ClinVar Miner

List of variants in gene HMBS studied for abdominal and pelvic region disorder

Included ClinVar conditions (902):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 70
Download table as spreadsheet
HGVS dbSNP
HMBS, 2-BP DEL, 218AG
HMBS, 2-BP DEL, 847TG
HMBS, 9-BP DEL, EX10
HMBS, ALU INS
HMBS, EX12DEL
HMBS, IVS14DS, G-A, +1
NM_000190.3:c.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT rs1555206402
NM_000190.4(HMBS):c.*101G>A rs565181447
NM_000190.4(HMBS):c.*194A>G rs886047756
NM_000190.4(HMBS):c.*94T>C rs886047755
NM_000190.4(HMBS):c.-28A>C rs201349602
NM_000190.4(HMBS):c.-65C>T rs589925
NM_000190.4(HMBS):c.100C>A (p.Gln34Lys) rs118204105
NM_000190.4(HMBS):c.1020C>T (p.Asn340=) rs146585331
NM_000190.4(HMBS):c.1026G>A (p.Leu342=) rs199845143
NM_000190.4(HMBS):c.105G>C (p.Thr35=) rs370081222
NM_000190.4(HMBS):c.1075G>A (p.Asp359Asn) rs144949995
NM_000190.4(HMBS):c.135G>A (p.Ser45=) rs146801283
NM_000190.4(HMBS):c.163G>T (p.Ala55Ser) rs118204106
NM_000190.4(HMBS):c.174del (p.Thr59fs) rs1565754285
NM_000190.4(HMBS):c.181dup (p.Asp61fs) rs1565754296
NM_000190.4(HMBS):c.210+5C>A rs79983883
NM_000190.4(HMBS):c.211-1G>A rs1565754452
NM_000190.4(HMBS):c.242T>C (p.Leu81Pro) rs118204119
NM_000190.4(HMBS):c.257A>T (p.Glu86Val) rs150763621
NM_000190.4(HMBS):c.266+1G>C rs1565754565
NM_000190.4(HMBS):c.303C>T (p.Pro101=) rs139147408
NM_000190.4(HMBS):c.331G>A (p.Gly111Arg) rs118204107
NM_000190.4(HMBS):c.345-9C>T rs772934410
NM_000190.4(HMBS):c.346C>T (p.Arg116Trp) rs118204094
NM_000190.4(HMBS):c.445C>T (p.Arg149Ter) rs118204120
NM_000190.4(HMBS):c.446G>A (p.Arg149Gln) rs118204098
NM_000190.4(HMBS):c.463C>T (p.Gln155Ter) rs118204097
NM_000190.4(HMBS):c.499-1G>A rs1565756481
NM_000190.4(HMBS):c.499C>T (p.Arg167Trp) rs118204101
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.500G>T (p.Arg167Leu) rs118204095
NM_000190.4(HMBS):c.518G>A (p.Arg173Gln) rs118204096
NM_000190.4(HMBS):c.530T>G (p.Leu177Arg) rs118204108
NM_000190.4(HMBS):c.532G>A (p.Asp178Asn) rs536814318
NM_000190.4(HMBS):c.583C>T (p.Arg195Cys) rs34413634
NM_000190.4(HMBS):c.593G>A (p.Trp198Ter) rs118204100
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.612+4G>A rs745705652
NM_000190.4(HMBS):c.613-19C>A rs1784304
NM_000190.4(HMBS):c.615C>G (p.Ile205Met) rs774594843
NM_000190.4(HMBS):c.647G>A (p.Gly216Asp) rs118204116
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000190.4(HMBS):c.669_698del (p.Glu223_Leu232del) rs1555206128
NM_000190.4(HMBS):c.674G>A (p.Arg225Gln) rs142459647
NM_000190.4(HMBS):c.717C>T (p.His239=) rs114025170
NM_000190.4(HMBS):c.723C>T (p.Pro241=) rs202067277
NM_000190.4(HMBS):c.728_729CT[1] (p.Leu244fs) rs1565757839
NM_000190.4(HMBS):c.734T>G (p.Leu245Arg) rs118204099
NM_000190.4(HMBS):c.734_741dup (p.Ile248fs) rs1565757857
NM_000190.4(HMBS):c.737G>A (p.Arg246His) rs201909197
NM_000190.4(HMBS):c.739T>C (p.Cys247Arg) rs118204111
NM_000190.4(HMBS):c.748G>A (p.Glu250Lys) rs118204112
NM_000190.4(HMBS):c.754G>A (p.Ala252Thr) rs118204113
NM_000190.4(HMBS):c.755C>T (p.Ala252Val) rs118204114
NM_000190.4(HMBS):c.766C>A (p.His256Asn) rs118204115
NM_000190.4(HMBS):c.771+1G>C rs1565758008
NM_000190.4(HMBS):c.77G>A (p.Arg26His) rs118204103
NM_000190.4(HMBS):c.815A>C (p.Lys272Thr) rs1057519252
NM_000190.4(HMBS):c.849G>A (p.Trp283Ter) rs118204117
NM_000190.4(HMBS):c.88-14G>A rs17075
NM_000190.4(HMBS):c.891dup (p.Thr298fs) rs1565758795
NM_000190.4(HMBS):c.900del (p.His300fs) rs1565758825
NM_000190.4(HMBS):c.91G>A (p.Ala31Thr) rs118204104
NM_000190.4(HMBS):c.962G>A (p.Arg321His) rs150428209

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.