del) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[8] (p.Gln2115dup) rs766775649
NM_005120.3(MED12):c.6288_6290GCA[9] (p.Gln2114_Gln2115dup) rs766775649
NM_005120.3(MED12):c.628G>C (p.Ala210Pro) rs1379201163
NM_005120.3(MED12):c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del) rs764789036
NM_005120.3(MED12):c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup) rs764789036
NM_005120.3(MED12):c.6321_6335del (p.Gln2111_Gln2115del) rs727503869
NM_005120.3(MED12):c.6526C>T (p.Arg2176Cys) rs777818556
NM_005120.3(MED12):c.727A>C (p.Met243Leu) rs1569480971
NM_005120.3(MED12):c.76C>G (p.Pro26Ala)
NM_005120.3(MED12):c.817C>T (p.Leu273Phe) rs1219519252

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.