ClinVar Miner

List of variants in gene HMBS reported as pathogenic for abdominal and pelvic region disorder

Included ClinVar conditions (902):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 43
Download table as spreadsheet
HGVS dbSNP
HMBS, 2-BP DEL, 218AG
HMBS, 2-BP DEL, 847TG
HMBS, 9-BP DEL, EX10
HMBS, ALU INS
HMBS, EX12DEL
HMBS, IVS14DS, G-A, +1
NM_000190.3:c.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT rs1555206402
NM_000190.4(HMBS):c.100C>A (p.Gln34Lys) rs118204105
NM_000190.4(HMBS):c.163G>T (p.Ala55Ser) rs118204106
NM_000190.4(HMBS):c.174del (p.Thr59fs) rs1565754285
NM_000190.4(HMBS):c.181dup (p.Asp61fs) rs1565754296
NM_000190.4(HMBS):c.211-1G>A rs1565754452
NM_000190.4(HMBS):c.242T>C (p.Leu81Pro) rs118204119
NM_000190.4(HMBS):c.266+1G>C rs1565754565
NM_000190.4(HMBS):c.331G>A (p.Gly111Arg) rs118204107
NM_000190.4(HMBS):c.346C>T (p.Arg116Trp) rs118204094
NM_000190.4(HMBS):c.445C>T (p.Arg149Ter) rs118204120
NM_000190.4(HMBS):c.446G>A (p.Arg149Gln) rs118204098
NM_000190.4(HMBS):c.463C>T (p.Gln155Ter) rs118204097
NM_000190.4(HMBS):c.499-1G>A rs1565756481
NM_000190.4(HMBS):c.499C>T (p.Arg167Trp) rs118204101
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.500G>T (p.Arg167Leu) rs118204095
NM_000190.4(HMBS):c.518G>A (p.Arg173Gln) rs118204096
NM_000190.4(HMBS):c.530T>G (p.Leu177Arg) rs118204108
NM_000190.4(HMBS):c.593G>A (p.Trp198Ter) rs118204100
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.647G>A (p.Gly216Asp) rs118204116
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000190.4(HMBS):c.669_698del (p.Glu223_Leu232del) rs1555206128
NM_000190.4(HMBS):c.728_729CT[1] (p.Leu244fs) rs1565757839
NM_000190.4(HMBS):c.734T>G (p.Leu245Arg) rs118204099
NM_000190.4(HMBS):c.734_741dup (p.Ile248fs) rs1565757857
NM_000190.4(HMBS):c.739T>C (p.Cys247Arg) rs118204111
NM_000190.4(HMBS):c.748G>A (p.Glu250Lys) rs118204112
NM_000190.4(HMBS):c.754G>A (p.Ala252Thr) rs118204113
NM_000190.4(HMBS):c.755C>T (p.Ala252Val) rs118204114
NM_000190.4(HMBS):c.766C>A (p.His256Asn) rs118204115
NM_000190.4(HMBS):c.771+1G>C rs1565758008
NM_000190.4(HMBS):c.77G>A (p.Arg26His) rs118204103
NM_000190.4(HMBS):c.849G>A (p.Trp283Ter) rs118204117
NM_000190.4(HMBS):c.900del (p.His300fs) rs1565758825
NM_000190.4(HMBS):c.91G>A (p.Ala31Thr) rs118204104

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.