ClinVar Miner

List of variants in gene CFTR reported as pathogenic for abdominal and pelvic region disorder

Included ClinVar conditions (891):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 426
Download table as spreadsheet
NM_000492.3(CFTR):c.*8753C>T rs1554398510
NM_000492.3(CFTR):c.1000C>T (p.Arg334Trp) rs121909011
NM_000492.3(CFTR):c.1001G>T (p.Arg334Leu) rs397508137
NM_000492.3(CFTR):c.1006_1007insG (p.Ile336Serfs) rs397508138
NM_000492.3(CFTR):c.1007T>A (p.Ile336Lys) rs397508139
NM_000492.3(CFTR):c.1013C>T (p.Thr338Ile) rs77409459
NM_000492.3(CFTR):c.1021T>C (p.Ser341Pro) rs397508144
NM_000492.3(CFTR):c.1021_1022dupTC (p.Phe342Hisfs) rs387906360
NM_000492.3(CFTR):c.1029delC (p.Cys343Terfs) rs121908774
NM_000492.3(CFTR):c.1037T>C (p.Leu346Pro) rs397508146
NM_000492.3(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.3(CFTR):c.1040G>C (p.Arg347Pro) rs77932196
NM_000492.3(CFTR):c.1040G>T (p.Arg347Leu) rs77932196
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1055G>A (p.Arg352Gln) rs121908753
NM_000492.3(CFTR):c.1081delT (p.Trp361Glyfs) rs387906361
NM_000492.3(CFTR):c.1083delG (p.Trp361Cysfs) rs387906375
NM_000492.3(CFTR):c.1084_1088dup (p.Ser364Metfs)
NM_000492.3(CFTR):c.1093_1094delCT (p.Leu365Trpfs) rs387906365
NM_000492.3(CFTR):c.1116+1G>A rs397508158
NM_000492.3(CFTR):c.1117-1G>A rs797045160
NM_000492.3(CFTR):c.1117G>A (p.Asp373Asn) rs556880586
NM_000492.3(CFTR):c.1126C>T (p.Gln376Ter)
NM_000492.3(CFTR):c.1130dupA (p.Gln378Alafs) rs397508163
NM_000492.3(CFTR):c.1141A>T (p.Lys381Ter) rs1554381605
NM_000492.3(CFTR):c.1155_1156dup (p.Asn386Ilefs) rs121908785
NM_000492.3(CFTR):c.115C>T (p.Gln39Ter) rs397508168
NM_000492.3(CFTR):c.11C>A (p.Ser4Ter) rs397508173
NM_000492.3(CFTR):c.1202G>A (p.Trp401Ter) rs397508174
NM_000492.3(CFTR):c.1203G>A (p.Trp401Ter) rs397508175
NM_000492.3(CFTR):c.1209+1G>A rs397508176
NM_000492.3(CFTR):c.1209+1G>T rs397508176
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1211delG (p.Gly404Aspfs) rs1235397597
NM_000492.3(CFTR):c.1234_1238delGCAAA (p.Ala412Thrfs) rs3034796
NM_000492.3(CFTR):c.1240C>T (p.Gln414Ter) rs397508183
NM_000492.3(CFTR):c.1297_1303delTTCTCAC (p.Ser434Leufs) rs397508186
NM_000492.3(CFTR):c.1301C>A (p.Ser434Ter)
NM_000492.3(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.3(CFTR):c.1327_1330dupGATA (p.Ile444Argfs) rs397508189
NM_000492.3(CFTR):c.1329_1350del (p.Asp443Glufs)
NM_000492.3(CFTR):c.1340delA (p.Lys447Argfs) rs397508192
NM_000492.3(CFTR):c.1358T>C (p.Leu453Ser)
NM_000492.3(CFTR):c.1364C>A (p.Ala455Glu) rs74551128
NM_000492.3(CFTR):c.1365_1366delGG (p.Val456Cysfs) rs797045161
NM_000492.3(CFTR):c.1367T>C (p.Val456Ala) rs193922500
NM_000492.3(CFTR):c.1373G>T (p.Gly458Val) rs121909009
NM_000492.3(CFTR):c.1373delG (p.Gly458Aspfs) rs397508196
NM_000492.3(CFTR):c.137C>A (p.Ala46Asp) rs151020603
NM_000492.3(CFTR):c.1393-1G>A rs397508200
NM_000492.3(CFTR):c.1393-2A>G rs397508201
NM_000492.3(CFTR):c.1397C>A (p.Ser466Ter) rs121908805
NM_000492.3(CFTR):c.1397C>G (p.Ser466Ter) rs121908805
NM_000492.3(CFTR):c.1400T>C (p.Leu467Pro) rs139573311
NM_000492.3(CFTR):c.1408_1417del10 (p.Val470Glufs) rs397508204
NM_000492.3(CFTR):c.1418delG (p.Gly473Glufs) rs397508205
NM_000492.3(CFTR):c.1420G>A (p.Glu474Lys)
NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) rs79282516
NM_000492.3(CFTR):c.143_146ATCT[1] (p.Ser50Lysfs)
NM_000492.3(CFTR):c.1466C>A (p.Ser489Ter) rs397508211
NM_000492.3(CFTR):c.1475C>T (p.Ser492Phe) rs121909017
NM_000492.3(CFTR):c.1477C>T (p.Gln493Ter) rs77101217
NM_000492.3(CFTR):c.1477_1478delCA (p.Gln493Valfs) rs121908775
NM_000492.3(CFTR):c.1487G>A (p.Trp496Ter) rs397508216
NM_000492.3(CFTR):c.14C>T (p.Pro5Leu) rs193922501
NM_000492.3(CFTR):c.1505T>C (p.Ile502Thr) rs397508222
NM_000492.3(CFTR):c.1510G>T (p.Glu504Ter) rs397508223
NM_000492.3(CFTR):c.1518C>G (p.Ile506Met) rs1800092
NM_000492.3(CFTR):c.1519_1521delATC (p.Ile507del) rs121908745
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1538A>G (p.Asp513Gly) rs397508225
NM_000492.3(CFTR):c.1545_1546delTA (p.Tyr515Terfs) rs121908776
NM_000492.3(CFTR):c.1550A>G (p.Tyr517Cys)
NM_000492.3(CFTR):c.1558G>T (p.Val520Phe) rs77646904
NM_000492.3(CFTR):c.1572C>A (p.Cys524Ter) rs121908754
NM_000492.3(CFTR):c.1573C>T (p.Gln525Ter) rs397508227
NM_000492.3(CFTR):c.1584+1G>A rs397508230
NM_000492.3(CFTR):c.164+1G>A rs397508243
NM_000492.3(CFTR):c.164+1G>T rs397508243
NM_000492.3(CFTR):c.164+2T>C rs121908800
NM_000492.3(CFTR):c.164+2dup rs1554375870
NM_000492.3(CFTR):c.164+3_164+4insT rs397508244
NM_000492.3(CFTR):c.1680-1G>A rs121908794
NM_000492.3(CFTR):c.1680-877G>T rs397508261
NM_000492.3(CFTR):c.1680-886A>G rs397508266
NM_000492.3(CFTR):c.1680A>C (p.Arg560Ser) rs397508267
NM_000492.3(CFTR):c.1682C>A (p.Ala561Glu) rs121909047
NM_000492.3(CFTR):c.1687T>A (p.Tyr563Asn) rs121909006
NM_000492.3(CFTR):c.1687T>C (p.Tyr563His)
NM_000492.3(CFTR):c.1687T>G (p.Tyr563Asp) rs121909006
NM_000492.3(CFTR):c.1692delA (p.Asp565Metfs) rs193922505
NM_000492.3(CFTR):c.1703delT (p.Leu568Cysfs) rs397508274
NM_000492.3(CFTR):c.1705T>G (p.Tyr569Asp) rs397508276
NM_000492.3(CFTR):c.1706A>G (p.Tyr569Cys) rs397508277
NM_000492.3(CFTR):c.1721C>A (p.Pro574His) rs121908758
NM_000492.3(CFTR):c.1736A>G (p.Asp579Gly) rs397508288
NM_000492.3(CFTR):c.1753G>T (p.Glu585Ter) rs397508296
NM_000492.3(CFTR):c.1766+1G>A rs121908748
NM_000492.3(CFTR):c.1766+1G>C rs121908748
NM_000492.3(CFTR):c.1766+1G>T rs121908748
NM_000492.3(CFTR):c.1766+3A>C rs397508298
NM_000492.3(CFTR):c.1766+3A>G rs397508298
NM_000492.3(CFTR):c.1766+5G>T rs121908796
NM_000492.3(CFTR):c.1766G>A (p.Ser589Asn) rs397508300
NM_000492.3(CFTR):c.1792_1798delAAAACTA (p.Lys598Glyfs) rs397508303
NM_000492.3(CFTR):c.1820_1903del84 (p.Met607_Gln634del) rs121908777
NM_000492.3(CFTR):c.1826A>G (p.His609Arg) rs397508310
NM_000492.3(CFTR):c.1837G>A (p.Ala613Thr) rs201978662
NM_000492.3(CFTR):c.1841A>G (p.Asp614Gly) rs201124247
NM_000492.3(CFTR):c.1853T>C (p.Ile618Thr) rs139468767
NM_000492.3(CFTR):c.1865G>A (p.Gly622Asp) rs121908759
NM_000492.3(CFTR):c.1882G>A (p.Gly628Arg) rs397508316
NM_000492.3(CFTR):c.1882G>C (p.Gly628Arg) rs397508316
NM_000492.3(CFTR):c.1911delG (p.Gln637Hisfs) rs1554389296
NM_000492.3(CFTR):c.1923_1931delCTCAAAACTinsA (p.Ser641Argfs) rs121908779
NM_000492.3(CFTR):c.1936G>T (p.Gly646Ter)
NM_000492.3(CFTR):c.1943A>T (p.Asp648Val) rs121909033
NM_000492.3(CFTR):c.1973_1985delGAAATTCAATCCTinsAGAAA (p.Arg658Lysfs) rs121908780
NM_000492.3(CFTR):c.1986_1989delAACT (p.Thr663Argfs) rs397508325
NM_000492.3(CFTR):c.19G>T (p.Glu7Ter) rs121909045
NM_000492.3(CFTR):c.1A>G (p.Met1Val) rs397508328
NM_000492.3(CFTR):c.200C>T (p.Pro67Leu) rs368505753
NM_000492.3(CFTR):c.2012delT (p.Leu671Terfs) rs121908812
NM_000492.3(CFTR):c.2017G>T (p.Gly673Ter) rs397508331
NM_000492.3(CFTR):c.2051_2052delAAinsG (p.Lys684Serfs) rs121908799
NM_000492.3(CFTR):c.2051_2052dup (p.Gln685Asnfs)
NM_000492.3(CFTR):c.2052delA (p.Lys684Asnfs) rs121908746
NM_000492.3(CFTR):c.2052dupA (p.Gln685Thrfs) rs121908746
NM_000492.3(CFTR):c.2053C>T (p.Gln685Ter) rs397508336
NM_000492.3(CFTR):c.2053dupC (p.Gln685Profs) rs797045162
NM_000492.3(CFTR):c.2125C>T (p.Arg709Ter) rs121908760
NM_000492.3(CFTR):c.2128A>T (p.Lys710Ter) rs75115087
NM_000492.3(CFTR):c.2143C>T (p.Gln715Ter) rs397508343
NM_000492.3(CFTR):c.2146A>T (p.Lys716Ter) rs121909023
NM_000492.3(CFTR):c.2158C>T (p.Gln720Ter) rs397508346
NM_000492.3(CFTR):c.2175dup (p.Glu726Argfs) rs746418935
NM_000492.3(CFTR):c.2195T>G (p.Leu732Ter) rs397508350
NM_000492.3(CFTR):c.2215delG (p.Val739Tyrfs) rs397508353
NM_000492.3(CFTR):c.223C>T (p.Arg75Ter) rs121908749
NM_000492.3(CFTR):c.2241_2248delGATACTGC (p.Ile748Serfs) rs397508355
NM_000492.3(CFTR):c.2290C>T (p.Arg764Ter) rs121908810
NM_000492.3(CFTR):c.2291delG (p.Arg764Glnfs) rs387906376
NM_000492.3(CFTR):c.233dupT (p.Trp79Leufs) rs397508360
NM_000492.3(CFTR):c.2353C>T (p.Arg785Ter) rs374946172
NM_000492.3(CFTR):c.2374C>T (p.Arg792Ter) rs145449046
NM_000492.3(CFTR):c.2424_2425insAT (p.Ser809Ilefs) rs387906359
NM_000492.3(CFTR):c.2443G>T (p.Glu815Ter) rs672601316
NM_000492.3(CFTR):c.2453delT (p.Leu818Trpfs) rs397515498
NM_000492.3(CFTR):c.2463_2464delTG (p.Ser821Argfs) rs797045156
NM_000492.3(CFTR):c.2464G>T (p.Glu822Ter) rs397508378
NM_000492.3(CFTR):c.2476G>T (p.Glu826Ter)
NM_000492.3(CFTR):c.2479G>T (p.Glu827Ter) rs121909018
NM_000492.3(CFTR):c.2490+1G>A rs141158996
NM_000492.3(CFTR):c.2491G>T (p.Glu831Ter) rs397508387
NM_000492.3(CFTR):c.2537G>A (p.Trp846Ter) rs397508393
NM_000492.3(CFTR):c.2538G>A (p.Trp846Ter) rs267606722
NM_000492.3(CFTR):c.2547C>A (p.Tyr849Ter) rs397508394
NM_000492.3(CFTR):c.254G>A (p.Gly85Glu) rs75961395
NM_000492.3(CFTR):c.254G>T (p.Gly85Val) rs75961395
NM_000492.3(CFTR):c.2551C>T (p.Arg851Ter) rs121909012
NM_000492.3(CFTR):c.2554dupT (p.Tyr852Leufs) rs1057517068
NM_000492.3(CFTR):c.2583delT (p.Phe861Leufs) rs397508399
NM_000492.3(CFTR):c.2589_2599delAATTTGGTGCT (p.Ile864Serfs) rs397508400
NM_000492.3(CFTR):c.2601dupA (p.Val868Serfs) rs397508405
NM_000492.3(CFTR):c.2620-2A>G rs1554390859
NM_000492.3(CFTR):c.262_263delTT (p.Leu88Ilefs) rs121908769
NM_000492.3(CFTR):c.263T>A (p.Leu88Ter) rs397508412
NM_000492.3(CFTR):c.263T>G (p.Leu88Ter) rs397508412
NM_000492.3(CFTR):c.2645G>A (p.Trp882Ter) rs397508413
NM_000492.3(CFTR):c.2657+5G>A rs80224560
NM_000492.3(CFTR):c.2658-1G>C rs397508416
NM_000492.3(CFTR):c.2658-2A>G rs1554390958
NM_000492.3(CFTR):c.2668C>T (p.Gln890Ter) rs79633941
NM_000492.3(CFTR):c.2700T>A (p.Asn900Lys) rs672601315
NM_000492.3(CFTR):c.271G>A (p.Gly91Arg) rs121908750
NM_000492.3(CFTR):c.273+1G>A rs121908791
NM_000492.3(CFTR):c.273+3A>C rs74467662
NM_000492.3(CFTR):c.273+4A>G rs387906374
NM_000492.3(CFTR):c.2735C>A (p.Ser912Ter) rs121909034
NM_000492.3(CFTR):c.2737_2738insG (p.Tyr913Terfs) rs121908788
NM_000492.3(CFTR):c.2738A>G (p.Tyr913Cys) rs121909008
NM_000492.3(CFTR):c.2739T>A (p.Tyr913Ter) rs149790377
NM_000492.3(CFTR):c.274-1G>A rs121908792
NM_000492.3(CFTR):c.274-2A>G rs397508426
NM_000492.3(CFTR):c.274G>A (p.Glu92Lys) rs121908751
NM_000492.3(CFTR):c.274G>T (p.Glu92Ter) rs121908751
NM_000492.3(CFTR):c.2763_2764dup (p.Val922Glufs) rs397508431
NM_000492.3(CFTR):c.2780T>C (p.Leu927Pro) rs397508435
NM_000492.3(CFTR):c.2810dupT (p.Val938Glyfs) rs193922510
NM_000492.3(CFTR):c.2812dup (p.Val938Glyfs)
NM_000492.3(CFTR):c.2825delT (p.Ile942Thrfs) rs397508441
NM_000492.3(CFTR):c.2834C>T (p.Ser945Leu) rs397508442
NM_000492.3(CFTR):c.2845C>T (p.His949Tyr) rs121909035
NM_000492.3(CFTR):c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC (p.Leu953Phefs) rs397508445
NM_000492.3(CFTR):c.2875delG (p.Ala959Hisfs) rs397508447
NM_000492.3(CFTR):c.2896delA (p.Thr966Argfs) rs397508451
NM_000492.3(CFTR):c.2908G>C (p.Gly970Arg) rs397508453
NM_000492.3(CFTR):c.2909G>A (p.Gly970Asp) rs386134230
NM_000492.3(CFTR):c.292C>T (p.Gln98Ter) rs397508461
NM_000492.3(CFTR):c.2936A>T (p.Asp979Val) rs397508462
NM_000492.3(CFTR):c.293A>G (p.Gln98Arg) rs397508464
NM_000492.3(CFTR):c.296C>T (p.Pro99Leu) rs397508467
NM_000492.3(CFTR):c.2988+1G>A rs75096551
NM_000492.3(CFTR):c.2988G>A (p.Gln996=) rs121908797
NM_000492.3(CFTR):c.2T>G (p.Met1Arg)
NM_000492.3(CFTR):c.305T>G (p.Leu102Arg) rs397508490
NM_000492.3(CFTR):c.310delA (p.Arg104Glufs) rs397508499
NM_000492.3(CFTR):c.313delA (p.Ile105Serfs) rs121908801
NM_000492.3(CFTR):c.325_327delTATinsG (p.Tyr109Glyfs) rs121908798
NM_000492.3(CFTR):c.326A>G (p.Tyr109Cys) rs121909031
NM_000492.3(CFTR):c.328G>C (p.Asp110His) rs113993958
NM_000492.3(CFTR):c.330C>A (p.Asp110Glu) rs397508537
NM_000492.3(CFTR):c.3368-2A>G rs755416052
NM_000492.3(CFTR):c.3421_3424dupAGTA (p.Thr1142Lysfs) rs397508559
NM_000492.3(CFTR):c.3435G>A (p.Trp1145Ter) rs397508561
NM_000492.3(CFTR):c.3454G>C (p.Asp1152His) rs75541969
NM_000492.3(CFTR):c.3468+2dup rs1554392800
NM_000492.3(CFTR):c.3468+5G>A rs1554392801
NM_000492.3(CFTR):c.3468G>A (p.Leu1156=) rs139729994
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3472C>T (p.Arg1158Ter) rs79850223
NM_000492.3(CFTR):c.3475T>C (p.Ser1159Pro) rs397508572
NM_000492.3(CFTR):c.3476C>T (p.Ser1159Phe) rs397508573
NM_000492.3(CFTR):c.3484C>T (p.Arg1162Ter) rs74767530
NM_000492.3(CFTR):c.3485_3486delGA (p.Val1163Leufs) rs397508575
NM_000492.3(CFTR):c.3492dup (p.Lys1165Terfs) rs387906379
NM_000492.3(CFTR):c.349C>T (p.Arg117Cys) rs77834169
NM_000492.3(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.3(CFTR):c.3528delC (p.Lys1177Serfs) rs78984783
NM_000492.3(CFTR):c.3532_3535dupTCAA (p.Thr1179Ilefs) rs387906378
NM_000492.3(CFTR):c.3587C>G (p.Ser1196Ter) rs121908763
NM_000492.3(CFTR):c.3605delA (p.Asp1202Alafs) rs397508587
NM_000492.3(CFTR):c.3611G>A (p.Trp1204Ter) rs121908764
NM_000492.3(CFTR):c.3612G>A (p.Trp1204Ter) rs121908765
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3659delC (p.Thr1220Lysfs) rs121908811
NM_000492.3(CFTR):c.366T>A (p.Tyr122Ter) rs79660178
NM_000492.3(CFTR):c.3691delT (p.Ser1231Profs) rs77035409
NM_000492.3(CFTR):c.3700A>G (p.Ile1234Val) rs75389940
NM_000492.3(CFTR):c.3712C>T (p.Gln1238Ter) rs121908766
NM_000492.3(CFTR):c.3717+40A>G rs397508595
NM_000492.3(CFTR):c.3717+4A>G rs387906362
NM_000492.3(CFTR):c.3717+5G>A rs193922520
NM_000492.3(CFTR):c.3717G>A (p.Arg1239=) rs144781064
NM_000492.3(CFTR):c.3718-1G>A rs387906369
NM_000492.3(CFTR):c.3718-3T>G rs397508596
NM_000492.3(CFTR):c.3719T>G (p.Val1240Gly) rs397508598
NM_000492.3(CFTR):c.3728T>A (p.Leu1243Ter)
NM_000492.3(CFTR):c.3731G>A (p.Gly1244Glu) rs267606723
NM_000492.3(CFTR):c.3744delA (p.Lys1250Argfs) rs121908784
NM_000492.3(CFTR):c.3745G>A (p.Gly1249Arg) rs397508602
NM_000492.3(CFTR):c.3745G>C (p.Gly1249Arg)
NM_000492.3(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.3(CFTR):c.3747delG (p.Lys1250Argfs) rs797045159
NM_000492.3(CFTR):c.3752G>A (p.Ser1251Asn) rs74503330
NM_000492.3(CFTR):c.3761T>G (p.Leu1254Ter) rs397508604
NM_000492.3(CFTR):c.3763T>C (p.Ser1255Pro) rs121909041
NM_000492.3(CFTR):c.3764C>A (p.Ser1255Ter) rs76649725
NM_000492.3(CFTR):c.3767dupC (p.Leu1258Phefs) rs387906370
NM_000492.3(CFTR):c.3773dupT (p.Leu1258Phefs) rs121908789
NM_000492.3(CFTR):c.377G>A (p.Gly126Asp) rs397508609
NM_000492.3(CFTR):c.3806T>A (p.Ile1269Asn)
NM_000492.3(CFTR):c.3841C>T (p.Gln1281Ter) rs397508615
NM_000492.3(CFTR):c.3844T>G (p.Trp1282Gly) rs397508616
NM_000492.3(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.3(CFTR):c.3848G>T (p.Arg1283Met) rs77902683
NM_000492.3(CFTR):c.3857T>C (p.Phe1286Ser) rs121909028
NM_000492.3(CFTR):c.3873+1G>A rs143570767
NM_000492.3(CFTR):c.3873+2T>C rs146795445
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.3874-1G>A rs397508624
NM_000492.3(CFTR):c.3883_3886delATTT (p.Ile1295Phefs) rs387906373
NM_000492.3(CFTR):c.3883delA (p.Ile1295Phefs) rs397508630
NM_000492.3(CFTR):c.3889dupT (p.Ser1297Phefs) rs121908808
NM_000492.3(CFTR):c.3890_3891insT (p.Gly1298Trpfs) rs397508633
NM_000492.3(CFTR):c.38C>T (p.Ser13Phe) rs397508635
NM_000492.3(CFTR):c.3900dup (p.Arg1301Terfs) rs1554396393
NM_000492.3(CFTR):c.3907A>C (p.Asn1303His) rs121909042
NM_000492.3(CFTR):c.3908delA (p.Asn1303Thrfs) rs397508637
NM_000492.3(CFTR):c.3909C>G (p.Asn1303Lys) rs80034486
NM_000492.3(CFTR):c.3925C>T (p.Gln1309Ter)
NM_000492.3(CFTR):c.3937C>T (p.Gln1313Ter) rs121909026
NM_000492.3(CFTR):c.3947G>A (p.Trp1316Ter) rs121909010
NM_000492.3(CFTR):c.3963+1G>A rs672601314
NM_000492.3(CFTR):c.3971T>C (p.Leu1324Pro) rs397508653
NM_000492.3(CFTR):c.3988C>T (p.Gln1330Ter) rs375661578
NM_000492.3(CFTR):c.3999delG (p.Lys1334Serfs) rs886042527
NM_000492.3(CFTR):c.3G>A (p.Met1Ile) rs397508657
NM_000492.3(CFTR):c.4004T>C (p.Leu1335Pro) rs397508658
NM_000492.3(CFTR):c.4036_4042delCTAAGCC (p.Leu1346Metfs) rs397508662
NM_000492.3(CFTR):c.4046G>A (p.Gly1349Asp) rs193922525
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.4077_4080delTGTTinsAA (p.Val1360Thrfs) rs397508668
NM_000492.3(CFTR):c.4086dupT (p.Lys1363Terfs) rs397508669
NM_000492.3(CFTR):c.409_412delCTCC (p.Leu137Tyrfs) rs397508671
NM_000492.3(CFTR):c.409delC (p.Leu137Serfs) rs397508672
NM_000492.3(CFTR):c.410T>C (p.Leu137Pro)
NM_000492.3(CFTR):c.4111G>T (p.Glu1371Ter) rs397508675
NM_000492.3(CFTR):c.4124A>C (p.His1375Pro) rs397508678
NM_000492.3(CFTR):c.4127_4131delTGGAT (p.Leu1376Serfs) rs1554397527
NM_000492.3(CFTR):c.413_415dup (p.Leu138_His139insLeu) rs397508686
NM_000492.3(CFTR):c.4144C>T (p.Gln1382Ter) rs397508684
NM_000492.3(CFTR):c.4147dupA (p.Ile1383Asnfs) rs397508685
NM_000492.3(CFTR):c.416A>G (p.His139Arg) rs76371115
NM_000492.3(CFTR):c.4197_4198delCT (p.Cys1400Terfs) rs397508693
NM_000492.3(CFTR):c.4231C>T (p.Gln1411Ter) rs397508701
NM_000492.3(CFTR):c.4234C>T (p.Gln1412Ter) rs397508702
NM_000492.3(CFTR):c.4242+1G>A rs372227120
NM_000492.3(CFTR):c.4242+1G>T rs372227120
NM_000492.3(CFTR):c.424delA (p.Ile142Phefs) rs387906363
NM_000492.3(CFTR):c.429delT (p.Phe143Leufs) rs387906364
NM_000492.3(CFTR):c.442delA (p.Ile148Leufs) rs121908770
NM_000492.3(CFTR):c.443T>A (p.Ile148Asn) rs35516286
NM_000492.3(CFTR):c.44T>C (p.Leu15Pro)
NM_000492.3(CFTR):c.454A>G (p.Met152Val) rs397508721
NM_000492.3(CFTR):c.459_476delAATAGCTATGTTTAGTTT (p.Ala155_Ile160del) rs387906371
NM_000492.3(CFTR):c.470_483delTTAGTTTGATTTAT (p.Phe157Terfs) rs1554379887
NM_000492.3(CFTR):c.481T>G (p.Tyr161Asp) rs397508729
NM_000492.3(CFTR):c.488delA (p.Lys163Argfs) rs1554379899
NM_000492.3(CFTR):c.489+1G>T rs78756941
NM_000492.3(CFTR):c.494T>C (p.Leu165Ser) rs397508736
NM_000492.3(CFTR):c.49_50dupTT (p.Trp19Alafs) rs397508714
NM_000492.3(CFTR):c.4C>T (p.Gln2Ter) rs397508740
NM_000492.3(CFTR):c.50delT (p.Phe17Serfs) rs397508714
NM_000492.3(CFTR):c.53+1G>T rs397508746
NM_000492.3(CFTR):c.531delT (p.Ile177Metfs) rs121908771
NM_000492.3(CFTR):c.532G>A (p.Gly178Arg) rs80282562
NM_000492.3(CFTR):c.543_546delTAGT (p.Leu183Phefs) rs397508750
NM_000492.3(CFTR):c.54_164del111 (p.Ser18_Glu54del)
NM_000492.3(CFTR):c.577G>A (p.Glu193Lys) rs397508759
NM_000492.3(CFTR):c.577G>T (p.Glu193Ter) rs397508759
NM_000492.3(CFTR):c.579+1G>T rs77188391
NM_000492.3(CFTR):c.579+3A>G rs397508761
NM_000492.3(CFTR):c.579+5G>A rs78440224
NM_000492.3(CFTR):c.57G>A (p.Trp19Ter) rs397508762
NM_000492.3(CFTR):c.580-1G>T rs121908793
NM_000492.3(CFTR):c.595C>T (p.His199Tyr) rs121908802
NM_000492.3(CFTR):c.613C>T (p.Pro205Ser) rs121908803
NM_000492.3(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.3(CFTR):c.647G>A (p.Trp216Ter) rs397508775
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.3(CFTR):c.658C>T (p.Gln220Ter) rs397508778
NM_000492.3(CFTR):c.675T>A (p.Cys225Ter) rs397508781
NM_000492.3(CFTR):c.680T>G (p.Leu227Arg) rs397508782
NM_000492.3(CFTR):c.695T>A (p.Val232Asp) rs397508783
NM_000492.3(CFTR):c.717delG (p.Leu240Terfs) rs1554380497
NM_000492.3(CFTR):c.720_741delAGGGAGAATGATGATGAAGTAC (p.Gly241Glufs) rs121908804
NM_000492.3(CFTR):c.743+1G>A rs397508791
NM_000492.3(CFTR):c.744-14_744-3del rs387906367
NM_000492.3(CFTR):c.772A>G (p.Arg258Gly) rs191456345
NM_000492.3(CFTR):c.79G>A (p.Gly27Arg) rs397508796
NM_000492.3(CFTR):c.79G>T (p.Gly27Ter) rs397508796
NM_000492.3(CFTR):c.803delA (p.Asn268Ilefs) rs121908772
NM_000492.3(CFTR):c.805_806delAT (p.Ile269Profs) rs121908773
NM_000492.3(CFTR):c.825C>G (p.Tyr275Ter) rs193922532
NM_000492.3(CFTR):c.828C>A (p.Cys276Ter) rs397508799
NM_000492.3(CFTR):c.830G>A (p.Trp277Ter) rs672601317
NM_000492.3(CFTR):c.850dupA (p.Met284Asnfs) rs786204693
NM_000492.3(CFTR):c.860dup (p.Asn287Lysfs) rs387906380
NM_000492.3(CFTR):c.861_865delCTTAA (p.Asn287Lysfs) rs397508805
NM_000492.3(CFTR):c.88C>T (p.Gln30Ter) rs397508815
NM_000492.3(CFTR):c.933C>G (p.Phe311Leu) rs121909016
NM_000492.3(CFTR):c.935_937delTCT (p.Phe312del) rs121908768
NM_000492.3(CFTR):c.941G>A (p.Gly314Glu) rs75763344
NM_000492.3(CFTR):c.948delT (p.Phe316Leufs) rs121908744
NM_000492.3(CFTR):c.987delA (p.Gly330Glufs) rs397508824
NM_000492.3(CFTR):c.988G>T (p.Gly330Ter) rs79031340

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.