ClinVar Miner

List of variants in gene TP53 reported as pathogenic for abdominal and pelvic region disorder

Included ClinVar conditions (891):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 122
Download table as spreadsheet
HGVS dbSNP
NC_000017.11:g.(?_7669599)_(7676604_?)del
NC_000017.11:g.(?_7669603)_(7676600_?)del
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.1010G>A (p.Arg337His) rs121912664
NM_000546.5(TP53):c.1015G>T (p.Glu339Ter) rs17882252
NM_000546.5(TP53):c.1024C>T (p.Arg342Ter) rs730882029
NM_000546.5(TP53):c.1025G>C (p.Arg342Pro) rs375338359
NM_000546.5(TP53):c.1031T>C (p.Leu344Pro) rs121912662
NM_000546.5(TP53):c.1043_1051delTGGAACTCAinsG (p.Leu348Terfs)
NM_000546.5(TP53):c.1101-2A>G rs587781664
NM_000546.5(TP53):c.112delC (p.Gln38Lysfs) rs1555526795
NM_000546.5(TP53):c.140delC (p.Pro47Argfs)
NM_000546.5(TP53):c.151G>T (p.Glu51Ter)
NM_000546.5(TP53):c.155_156delAA (p.Gln52Leufs) rs1555526750
NM_000546.5(TP53):c.158G>A (p.Trp53Ter) rs876658483
NM_000546.5(TP53):c.216_217insC rs730882018
NM_000546.5(TP53):c.257_279del (p.Ala86Valfs) rs886041861
NM_000546.5(TP53):c.273G>A (p.Trp91Ter) rs876660548
NM_000546.5(TP53):c.295delT (p.Ser99Profs) rs1555526593
NM_000546.5(TP53):c.310C>T (p.Gln104Ter)
NM_000546.5(TP53):c.321C>A (p.Tyr107Ter) rs770776262
NM_000546.5(TP53):c.323_329dup (p.Leu111Phefs) rs1131691004
NM_000546.5(TP53):c.329G>C (p.Arg110Pro) rs11540654
NM_000546.5(TP53):c.329G>T (p.Arg110Leu) rs11540654
NM_000546.5(TP53):c.334_364dup (p.Val122Glyfs) rs1555526495
NM_000546.5(TP53):c.358A>T (p.Lys120Ter) rs121912658
NM_000546.5(TP53):c.372C>A (p.Cys124Ter) rs1555526478
NM_000546.5(TP53):c.375G>A (p.Thr125=) rs55863639
NM_000546.5(TP53):c.398T>C (p.Met133Thr) rs28934873
NM_000546.5(TP53):c.412G>C (p.Ala138Pro) rs28934875
NM_000546.5(TP53):c.438G>A (p.Trp146Ter) rs1131691026
NM_000546.5(TP53):c.448_460delACACCCCCGCCCG (p.Thr150Alafs) rs1064792930
NM_000546.5(TP53):c.451C>T (p.Pro151Ser) rs28934874
NM_000546.5(TP53):c.455C>T (p.Pro152Leu) rs587782705
NM_000546.5(TP53):c.455dupC (p.Pro153Alafs) rs730882019
NM_000546.5(TP53):c.45delT (p.Gln16Argfs) rs1555526997
NM_000546.5(TP53):c.469G>T (p.Val157Phe) rs121912654
NM_000546.5(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.5(TP53):c.473G>T (p.Arg158Leu) rs587782144
NM_000546.5(TP53):c.473_474delGCinsTT (p.Arg158Leu)
NM_000546.5(TP53):c.488A>G (p.Tyr163Cys) rs148924904
NM_000546.5(TP53):c.492_493delGCinsCT (p.Lys164_Gln165delinsAsnTer)
NM_000546.5(TP53):c.493C>T (p.Gln165Ter) rs730882001
NM_000546.5(TP53):c.499C>T (p.Gln167Ter) rs1555526097
NM_000546.5(TP53):c.501delG (p.Gln167Hisfs)
NM_000546.5(TP53):c.517G>A (p.Val173Met) rs876660754
NM_000546.5(TP53):c.517G>T (p.Val173Leu) rs876660754
NM_000546.5(TP53):c.517_535dup (p.His179Argfs)
NM_000546.5(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG rs1555525957
NM_000546.5(TP53):c.523C>G (p.Arg175Gly) rs138729528
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.532del (p.His178Thrfs) rs786202525
NM_000546.5(TP53):c.535C>T (p.His179Tyr) rs587780070
NM_000546.5(TP53):c.537T>A (p.His179Gln) rs876660821
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.542G>A (p.Arg181His) rs397514495
NM_000546.5(TP53):c.559+1G>A rs1131691042
NM_000546.5(TP53):c.574C>T (p.Gln192Ter) rs866380588
NM_000546.5(TP53):c.584T>C (p.Ile195Thr) rs760043106
NM_000546.5(TP53):c.586C>T (p.Arg196Ter) rs397516435
NM_000546.5(TP53):c.626_627delGA (p.Arg209Lysfs) rs1057517840
NM_000546.5(TP53):c.627_628del (p.Asn210Hisfs) rs587776768
NM_000546.5(TP53):c.637C>T (p.Arg213Ter) rs397516436
NM_000546.5(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.5(TP53):c.652G>A (p.Val218Met) rs878854072
NM_000546.5(TP53):c.659A>C (p.Tyr220Ser) rs121912666
NM_000546.5(TP53):c.659A>G (p.Tyr220Cys) rs121912666
NM_000546.5(TP53):c.662delA (p.Glu221Glyfs) rs878854071
NM_000546.5(TP53):c.672+1G>A rs863224499
NM_000546.5(TP53):c.673-1G>T rs878854073
NM_000546.5(TP53):c.673-2A>G rs1555525585
NM_000546.5(TP53):c.702_714del (p.Tyr234Terfs)
NM_000546.5(TP53):c.713G>T (p.Cys238Phe) rs730882005
NM_000546.5(TP53):c.715_724delAACAGTTCCT (p.Asn239Alafs) rs1555525518
NM_000546.5(TP53):c.716delA (p.Asn239Thrfs) rs1060501197
NM_000546.5(TP53):c.722C>T (p.Ser241Phe) rs28934573
NM_000546.5(TP53):c.725G>A (p.Cys242Tyr) rs121912655
NM_000546.5(TP53):c.730G>A (p.Gly244Ser) rs1057519989
NM_000546.5(TP53):c.731G>A (p.Gly244Asp) rs985033810
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.733G>T (p.Gly245Cys) rs28934575
NM_000546.5(TP53):c.734G>A (p.Gly245Asp) rs121912656
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.5(TP53):c.747G>T (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.755T>C (p.Leu252Pro) rs121912653
NM_000546.5(TP53):c.770T>A (p.Leu257Gln) rs28934577
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.790delC (p.Leu264Tyrfs) rs1060501194
NM_000546.5(TP53):c.794T>C (p.Leu265Pro) rs879253942
NM_000546.5(TP53):c.814G>T (p.Val272Leu) rs121912657
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.5(TP53):c.818G>C (p.Arg273Pro) rs28934576
NM_000546.5(TP53):c.820_821delGT (p.Val274Leufs)
NM_000546.5(TP53):c.841_842delGA (p.Asp281Profs)
NM_000546.5(TP53):c.842A>G (p.Asp281Gly) rs587781525
NM_000546.5(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.5(TP53):c.844_847delCGGCinsAG (p.Arg283Hisfs) rs1555525209
NM_000546.5(TP53):c.848_857delGCACAGAGGA (p.Arg283Glnfs) rs1555525170
NM_000546.5(TP53):c.853G>A (p.Glu285Lys) rs112431538
NM_000546.5(TP53):c.856G>A (p.Glu286Lys) rs786201059
NM_000546.5(TP53):c.86delA (p.Asn29Thrfs) rs1555526931
NM_000546.5(TP53):c.875A>T (p.Lys292Ile) rs121912663
NM_000546.5(TP53):c.892G>T (p.Glu298Ter) rs201744589
NM_000546.5(TP53):c.916C>T (p.Arg306Ter) rs121913344
NM_000546.5(TP53):c.917_919+10del rs1555525040
NM_000546.5(TP53):c.917_919+6del
NM_000546.5(TP53):c.919+1G>A
NM_000546.5(TP53):c.949C>T (p.Gln317Ter) rs764735889
NM_000546.5(TP53):c.949delC (p.Gln317Serfs)
NM_000546.5(TP53):c.96+1G>T rs1131691003
NM_000546.5(TP53):c.973G>T (p.Gly325Ter) rs863224500
NM_000546.5(TP53):c.976G>T (p.Glu326Ter) rs876659384
NM_000546.5(TP53):c.990_993delTCAG (p.Gln331Serfs) rs1555524949
NM_000546.5(TP53):c.993+1G>A rs11575997
NM_001126115.1(TP53):c.318T>G (p.Cys106Trp) rs193920789
NM_001126115.1(TP53):c.474dup (p.Lys159Glnfs) rs1555525140
NM_001126118.1(TP53):c.*1406dup rs1555523630
NM_001126118.1(TP53):c.39dup (p.Trp14Metfs) rs1555526748
TP53, 1-BP DEL, CODON 257
TP53, 11-BP DEL/5-BP INS

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.