ClinVar Miner

List of variants reported as pathogenic for abdominal and pelvic region disorder

Included ClinVar conditions (902):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 10580
Download table as spreadsheet
HGVS dbSNP
-4C-T, PRO105LEU, AND PRO453SER
1567del9
1685del36
2606-2623del
2q13 deletion
2q13 deletion (290 kb)
4245del6, 4241G>A
46;X;inv(X)(p11.4q24)dn
46;X;t(X;5)(q24;q13)dn
46;XY;inv(6)(p22q13)dn
46;XY;t(6;12)(q14;q24);20p+dn
ABCD1, 1-BP DEL, 2204G
ABCD1, 2-BP DEL, 2177TA
ABCD1, IVS1DS, G-A, -1
AGXT, 1-BP INS, 33C
AKR1D1, 1-BP DEL, 511T
ALAD, IVS3AS, C-A, -11
ALDOB, 7-BP DEL/1-BP INS, 3-PRIME IVS8
ALMS1, 19-BP INS
ALMS1, 333-BP ALU INS, EX16
AMN, IVS3, A-G, -2
APOA1, 12-BP DEL AND 2-BP INS
APRT, 254-BP DEL AND 8-BP INS
ARMC5, 1-BP DEL, G
ATM, IVS61DS, 2-BP INS, +2TA
ATP6V0A4, 1-BP DEL, GLN276
ATP7B, 1-BP DEL, 2337C
ATP7B, 1-BP DEL, 2511A
ATP7B, 1-BP INS, NT2487
ATP7B, 15-BP DEL, NT-441
ATP7B, 3-BP DEL, 3892GTC
ATP7B, 7-BP DEL, NT2010
ATP8B1, 1.4-KB DEL
ATP8B1, 9-BP DEL, NT2384
ATP8B1, IVS23AS, C-A, -3
AVP, 1-BP DEL, 227G
AVP, 3-BP DEL, NT1824
AVP, 3-BP DEL, PHE3DEL
AVPR2, 1-BP DEL, 733G
AVPR2, 1-BP INS
AVPR2, 1-BP INS, 804G
B9D1, 1.71-MB DEL
B9D2, GLY155SER
B9D2, LEU36PRO
B9D2, PRO74SER
BBS1, 1-BP DEL, 1650C
BBS2, CYS210FS, TER246
BBS5, 8-BP DEL/7-BP INS, NT263
BBS5, LEU142TER
BSND, EX3-EX4 DEL
BSND, IVS1, 41-BP DEL
CA2, 1-BP DEL, 207C
CA2, IVS2DS, G-A, +1
CA2, IVS5AS, G-C, -1
CC2D2A, 1762C-T
CDC73, 2-BP DEL
CDC73, 41-BP DUP/INS
CDKN1C, 1-BP DEL/2-BP INS, 1086T-AG
CEP290, 1-BP DEL, 5489A
CEP290, 4-BP DEL, 384TAGA
CEP290, 5-BP DEL
CEP290, EX3, T-A, +2
CFHR5, EX2-3DUP
CFTR, ALA445GLU
CFTR, GLN524HIS
CFTR, HIS1282TER
CHD7, DEL EXONS 8-12
CHEK2, 1-BP DEL, 1100C
CHEK2, 1-BP DEL, 1422T
CLCN2, ARG172GLN
CLCN2, LYS362DEL
CLCN2, MET22LYS
CLCN2, SER865ARG
CLCN2, TYR26ASN
CLCN5, ALU INS, EX11
CLCNKB, DEL
CLCNKB, IVS7AS, A-G, -2
CLDN16, LEU151PRO
COL4A3, 5-BP DEL, NT4414
COL4A3, ALU INS, EX6
COL4A3, IVS21DS, G-A, -1
COL4A5 insertion
COL4A5, 10-15-KB INS, 40-KB DEL
COL4A5, 3-PRIME AND PARTIAL 5-PRIME DELETION
COL4A5, 38-KB DEL
COL4A5, 450-KB DEL
COL4A5, CYS108SER
COL4A5, EX5-10DEL
COL4A5:c.142-?_231+?del(p.Gly48_Lys77del)
COL4A5:c.2510-?_2677+?del (p.Gly837_Gly893delinsGly)
COL4A5:c.3554-?_3604+?del (p.?)
COL4A5:c.3791-?_3924+?del (p.?)
COL4A5:c.82-?_141+?del (p.Ala28_Lys47del)
CREBBP, 2-BP DEL, NT5222
CTNS, -295G-C, PROMOTER
CTNS, IVS7AS, C-G, -10
CYP11A1, 1-BP DEL, 835A
CYP11A1, 1-BP INS, IVS3, T
CYP11A1, 6-BP INS
CYP11B1, 2-BP INS
CYP11B1, 954G-A
CYP11B1, CYP11B1/CYP11B2 ANTI-LEPORE-LIKE CHIMERA
CYP11B1, CYP11B1/CYP11B2 CHIMERA
CYP11B1, IVS3DS, G-T, +16
CYP11B1, IVS8, A-G, +4
CYP11B2, 5-BP DEL
CYP11B2, 6-BP DUP, CODON 143
CYP21A2, 1-BP INS, 1003A
CYP21A2, 1-BP INS, 82C
CYP21A2, 30-KB DEL
CYP21A2, ARG339HIS AND PRO453SER
CYP21A2, ARG408CYS
CYP21A2, ARG426HIS
CYP21A2, GENE CONVERSION CYP21 FROM CYP21P
CYP21A2, GLU380ASP
CYP21A2, GLY424SER
CYP21A2, IVS2, A-G, -2
CYP21A2, IVS7DS, G-C, +1
DHCR7, 1-BP INS, 505C
DHCR7, 1-BP INS, 586T
DHCR7, 96-BP DEL
DHCR7, PHE284LEU
DHCR7, TRP37TER
DIS3L2, 22-KB DEL, EX9DEL
DIS3L2, 82.8-KB DEL, EX6DEL
DIS3L2, IVS19, G-A, +5
DNASE1L3, 1-BP DEL, 643T
EPHX1, -4238T-A
EPHX1, 2557C-G
EVC2, 1-BP DEL, 3660C
EVC2, 1-BP INS, 2056C
EVC2, 5-BP INS, NT198
EVC2, IVS5, A-G, -2
EYA1, 1-BP DEL AND 2-BP INS, 1251T-CC
EYA1, 1-BP INS, 387T
EYA1, ALU INS, EX10
FANCA, IVS7DS, G-A, +5
FANCB, 1-BP DEL, 1650T
FANCB, 1-BP INS, 1838T
FANCB, 1-BP INS, 811T
FANCB, 3314-BP DEL
FANCC, 250-BP DEL
FANCD2, 376A-G
FANCD2, EX17 DEL
FANCG, IVS13, G-C, -1
FANCI, 2T-C
FANCI, IVS31AS, A-G, -88
FANCL, 3-BP DEL, 1007TAT
FANCL, 4-BP DUP, 1095AATT
FGFR2-CLIP1 fusion
FGFR3, FGFR3/IGH FUSION
FLCN, 2-BP DEL, 1284TC AND 2-BP INS, 1284AC
FLCN, 2-BP DEL/2-BP INS, NT610
FRAS1, 1-BP INS, 5605T
FREM1, 1-BP DEL, 2721G
GALK1, 1-BP DEL, 761G
GATA3, 1-BP DEL, 431G
GATA3, 1-BP DEL, 478G
GATA3, 12-BP DEL, NT946-957
GATA3, 2-BP DEL, 108GG
GATA3, 2-BP INS, 3-BP INS
GATA3, 250-KB DEL
GATA3, 49-BP DEL, NT465-513
GATA3, 900-KB DEL
GLA, 1-BP DEL, NT716
GLA, 1-BP INS, NT1040
GLA, 2-BP DEL, NT1176
GLA, 2-BP DEL, NT773
GLA, EX1-2DEL
GLA, EX2-6DUP
GLA, EX3-4DEL
GLA, EX3-7DEL
GLA, EX3DEL
GLA, EX4DEL
GLA, EX6-7DEL
GLA, IVS5AS, DEL -2,-3
GLA, IVS6DS, G-T, +1
GLIS2, IVS5DS, G-T, +1
GMPPA, TRP214TER
GNAS, 1-BP DEL, 348C
GNAS, 1-BP DEL, 725C
GNAS, 1-BP DEL, C, EXON 1
GNAS, 1-BP INS, A, EXON 3
GNAS, 12-BP INS, NT1107
GNAS, 2-BP DEL, CT, EXON 4
GNAS, 2-BP DEL, GA, EXON 8
GNAS, 2-BP DEL, TG, EXON 11
GNAS, 3-BP DEL, CAT, EXON 13
GNAS, 38-BP DEL, EX1/IVS1 BOUNDARY
GNAS, 4.7-KB DEL
GNAS, GLN170ALA
GNAS, IVS10DS, G-C, +1
GNAS, IVS3AS, A-G, -12
GNAS, METHYLATION CHANGES, PATERNAL EPIGENOTYPE
GNAS, TYR391TER
GNASAS, 4.7-KB DEL
GRCh37/hg19 11p13(chr11:31541617-31813509)
GRCh37/hg19 11p14.1-13(chr11:29750813-32752091)x1
GRCh37/hg19 11p15.1-13(chr11:21586131-33168232)x1
GRCh37/hg19 16p13.3(chr16:1557663-1561126)
GRCh37/hg19 16p13.3(chr16:216075-231021)
GRCh37/hg19 16p13.3(chr16:221962-228406)
GRCh37/hg19 16p13.3(chr16:3794894-3795355)
GRCh37/hg19 17q12(chr17:34815551-36208392)x1
GRCh37/hg19 20p12.2(chr20:10124855-11479105)
GRCh37/hg19 20q13.32(chr20:57244540-57246216)
GRCh37/hg19 22q11.1-11.21(chr22:17289827-17938918)
GRCh37/hg19 22q11.1-11.21(chr22:17450514-18636846)x3
GRCh37/hg19 22q11.21(chr22:18631364-21800471)x1
GRCh37/hg19 22q11.21(chr22:18636749-21800471)x1
GRCh37/hg19 22q11.21(chr22:18892575-21460220)
GRCh37/hg19 22q11.21(chr22:18900755-21800277)
GRCh37/hg19 22q11.21(chr22:18901004-21408430)
GRCh37/hg19 22q11.21(chr22:18912231-21465672)x1
GRCh37/hg19 22q11.21(chr22:18912403-21431174)
GRCh37/hg19 22q11.21(chr22:18912870-21431174)
GRCh37/hg19 22q11.21(chr22:18918741-20311922)
GRCh37/hg19 22q11.21(chr22:18919477-21800471)x1
GRCh37/hg19 22q11.21(chr22:18922151-21449911)x1
GRCh37/hg19 2q13(chr2:110862477-110983703)
GRCh37/hg19 2q13(chr2:110875689-110967529)
GRCh37/hg19 2q31.1(chr2:169824976-169830328)
GRCh37/hg19 3q28(chr3:190039387-190040504)
GRCh37/hg19 4p14(chr4:39215680-39219295)
GRCh37/hg19 7q11.23(chr7:72700996-74142190)
GRCh37/hg19 7q11.23(chr7:72721449-73959106)
GRCh37/hg19 7q11.23(chr7:72744494-74339044)
GRCh37/hg19 7q11.23(chr7:72744494-76038818)
GRCh37/hg19 7q11.23(chr7:72772522-74133319)
GRCh37/hg19 8q24.3(chr8:144879444-145199846)
GRCh37/hg19 Xq22.3(chrX:107802035-107802303)
GRCh37/hg19 Xq26.1-26.2(chrX:130280298-132670366)
GRCh37/hg19 Xq26.2(chrX:132834006-132986815)
GRCh37/hg19 Xq28(chrX:152980470-153032459)
GRCh38/hg38 11p15.5(chr11:2000799-2001783)x3
GRCh38/hg38 9p21.2(chr9:27040565-27060992)
H19, 1.43-KB TRIPLICATION
H19, 1.8-KB DEL
H19, 5.3-KB DEL
HBA1, 1-BP DEL, 354C
HBB, 1-BP DEL
HMBS, 2-BP DEL, 218AG
HMBS, 2-BP DEL, 847TG
HMBS, 9-BP DEL, EX10
HMBS, ALU INS
HMBS, EX12DEL
HMBS, IVS14DS, G-A, +1
HNF1B, 1-BP DEL
HNF1B, 5-BP DEL
HNF1B, 75-BP DEL, NT409
HNF1B, EX5DUP
HOGA1, IVS, G-T, +4
HPRT CHERMSIDE
HPRT CHICAGO
HPRT CONNERSVILLE
HPRT COORPAROO
HPRT MICHIGAN
HPRT, 1-BP DEL, TTA-TA
HPRT, 1-BP DEL, TTG-TG
HPRT, 13-BP DEL, 5-PRIME UTR
HPRT, 2-BP DEL, GT
HPRT, 40-BP DEL
HPRT, DEL
HPRT, EX2-3DUP, IVS1DEL
HPRT, EX2DEL
HPRT, EX4-9DEL
HPRT, EX9DEL
HPRT, INV/DEL, EX6-9
HPRT,1-BP INS, 207G
HPSE2, EX3DEL
HPSE2, EX8-9DEL
HSD11B1, LYS187ASN
HSD3B2, 1-BP DEL, 867G
HSD3B2, 1-BP INS
INF2, 9-BP DEL, NT490
ITGA3, 1-BP DEL, NT1173
JAG1, 1-BP INS, 684G
JAG1, 1329, T-G, +2
KCNJ1, 1-BP INS, CODON 15
KCNJ1, TRP58TER
KCNQ1OT1, DEL
KLHL3, ASN529LYS
KLHL3, TRP470TER
L255AfsX12
LCAT, 1-BP INS, EX1
LMX1B, 1-BP INS, 713A
LMX1B, 17-BP DEL
LMX1B, 2-BP DEL, 233TG
LMX1B, 672, G-A, +1
LMX1B, 672, G-T, +1
LMX1B, DEL
M60091.1:c.772C>T
M60091.1:c.775C>T?
MC2R, 1-BP INS, 1347A
MEN1, 1-BP DEL, 7773C
MEN1, 1-BP INS, 1657C
MEN1, 12-BP DEL, NT1466
MEN1, 3-BP DEL, 2641GAA
MEN1, 4-BP DEL, 4480CAGT
MEN1, 6-BP INS, NT879
MKKS, 2-BP DEL, 429CT AND 2-BP DEL, 433AG
MMAA, 8-BP INS, NT260
MRAP, IVS3, G DEL, +1
MRAP, IVS3, G-A, +1
MRAP, IVS3, G-C, +1
MRAP, IVS3, G-T, +1
MRAP, IVS3, T INS, +3
MTR, IVS3AS, A-G, -166
MTR, IVS6AS, G-A, LYS203
MUT, 1808G-A
MUT, 2-BP DEL, 769CA
MUT, IVS11, C-A, -891
MYH9, 18-BP DEL, NT228
NC_000001.10:g.(155160963_155162030)insC
NC_000001.10:g.(196712876_196712928)_(196797494_196797546)del
NC_000001.10:g.(?_161284190)_(161332229_?)del
NC_000001.10:g.(?_161326457)_(161326640_?)del
NC_000001.10:g.(?_161326457)_(161332233_?)del
NC_000001.10:g.(?_161326467)_(161326630_?)del
NC_000001.10:g.(?_17345366)_(17345463_?)del
NC_000001.10:g.(?_17345366)_(17380524_?)del
NC_000001.10:g.(?_17345370)_(17359646_?)del
NC_000001.10:g.(?_17345370)_(17371389_?)del
NC_000001.10:g.(?_17345376)_(17397986_?)del
NC_000001.10:g.(?_17359545)_(17359650_?)del
NC_000001.10:g.(?_17359549)_(17359646_?)del
NC_000001.10:g.(?_17371246)_(17371393_?)del
NC_000001.10:g.(?_17371256)_(17371383_?)del
NC_000001.10:g.(?_17380433)_(17380524_?)del
NC_000001.10:g.(?_17380437)_(17380520_?)del
NC_000001.10:g.(?_236958984)_(237060964_?)del
NC_000001.10:g.(?_242431558)_(244006492_?)del
NC_000001.10:g.17375249_17390927del15679
NC_000001.10:g.17376556_17396932del20377
NC_000001.9:g.157610062_160185096del2575035
NC_000002.11:g.(?_110881348)_(110962565_?)del
NC_000002.11:g.(?_110881368)_(110962545_?)del
NC_000002.11:g.(?_110920625)_(110962545_?)del
NC_000002.11:g.(?_217279418)_(217281040_?)del
NC_000002.11:g.(?_232995329)_(232995429_?)del
NC_000002.11:g.(?_233001172)_(233001439_?)del
NC_000002.11:g.(?_233113939)_(233164839_?)del
NC_000002.11:g.(?_44527090)_(44541110_?)dup
NC_000002.11:g.(?_58386890)_(58468458_?)del
NC_000002.11:g.(?_63605521)_(63631792_?)del
NC_000002.11:g.(?_96919536)_(96931129_?)del
NC_000002.12:g.(?_239048168)_(240879119_?)del
NC_000003.11:g.(?_10070332)_(10085558_?)del
NC_000003.11:g.(?_10070332)_(10088417_?)del
NC_000003.11:g.(?_10094061)_(10191659_?)del
NC_000003.11:g.(?_10106407)_(10188326_?)del
NC_000003.11:g.(?_10183319)_(10183871_?)del
NC_000003.11:g.(?_10183522)_(10183881_?)del
NC_000003.11:g.(?_10183522)_(10191659_?)del
NC_000003.11:g.(?_10188188)_(10188330_?)del
NC_000003.11:g.(?_10188188)_(10191659_?)del
NC_000003.11:g.(?_10188198)_(10188320_?)del
NC_000003.11:g.(?_10191461)_(10191659_?)del
NC_000003.12:g.10073363G>A
NC_000004.11:g.(?_15480347)_(15482451_?)del
NC_000004.11:g.(?_5690874)_(5691080_?)del
NC_000004.11:g.(?_5798729)_(5798979_?)del
NC_000004.11:g.(?_88928866)_(88979275_?)del
NC_000004.11:g.(?_88928866)_(88996866_?)del
NC_000004.11:g.88957372-?_89042944+?dup
NC_000005.9:g.(?_176562095)_(176722470_?)del
NC_000005.9:g.(?_176662802)_(176666886_?)del
NC_000006.11:g.(?_49423783)_(49423960_?)del
NC_000006.11:g.(?_51497343)_(51512936_?)del
NC_000006.11:g.(?_51824658)_(51875267_?)del
NC_000007.13:g.(?_117114235)_(117308205_?)del
NC_000007.13:g.(?_117144287)_(117149216_?)del
NC_000007.13:g.(?_117144294)_(117144445_?)del
NC_000007.13:g.(?_117144297)_(117149206_?)del
NC_000007.13:g.(?_117144307)_(117149196_?)del
NC_000007.13:g.(?_117170933)_(117199729_?)del
NC_000007.13:g.(?_117170947)_(117199715_?)del
NC_000007.13:g.(?_117227773)_(117227921_?)del
NC_000007.13:g.(?_117250563)_(117254777_?)del
NC_000007.13:g.(?_117304714)_(117308205_?)del
NC_000007.13:g.(?_117304732)_(117305628_?)del
NC_000007.13:g.(?_33423258)_(33427776_?)dup
NC_000007.13:g.(?_92118587)_(92120836_?)del
NC_000007.13:g.117246728_117251862del
NC_000007.13:g.117250573_117254767del
NC_000007.13:g.117304742_117307162del
NC_000007.14:g.140777014C>G
NC_000008.10:g.(?_61653972)_(61778512_?)del
NC_000008.10:g.(?_72111555)_(72268741_?)del
NC_000008.10:g.(?_72156818)_(72234523_?)del
NC_000009.11:g.(135750586_135753559)_(135772997_135776102)del
NC_000009.11:g.(34644527_34645701)_(34650746_34653247)del
NC_000009.11:g.(71833276_71835802)_(71855064_71861605)dup
NC_000009.11:g.(?_102866780)_(102866909_?)del
NC_000009.11:g.(?_102888645)_(102888851_?)del
NC_000009.11:g.(?_119460002)_(119462003_?)del
NC_000009.11:g.(?_131394406)_(131403218_?)del
NC_000009.11:g.(?_135771602)_(135779861_?)del
NC_000009.11:g.(?_135771602)_(135804279_?)del
NC_000009.11:g.(?_135771616)_(135804265_?)del
NC_000009.11:g.(?_135776102)_(135787844_?)dup
NC_000009.11:g.(?_135785938)_(135787864_?)del
NC_000009.11:g.(?_34645556)_(34651235_?)del
NC_000009.11:g.(?_34646583)_(34651235_?)del
NC_000009.11:g.(?_34646606)_(34650456_?)del
NC_000009.11:g.(?_97863982)_(98270649_?)del
NC_000010.10:g.4689760_19120882del14431123
NC_000011.9:g.(?_111957622)_(111965704_?)del
NC_000011.9:g.(?_111959581)_(111965704_?)del
NC_000011.9:g.(?_111965519)_(111965704_?)del
NC_000011.9:g.(?_111965523)_(111965700_?)del
NC_000011.9:g.(?_118898884)_(118900099_?)del
NC_000011.9:g.(?_2905209)_(2906985_?)del
NC_000011.9:g.(?_32410594)_(32456901_?)del
NC_000011.9:g.(?_32410604)_(32456891_?)del
NC_000011.9:g.(?_32417797)_(32439206_?)del
NC_000011.9:g.(?_64570986)_(64572288_?)del
NC_000011.9:g.(?_64570986)_(64577604_?)del
NC_000011.9:g.(?_64571796)_(64578188_?)del
NC_000011.9:g.(?_64577131)_(64577587_?)del
NC_000012.11:g.110576651_110589026dup
NC_000012.12:g.53306793_53321761del
NC_000013.10:g.(?_52518225)_(52520634_?)del
NC_000014.8:g.(?_103336519)_(103397037_?)del
NC_000014.8:g.(?_58910652)_(58917484_?)del
NC_000014.8:g.(?_65560420)_(65569063_?)del
NC_000014.8:g.(?_65568254)_(65569067_?)del
NC_000014.8:g.(?_65568264)_(65569262_?)del
NC_000014.9:g.[94380925T>A;94382636T>C]
NC_000014.9:g.[94380925T>A;94383048G>T]
NC_000015.9:g.(?_72978559)_(72978602_?)del
NC_000015.9:g.(?_73002021)_(73004668_?)del
NC_000015.9:g.(?_73007612)_(73009211_?)del
NC_000015.9:g.(?_89790860)_(89860362_?)del
NC_000016.9:g.(56519651_56530879)_(56536720_56539861)del
NC_000016.9:g.(?_14014013)_(14042214_?)del
NC_000016.9:g.(?_14021879)_(14022098_?)del
NC_000016.9:g.(?_15796991)_(16317329_?)del
NC_000016.9:g.(?_201208)_(232141_?)del
NC_000016.9:g.(?_2098588)_(2115636_?)del
NC_000016.9:g.(?_2098597)_(2115656_?)del
NC_000016.9:g.(?_2098597)_(2124416_?)del
NC_000016.9:g.(?_2098597)_(2130398_?)del
NC_000016.9:g.(?_2098597)_(2150587_?)del
NC_000016.9:g.(?_2098597)_(2156698_?)del
NC_000016.9:g.(?_2098597)_(2169399_?)del
NC_000016.9:g.(?_2098611)_(2138617_?)del
NC_000016.9:g.(?_2098645)_(2130379_2131595)del
NC_000016.9:g.(?_2100381)_(2100507_?)del
NC_000016.9:g.(?_2100381)_(2115656_?)dup
NC_000016.9:g.(?_2100391)_(2100497_?)del
NC_000016.9:g.(?_2103323)_(2107460_?)del
NC_000016.9:g.(?_2103323)_(2142209_?)del
NC_000016.9:g.(?_2103343)_(2110814_?)del
NC_000016.9:g.(?_2105383)_(2169399_?)del
NC_000016.9:g.(?_2106177)_(2114448_?)del
NC_000016.9:g.(?_2106177)_(2124416_?)del
NC_000016.9:g.(?_2110651)_(2115656_?)dup
NC_000016.9:g.(?_2115500)_(2124416_?)del
NC_000016.9:g.(?_2122222)_(2127477_?)del
NC_000016.9:g.(?_2129013)_(2142209_?)del
NC_000016.9:g.(?_2131576)_(2154663_?)del
NC_000016.9:g.(?_2131590)_(2138617_?)del
NC_000016.9:g.(?_2136174)_(2162494_?)del
NC_000016.9:g.(?_2137858)_(2138617_?)del
NC_000016.9:g.(?_219779)_(232141_?)del
NC_000016.9:g.(?_3658431)_(3659567_?)del
NC_000016.9:g.(?_3777699)_(4852592_?)del
NC_000016.9:g.(?_3799608)_(3821007_?)dup
NC_000016.9:g.(?_3817701)_(3817930_?)dup
NC_000016.9:g.(?_3830713)_(3831327_?)del
NC_000016.9:g.(?_51171003)_(51185172_?)del
NC_000016.9:g.(?_56518653)_(56545216_?)del
NC_000016.9:g.(?_624055)_(2115656_?)del
NC_000016.9:g.(?_75573872)_(75579413_?)del
NC_000016.9:g.(?_89804999)_(89883033_?)del
NC_000016.9:g.(?_89818536)_(89858965_?)del
NC_000016.9:g.(?_89818536)_(89883033_?)del
NC_000016.9:g.(?_89818546)_(89858955_?)del
NC_000016.9:g.(?_89824979)_(89851378_?)del
NC_000016.9:g.(?_89828351)_(89986626_?)del
NC_000016.9:g.(?_89831215)_(89871810_?)del
NC_000016.9:g.(?_89831288)_(89839802_?)del
NC_000016.9:g.(?_89831292)_(89833651_?)del
NC_000016.9:g.(?_89833543)_(89883029_?)del
NC_000016.9:g.(?_89842140)_(89874785_?)del
NC_000016.9:g.(?_89842144)_(89842229_?)del
NC_000016.9:g.(?_89849257)_(89851382_?)del
NC_000016.9:g.(?_89849257)_(89862436_?)del
NC_000016.9:g.(?_89857801)_(89883033_?)del
NC_000016.9:g.(?_89857810)_(89883023_?)del
NC_000016.9:g.(?_89877105)_(89883033_?)del
NC_000016.9:g.(?_89877109)_(89883029_?)del
NC_000016.9:g.(?_89880922)_(89883029_?)del
NC_000016.9:g.2124200_2138612dup
NC_000017.10:g.(?_17116047)_(17118400_?)del
NC_000017.10:g.(?_17116959)_(17117180_?)del
NC_000017.10:g.(?_17116959)_(17140502_?)del
NC_000017.10:g.(?_17124845)_(17131457_?)del
NC_000017.10:g.(?_17140226)_(17140502_?)del
NC_000017.10:g.(?_29421945)_(29422387_?)del
NC_000017.10:g.(?_29421945)_(29509683_?)del
NC_000017.10:g.(?_29422308)_(29701193_?)del
NC_000017.10:g.(?_29422318)_(29422397_?)del
NC_000017.10:g.(?_29422318)_(29701183_?)del
NC_000017.10:g.(?_29422322)_(29483150_?)del
NC_000017.10:g.(?_29482981)_(29701193_?)del
NC_000017.10:g.(?_29482995)_(29490400_?)del
NC_000017.10:g.(?_29482995)_(29701179_?)del
NC_000017.10:g.(?_29486022)_(29533395_?)del
NC_000017.10:g.(?_29490204)_(29490394_?)del
NC_000017.10:g.(?_29490204)_(29497015_?)del
NC_000017.10:g.(?_29496889)_(29670173_?)del
NC_000017.10:g.(?_29496899)_(29701183_?)del
NC_000017.10:g.(?_29506124)_(29684057_?)del
NC_000017.10:g.(?_29508434)_(29509689_?)del
NC_000017.10:g.(?_29527420)_(29592377_?)del
NC_000017.10:g.(?_29527430)_(29533399_?)del
NC_000017.10:g.(?_29527430)_(29592367_?)del
NC_000017.10:g.(?_29527440)_(29592357_?)del
NC_000017.10:g.(?_29546013)_(29701183_?)del
NC_000017.10:g.(?_29556843)_(29592367_?)del
NC_000017.10:g.(?_29559081)_(29576147_?)del
NC_000017.10:g.(?_29575992)_(29701183_?)del
NC_000017.10:g.(?_29587367)_(29592377_?)dup
NC_000017.10:g.(?_29588729)_(29667663_?)del
NC_000017.10:g.(?_29652818)_(29687741_?)del
NC_000017.10:g.(?_29652818)_(29701193_?)del
NC_000017.10:g.(?_29652828)_(29701183_?)del
NC_000017.10:g.(?_29652832)_(29665163_?)del
NC_000017.10:g.(?_29654517)_(29654857_?)del
NC_000017.10:g.(?_29661577)_(29686053_?)del
NC_000017.10:g.(?_29661846)_(29662059_?)del
NC_000017.10:g.(?_29661850)_(29662055_?)del
NC_000017.10:g.(?_29670027)_(29670153_?)del
NC_000017.10:g.(?_3539712)_(3560109_?)del
NC_000017.10:g.(?_3539712)_(3561479_?)del
NC_000017.10:g.(?_3539712)_(3561489_?)del
NC_000017.10:g.(?_3550718)_(3552245_?)del
NC_000017.10:g.(?_3550728)_(3552235_?)del
NC_000017.10:g.(?_3550738)_(3561469_?)del
NC_000017.10:g.(?_3561289)_(3564038_?)del
NC_000017.10:g.(?_56769995)_(56770159_?)del
NC_000017.10:g.(?_56769995)_(56787361_?)del
NC_000017.10:g.(?_56769999)_(56787357_?)del
NC_000017.10:g.(?_56769999)_(56811589_?)del
NC_000017.10:g.(?_56774048)_(56774226_?)del
NC_000017.10:g.(?_56780547)_(56780700_?)del
NC_000017.10:g.(?_56780547)_(56811593_?)del
NC_000017.10:g.(?_56780557)_(56787351_?)del
NC_000017.10:g.(?_56787210)_(56811593_?)del
NC_000017.10:g.(?_56798097)_(56811593_?)del
NC_000017.10:g.(?_56798101)_(56798179_?)del
NC_000017.10:g.(?_56798101)_(56801467_?)del
NC_000017.10:g.(?_56798107)_(56811703_?)del
NC_000017.10:g.(?_56809835)_(56811593_?)del
NC_000017.10:g.(?_59760647)_(59770883_?)del
NC_000017.10:g.(?_59760647)_(59793434_?)del
NC_000017.10:g.(?_59760651)_(59761507_?)del
NC_000017.10:g.(?_59793302)_(59886128_?)del
NC_000017.10:g.(?_59820368)_(59886124_?)del
NC_000017.10:g.(?_59853756)_(59878841_?)del
NC_000017.10:g.(?_59853756)_(59938906_?)del
NC_000017.10:g.(?_59924452)_(59926627_?)del
NC_000017.10:g.(?_59924462)_(59926617_?)del
NC_000017.10:g.(?_59934409)_(59938910_?)del
NC_000017.10:g.(?_59934413)_(59938906_?)del
NC_000017.10:g.(?_59937147)_(59938910_?)del
NC_000017.10:g.(?_66508520)_(66526600_?)del
NC_000017.10:g.(?_66511525)_(66525142_?)del
NC_000017.10:g.(?_66511535)_(66526596_?)del
NC_000017.10:g.(?_7572917)_(7579922_?)del
NC_000017.10:g.(?_7572917)_(7591611_?)del
NC_000017.10:g.(?_7572917)_(8285638_?)del
NC_000017.10:g.(?_7572921)_(7579918_?)del
NC_000017.10:g.(?_7590924)_(7591611_?)del
NC_000017.11:g.(?_68512379)_(68512548_?)del
NC_000017.11:g.(?_68512379)_(68533431_?)del
NC_000017.11:g.(?_68515394)_(68515576_?)del
NC_000017.11:g.(?_68528870)_(68530449_?)del
NC_000020.10:g.(?_10234257)_(10654198_?)del
NC_000020.10:g.(?_10385875)_(10394182_?)del
NC_000020.10:g.(?_10620126)_(10620623_?)del
NC_000021.8:g.(?_45705870)_(45717630_?)del
NC_000022.10:g.(41537227_41542742)_(41560135_41562602)dup
NC_000022.10:g.(?_18900668)_(19770565_?)del
NC_000022.10:g.(?_18910310)_(19770565_?)del
NC_000022.10:g.(?_19709951)_(19963280_?)del
NC_000022.10:g.(?_19743424)_(19754400_?)del
NC_000022.10:g.(?_19743424)_(19770565_?)del
NC_000022.10:g.(?_19743473)_(19747220_?)del
NC_000022.10:g.(?_41550979)_(41560154_?)del
NC_000022.11:g.(?_41092585)_(41093099_41117186)del
NC_000022.11:g.41155018C>T
NC_000023.10:g.(28450110_28771544)_(31838019_32614088)del
NC_000023.10:g.(29155333_29973170)_(30327505_30577779)del
NC_000023.10:g.(29976475_30082636)_(31196736_31462831)del
NC_000023.10:g.(?_100658779)_(100658993_?)del
NC_000023.10:g.(?_132795738)_(133119496_?)del
NC_000023.10:g.(?_132795758)_(132888203_?)del
NC_000023.10:g.(?_133594322)_(133594415_?)del
NC_000023.10:g.(?_133594322)_(133634127_?)del
NC_000023.10:g.(?_133607369)_(133634127_?)del
NC_000023.10:g.(?_13753171)_(13762658_?)del
NC_000023.10:g.(?_152954020)_(154096327_?)del
NC_000023.10:g.(?_152959340)_(153009209_?)del
NC_000023.10:g.(?_153005536)_(153005701_?)del
NC_000023.10:g.(?_153008421)_(153009209_?)del
NC_000023.10:g.(?_153008431)_(153009199_?)del
NC_000023.10:g.(?_153008655)_(153009209_?)del
NC_000023.10:g.(?_18938130)_(18938339_?)del
NC_000023.10:g.(?_30322696)_(30327480_?)del
NC_000023.11:g.(129551601)_129559858del
NC_000023.11:g.(134493178_134493182)_(134501172_134501176)del
NC_000023.11:g.(?_126549383)_(129592556_?)del
NC_000023.11:g.(?_49922616)_(50099235_?)del
NC_000023.11:g.129569295C>T
NEU1, 1-BP DEL, 1337C
NEU1, 1-BP DEL, 623G
NEU1, IVSEDS, G-C, +1
NF1, 1-BP DEL, 4071C
NF1, 5-BP DEL
NF1, ALU INS
NF1, DEL
NG_000006.1:g.32867_38062del5196
NG_000006.1:g.34164_37967del3804
NG_007159.3:g.(?_162979)_(164232_?)del
NG_007558.2:g.(60799_60814)_(77206_77221)del
NG_008005.1:g.(14407_14970)_(15375_?)del
NG_008005.1:g.(7706_9235)_(15375_?)del
NG_008005.1:g.(?_5001)_(11460_12190)del
NG_008005.1:g.(?_5001)_(9305_10233)del
NG_008638.1:g.(5550_9683)_(13328_22050)del
NG_008872.1(OFD1):g.[16740_20819del;g.20987_21000del]
NG_009018.1(NF1):g.[134769_136954del2186;136931_139830del2900]
NG_009029.1:g.(?_4752)_(?_9014)
NG_009029.1:g.[4026_7188del; 7307insGAATAGACCCCA; g.7308_9602del]
NG_009873.1:g.(?_5000)_(160068_?)del
NG_011706.1:g.10587_63081del
NG_011706.1:g.13291_71928del
NG_012340.1:g.21597_29501del
NG_016165.1:g.(170_?)_(?_2014)del
NG_016465.3:g.(37526_37529)_(58606_58609)
NM_000029.4(AGT):c.1124G>A (p.Arg375Gln) rs74315283
NM_000029.4(AGT):c.1290del (p.Phe430fs) rs387906578
NM_000029.4(AGT):c.604C>T (p.Gln202Ter) rs121912702
NM_000030.2(AGXT):c.[299_307dup;308G>A]
NM_000030.2(AGXT):c.[829_830insA;830C>A]
NM_000030.3(AGXT):c.1007T>A (p.Val336Asp) rs180177155
NM_000030.3(AGXT):c.1014C>G (p.Tyr338Ter) rs756437332
NM_000030.3(AGXT):c.1045G>A (p.Gly349Ser) rs796052065
NM_000030.3(AGXT):c.1049G>A (p.Gly350Asp) rs180177156
NM_000030.3(AGXT):c.106C>T (p.Arg36Cys) rs180177157
NM_000030.3(AGXT):c.1071+1G>A rs180177158
NM_000030.3(AGXT):c.1076T>C (p.Leu359Pro) rs180177160
NM_000030.3(AGXT):c.1079G>A (p.Arg360Gln) rs180177161
NM_000030.3(AGXT):c.107G>A (p.Arg36His) rs180177162
NM_000030.3(AGXT):c.1102G>A (p.Ala368Thr) rs180177163
NM_000030.3(AGXT):c.1108_1109CG[1] (p.Asn372fs) rs796052075
NM_000030.3(AGXT):c.1123_1124CG[1] (p.Val376fs) rs180177164
NM_000030.3(AGXT):c.1148C>A (p.Ala383Asp) rs796052066
NM_000030.3(AGXT):c.1151T>C (p.Leu384Pro) rs180177165
NM_000030.3(AGXT):c.116_117dup (p.Ala40fs) rs180177166
NM_000030.3(AGXT):c.121G>A (p.Gly41Arg) rs121908523
NM_000030.3(AGXT):c.122G>A (p.Gly41Glu) rs180177168
NM_000030.3(AGXT):c.122G>T (p.Gly41Val) rs180177168
NM_000030.3(AGXT):c.125G>A (p.Gly42Glu) rs180177170
NM_000030.3(AGXT):c.126del (p.Leu43fs) rs180177171
NM_000030.3(AGXT):c.130C>T (p.Gln44Ter) rs180177172
NM_000030.3(AGXT):c.139G>A (p.Gly47Arg) rs180177173
NM_000030.3(AGXT):c.166-1G>A rs180177177
NM_000030.3(AGXT):c.167T>A (p.Ile56Asn) rs180177180
NM_000030.3(AGXT):c.175G>A (p.Glu59Lys) rs767586362
NM_000030.3(AGXT):c.187G>C (p.Gly63Arg) rs180177181
NM_000030.3(AGXT):c.198C>G (p.Tyr66Ter) rs121908521
NM_000030.3(AGXT):c.205C>T (p.Gln69Ter) rs180177182
NM_000030.3(AGXT):c.209C>A (p.Thr70Asn) rs796052058
NM_000030.3(AGXT):c.215dup (p.Asn72fs) rs796052069
NM_000030.3(AGXT):c.221_227dup (p.Val77fs) rs180177183
NM_000030.3(AGXT):c.22G>C (p.Val8Leu) rs796052057
NM_000030.3(AGXT):c.242C>A (p.Ser81Ter) rs180177184
NM_000030.3(AGXT):c.242C>T (p.Ser81Leu) rs180177184
NM_000030.3(AGXT):c.244G>C (p.Gly82Arg) rs180177185
NM_000030.3(AGXT):c.245G>A (p.Gly82Glu) rs121908522
NM_000030.3(AGXT):c.248A>G (p.His83Arg) rs180177186
NM_000030.3(AGXT):c.254C>A (p.Ala85Asp) rs796052059
NM_000030.3(AGXT):c.276del (p.Asn92fs) rs180177187
NM_000030.3(AGXT):c.283G>A (p.Glu95Lys) rs180177189
NM_000030.3(AGXT):c.283_285dup (p.Glu95dup) rs180177190
NM_000030.3(AGXT):c.28C>T (p.Pro10Ser) rs180177191
NM_000030.3(AGXT):c.2T>C (p.Met1Thr) rs138584408
NM_000030.3(AGXT):c.2_3delinsAT (p.Met1Asn) rs180177194
NM_000030.3(AGXT):c.302T>C (p.Leu101Pro) rs180177195
NM_000030.3(AGXT):c.322T>C (p.Trp108Arg) rs180177197
NM_000030.3(AGXT):c.323G>A (p.Trp108Ter) rs180177198
NM_000030.3(AGXT):c.324G>T (p.Trp108Cys) rs796052060
NM_000030.3(AGXT):c.326G>T (p.Gly109Val) rs180177199
NM_000030.3(AGXT):c.327del (p.Gln110fs) rs180177200
NM_000030.3(AGXT):c.32C>G (p.Pro11Arg) rs34116584
NM_000030.3(AGXT):c.32_33del (p.Pro11fs) rs180177201
NM_000030.3(AGXT):c.331C>T (p.Arg111Ter) rs180177202
NM_000030.3(AGXT):c.332G>A (p.Arg111Gln) rs180177203
NM_000030.3(AGXT):c.335C>A (p.Ala112Asp) rs796052061
NM_000030.3(AGXT):c.33del (p.Lys12fs) rs180177201
NM_000030.3(AGXT):c.33dup (p.Lys12fs) rs180177201
NM_000030.3(AGXT):c.346G>A (p.Gly116Arg) rs180177207
NM_000030.3(AGXT):c.349G>T (p.Glu117Ter) rs180177208
NM_000030.3(AGXT):c.352C>T (p.Arg118Cys) rs376844297
NM_000030.3(AGXT):c.353G>A (p.Arg118His) rs138025751
NM_000030.3(AGXT):c.358+1G>T rs796052067
NM_000030.3(AGXT):c.358+2T>G rs113681235
NM_000030.3(AGXT):c.359-1_382del rs796052070
NM_000030.3(AGXT):c.364C>T (p.Arg122Ter) rs180177210
NM_000030.3(AGXT):c.371A>C (p.His124Pro) rs180177211
NM_000030.3(AGXT):c.3G>T (p.Met1Ile) rs180177213
NM_000030.3(AGXT):c.406_410dup (p.Gln137fs) rs1553648488
NM_000030.3(AGXT):c.409C>T (p.Gln137Ter) rs180177214
NM_000030.3(AGXT):c.416_418del (p.Val139del) rs180177215
NM_000030.3(AGXT):c.423G>T (p.Glu141Asp) rs180177217
NM_000030.3(AGXT):c.424-2A>G rs180177219
NM_000030.3(AGXT):c.445del (p.Val149fs) rs180177220
NM_000030.3(AGXT):c.447_454del (p.Leu151fs) rs180177221
NM_000030.3(AGXT):c.449T>C (p.Leu150Pro) rs180177222
NM_000030.3(AGXT):c.454T>A (p.Phe152Ile) rs121908524
NM_000030.3(AGXT):c.457T>G (p.Leu153Val) rs180177223
NM_000030.3(AGXT):c.460del (p.Thr154fs) rs180177224
NM_000030.3(AGXT):c.466G>A (p.Gly156Arg) rs121908530
NM_000030.3(AGXT):c.466G>C (p.Gly156Arg) rs121908530
NM_000030.3(AGXT):c.473C>A (p.Ser158Ter) rs180177225
NM_000030.3(AGXT):c.473C>T (p.Ser158Leu) rs180177225
NM_000030.3(AGXT):c.481G>A (p.Gly161Ser) rs180177227
NM_000030.3(AGXT):c.481G>C (p.Gly161Arg) rs180177227
NM_000030.3(AGXT):c.481G>T (p.Gly161Cys) rs180177227
NM_000030.3(AGXT):c.497T>C (p.Leu166Pro) rs180177230
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000030.3(AGXT):c.518G>A (p.Cys173Tyr) rs180177231
NM_000030.3(AGXT):c.519C>A (p.Cys173Ter) rs180177232
NM_000030.3(AGXT):c.519_520delinsGA (p.Cys173_His174delinsTrpAsn) rs180177233
NM_000030.3(AGXT):c.525-1G>A rs180177234
NM_000030.3(AGXT):c.533G>A (p.Cys178Tyr) rs180177235
NM_000030.3(AGXT):c.547G>A (p.Asp183Asn) rs180177236
NM_000030.3(AGXT):c.557_562delinsATCGGT (p.Ala186_Ser187delinsAspArg) rs180177237
NM_000030.3(AGXT):c.560C>T (p.Ser187Phe) rs180177238
NM_000030.3(AGXT):c.568G>A (p.Gly190Arg) rs180177239
NM_000030.3(AGXT):c.570del (p.Thr191fs) rs180177240
NM_000030.3(AGXT):c.577del (p.Leu193fs) rs180177241
NM_000030.3(AGXT):c.577dup (p.Leu193fs) rs180177241
NM_000030.3(AGXT):c.583A>C (p.Met195Leu) rs180177243
NM_000030.3(AGXT):c.584T>G (p.Met195Arg) rs180177244
NM_000030.3(AGXT):c.595G>A (p.Gly199Ser) rs796052062
NM_000030.3(AGXT):c.596-2A>G rs180177245
NM_000030.3(AGXT):c.603C>A (p.Asp201Glu) rs180177246
NM_000030.3(AGXT):c.605T>A (p.Ile202Asn) rs536352238
NM_000030.3(AGXT):c.612C>A (p.Tyr204Ter) rs180177247
NM_000030.3(AGXT):c.613T>C (p.Ser205Pro) rs121908520
NM_000030.3(AGXT):c.614C>A (p.Ser205Ter) rs180177248
NM_000030.3(AGXT):c.614C>T (p.Ser205Leu) rs180177248
NM_000030.3(AGXT):c.628G>C (p.Ala210Pro) rs180177250
NM_000030.3(AGXT):c.642_645del (p.Pro215fs) rs180177251
NM_000030.3(AGXT):c.646G>A (p.Gly216Arg) rs180177252
NM_000030.3(AGXT):c.653C>T (p.Ser218Leu) rs180177253
NM_000030.3(AGXT):c.661T>C (p.Ser221Pro) rs180177254
NM_000030.3(AGXT):c.662_664del (p.Ser221del) rs796052071
NM_000030.3(AGXT):c.679_680+2del rs180177255
NM_000030.3(AGXT):c.680+1G>A rs111996685
NM_000030.3(AGXT):c.680+1G>C rs111996685
NM_000030.3(AGXT):c.680+2T>A rs111742810
NM_000030.3(AGXT):c.680+480_776+69delinsTGAGA rs1553648931
NM_000030.3(AGXT):c.680+5G>C rs180177256
NM_000030.3(AGXT):c.697C>T (p.Arg233Cys) rs121908526
NM_000030.3(AGXT):c.698G>A (p.Arg233His) rs121908527
NM_000030.3(AGXT):c.698G>T (p.Arg233Leu) rs121908527
NM_000030.3(AGXT):c.725dup (p.Asp243fs) rs180177257
NM_000030.3(AGXT):c.727G>C (p.Asp243His) rs180177258
NM_000030.3(AGXT):c.731T>C (p.Ile244Thr) rs121908525
NM_000030.3(AGXT):c.737G>A (p.Trp246Ter) rs180177259
NM_000030.3(AGXT):c.738G>A (p.Trp246Ter) rs121908528
NM_000030.3(AGXT):c.744del (p.Asn249fs) rs180177261
NM_000030.3(AGXT):c.74T>G (p.Leu25Arg) rs180177262
NM_000030.3(AGXT):c.751_752delinsAA (p.Trp251Lys) rs796052072
NM_000030.3(AGXT):c.753G>A (p.Trp251Ter) rs180177263
NM_000030.3(AGXT):c.757T>C (p.Cys253Arg) rs180177264
NM_000030.3(AGXT):c.776+1G>A rs180177265
NM_000030.3(AGXT):c.776+1G>C rs180177265
NM_000030.3(AGXT):c.777-1G>C rs180177267
NM_000030.3(AGXT):c.777-2A>G rs796052068
NM_000030.3(AGXT):c.77T>C (p.Leu26Pro) rs180177268
NM_000030.3(AGXT):c.783T>A (p.His261Gln) rs180177269
NM_000030.3(AGXT):c.798_802delinsACAATCTCAG (p.Ile267fs) rs180177270
NM_000030.3(AGXT):c.806T>C (p.Leu269Pro) rs180177271
NM_000030.3(AGXT):c.817_818AG[5] (p.Ser275fs) rs180177273
NM_000030.3(AGXT):c.822G>C (p.Glu274Asp) rs146525143
NM_000030.3(AGXT):c.823A>C (p.Ser275Arg) rs180177272
NM_000030.3(AGXT):c.834del (p.Ile279fs) rs180177276
NM_000030.3(AGXT):c.83del (p.Pro28fs) rs180177278
NM_000030.3(AGXT):c.844C>T (p.Gln282Ter) rs180177279
NM_000030.3(AGXT):c.846+1G>A rs180177281
NM_000030.3(AGXT):c.846+1G>T rs180177281
NM_000030.3(AGXT):c.846+646_942+139del
NM_000030.3(AGXT):c.846G>C (p.Gln282His) rs180177284
NM_000030.3(AGXT):c.847-1G>C rs180177285
NM_000030.3(AGXT):c.847-3C>G rs180177286
NM_000030.3(AGXT):c.851T>C (p.Leu284Pro) rs180177287
NM_000030.3(AGXT):c.853G>T (p.Glu285Ter) rs180177288
NM_000030.3(AGXT):c.860_861delinsCG (p.Ser287Thr) rs180177289
NM_000030.3(AGXT):c.866G>A (p.Arg289His) rs61729604
NM_000030.3(AGXT):c.883_885GCG[1] (p.Ala296del) rs180177291
NM_000030.3(AGXT):c.891T>G (p.Tyr297Ter) rs180177292
NM_000030.3(AGXT):c.893T>C (p.Leu298Pro) rs180177293
NM_000030.3(AGXT):c.907C>T (p.Gln303Ter) rs180177294
NM_000030.3(AGXT):c.919del (p.Leu307fs) rs180177295
NM_000030.3(AGXT):c.922C>T (p.Gln308Ter) rs180177296
NM_000030.3(AGXT):c.942+1G>T rs180177297
NM_000030.3(AGXT):c.943-1G>A rs180177298
NM_000030.3(AGXT):c.943-1G>T rs180177298
NM_000030.3(AGXT):c.947T>C (p.Leu316Pro) rs796052063
NM_000030.3(AGXT):c.956C>T (p.Pro319Leu) rs180177299
NM_000030.3(AGXT):c.957_958CA[1] (p.Thr320fs) rs796052074
NM_000030.3(AGXT):c.969_970TG[1] (p.Val324fs) rs180177300
NM_000030.3(AGXT):c.976del (p.Val326fs) rs180177301
NM_000030.3(AGXT):c.983_988del (p.Ala328_Tyr330delinsAsp) rs180177302
NM_000030.3(AGXT):c.996G>A (p.Trp332Ter) rs796052064
NM_000030.3(AGXT):c.997A>T (p.Arg333Ter) rs180177303
NM_000031.6(ALAD):c.165-11C>T rs749066913
NM_000031.6(ALAD):c.397G>A (p.Gly133Arg) rs121912980
NM_000031.6(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000031.6(ALAD):c.820G>A (p.Ala274Thr) rs121912983
NM_000031.6(ALAD):c.823G>A (p.Val275Met) rs121912981
NM_000032.5(ALAS2):c.1642C>T (p.Gln548Ter) rs397514730
NM_000032.5(ALAS2):c.1651_1676del (p.Ser551fs) rs879255567
NM_000032.5(ALAS2):c.1699_1700del (p.Met567fs) rs387906473
NM_000032.5(ALAS2):c.1702_1705AGTG[1] (p.Glu569fs) rs387906472
NM_000032.5(ALAS2):c.1757A>T (p.Tyr586Phe) rs139596860
NM_000033.3(ABCD1):c.874_876delGAG (p.Glu292del) rs387906496
NM_000033.4(ABCD1):c.-16_10del (p.Met1fs) rs387906497
NM_000033.4(ABCD1):c.1096A>T (p.Lys366Ter) rs1569541000
NM_000033.4(ABCD1):c.1101_1108dup (p.Leu370fs)
NM_000033.4(ABCD1):c.1126G>T (p.Glu376Ter)
NM_000033.4(ABCD1):c.1165C>G (p.Arg389Gly) rs128624215
NM_000033.4(ABCD1):c.1201C>T (p.Arg401Trp) rs727503786
NM_000033.4(ABCD1):c.1202G>A (p.Arg401Gln) rs128624219
NM_000033.4(ABCD1):c.1225-7_1239del rs1569541009
NM_000033.4(ABCD1):c.1252C>T (p.Arg418Trp) rs128624220
NM_000033.4(ABCD1):c.1270C>T (p.Gln424Ter) rs1557054210
NM_000033.4(ABCD1):c.1288C>T (p.Gln430Ter) rs797044726
NM_000033.4(ABCD1):c.1390C>T (p.Arg464Ter) rs128624221
NM_000033.4(ABCD1):c.1415_1416del (p.Gln472fs) rs387906494
NM_000033.4(ABCD1):c.1429G>T (p.Glu477Ter) rs128624222
NM_000033.4(ABCD1):c.1451C>G (p.Pro484Arg) rs128624214
NM_000033.4(ABCD1):c.1454C>G (p.Ser485Ter)
NM_000033.4(ABCD1):c.146_159del (p.Pro49fs) rs1569540676
NM_000033.4(ABCD1):c.1532G>A (p.Cys511Tyr) rs1557054745
NM_000033.4(ABCD1):c.1534G>A (p.Gly512Ser) rs1569541088
NM_000033.4(ABCD1):c.1544C>T (p.Ser515Phe) rs128624223
NM_000033.4(ABCD1):c.1552C>G (p.Arg518Gly) rs128624224
NM_000033.4(ABCD1):c.1552C>T (p.Arg518Trp) rs128624224
NM_000033.4(ABCD1):c.1552del (p.Arg518fs) rs387906495
NM_000033.4(ABCD1):c.1553G>A (p.Arg518Gln) rs398123102
NM_000033.4(ABCD1):c.1628C>T (p.Pro543Leu) rs1557054776
NM_000033.4(ABCD1):c.1628del (p.Pro543fs)
NM_000033.4(ABCD1):c.1634+1G>A rs1569541096
NM_000033.4(ABCD1):c.1635-2A>G rs1569541109
NM_000033.4(ABCD1):c.1660dup (p.Arg554fs) rs1569541115
NM_000033.4(ABCD1):c.1679C>T (p.Pro560Leu) rs398123105
NM_000033.4(ABCD1):c.16_22delinsCT (p.Arg6fs) rs1557052133
NM_000033.4(ABCD1):c.1771C>T (p.Arg591Trp) rs398123106
NM_000033.4(ABCD1):c.1772G>A (p.Arg591Gln) rs1557054873
NM_000033.4(ABCD1):c.1780+2T>G rs1557054875
NM_000033.4(ABCD1):c.1784G>A (p.Trp595Ter)
NM_000033.4(ABCD1):c.1817C>T (p.Ser606Leu) rs128624225
NM_000033.4(ABCD1):c.1820_1823del (p.Gly607fs) rs1557055253
NM_000033.4(ABCD1):c.1825G>A (p.Glu609Lys) rs150346282
NM_000033.4(ABCD1):c.1849C>T (p.Arg617Cys) rs4010613
NM_000033.4(ABCD1):c.1850G>A (p.Arg617His) rs11146842
NM_000033.4(ABCD1):c.1865+1G>A rs1569541198
NM_000033.4(ABCD1):c.1866-10G>A rs398123108
NM_000033.4(ABCD1):c.1876G>A (p.Ala626Thr) rs1557055316
NM_000033.4(ABCD1):c.1978C>T (p.Arg660Trp) rs1569541203
NM_000033.4(ABCD1):c.1998C>A (p.Tyr666Ter) rs1170974058
NM_000033.4(ABCD1):c.253dup (p.Arg85fs) rs713993050
NM_000033.4(ABCD1):c.293C>T (p.Ser98Leu) rs1557052294
NM_000033.4(ABCD1):c.311G>A (p.Arg104His) rs1557052302
NM_000033.4(ABCD1):c.346G>C (p.Gly116Arg)
NM_000033.4(ABCD1):c.36del (p.Asn13fs)
NM_000033.4(ABCD1):c.408del (p.Gln136fs)
NM_000033.4(ABCD1):c.421G>A (p.Ala141Thr) rs193922097
NM_000033.4(ABCD1):c.443A>G (p.Asn148Ser) rs128624216
NM_000033.4(ABCD1):c.454C>T (p.Arg152Cys) rs1569540693
NM_000033.4(ABCD1):c.520T>G (p.Tyr174Asp) rs128624217
NM_000033.4(ABCD1):c.521A>G (p.Tyr174Cys) rs1557052390
NM_000033.4(ABCD1):c.537_544dup (p.Arg182fs) rs1557052397
NM_000033.4(ABCD1):c.70del (p.Leu24fs) rs1557052171
NM_000033.4(ABCD1):c.723del (p.Trp242fs)
NM_000033.4(ABCD1):c.761C>T (p.Thr254Met) rs1131691743
NM_000033.4(ABCD1):c.766_769dup (p.Val257fs) rs1557052530
NM_000033.4(ABCD1):c.796G>A (p.Gly266Arg) rs128624218
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000033.4(ABCD1):c.871G>A (p.Glu291Lys) rs128624213
NM_000033.4(ABCD1):c.919C>T (p.Gln307Ter)
NM_000035.3(ALDOB):c.-10-2043_624+62del
NM_000035.4(ALDOB):c.-11+1G>C rs181639417
NM_000035.4(ALDOB):c.1005C>G (p.Asn335Lys) rs78340951
NM_000035.4(ALDOB):c.1027T>C (p.Tyr343His) rs369586696
NM_000035.4(ALDOB):c.10C>T (p.Arg4Ter) rs118204428
NM_000035.4(ALDOB):c.136A>T (p.Arg46Trp) rs41281039
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000035.4(ALDOB):c.324+1G>A rs764826805
NM_000035.4(ALDOB):c.356_359CAAA[1] (p.Asn120fs) rs387906225
NM_000035.4(ALDOB):c.442T>C (p.Trp148Arg) rs118204430
NM_000035.4(ALDOB):c.448G>C (p.Ala150Pro) rs1800546
NM_000035.4(ALDOB):c.522C>G (p.Tyr174Ter) rs752902486
NM_000035.4(ALDOB):c.524C>A (p.Ala175Asp) rs76917243
NM_000035.4(ALDOB):c.548_553del (p.Leu183_Val184del) rs387906226
NM_000035.4(ALDOB):c.612T>G (p.Tyr204Ter) rs370793608
NM_000035.4(ALDOB):c.625-1G>A rs1564077542
NM_000035.4(ALDOB):c.720C>A (p.Cys240Ter) rs118204426
NM_000035.4(ALDOB):c.865_867del (p.Leu289del) rs118204425
NM_000035.4(ALDOB):c.865del (p.Leu289fs) rs864309533
NM_000038.6(APC):c.1660C>T (p.Arg554Ter) rs137854573
NM_000038.6(APC):c.1695del (p.Val566fs) rs397514032
NM_000038.6(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.3867T>A (p.Cys1289Ter) rs1554085355
NM_000038.6(APC):c.4183A>T (p.Ser1395Cys) rs137854578
NM_000038.6(APC):c.637C>T (p.Arg213Ter) rs587781392
NM_000038.6(APC):c.646C>T (p.Arg216Ter) rs62619935
NM_000038.6(APC):c.694C>T (p.Arg232Ter) rs397515734
NM_000038.6(APC):c.70C>T (p.Arg24Ter) rs145945630
NM_000038.6(APC):c.847C>T (p.Arg283Ter) rs786201856
NM_000038.6(APC):c.933+1G>A rs876660765
NM_000039.2(APOA1):c.220T>C (p.Trp74Arg) rs121912726
NM_000039.2(APOA1):c.251T>G (p.Leu84Arg) rs121912724
NM_000039.2(APOA1):c.593T>C (p.Leu198Ser) rs121912729
NM_000039.2(APOA1):c.595G>C (p.Ala199Pro) rs121912730
NM_000041.4(APOE):c.127C>T (p.Arg43Cys) rs121918399
NM_000041.4(APOE):c.488G>C (p.Arg163Pro) rs121918397
NM_000053.3(ATP7B):c.-436_-422del15 rs1484840087
NM_000053.3(ATP7B):c.-441_-427del15 rs879255499
NM_000053.3(ATP7B):c.1708-25_1719delGGATTCTTGCCATCCTGTGTTGCAGATCACAGGGATG rs1566560096
NM_000053.3(ATP7B):c.3809A>G rs121907990
NM_000053.3(ATP7B):c.[1924G>C];[3809A>G]
NM_000053.3(ATP7B):c.[2950C>G];[3809A>G]
NM_000053.3(ATP7B):c.[3443T>C;3526G>A]
NM_000053.4(ATP7B):c.111dup (p.Ala38fs) rs1555296939
NM_000053.4(ATP7B):c.1145_1151del (p.Ser382fs) rs1176709391
NM_000053.4(ATP7B):c.1158_1159del (p.Val387fs)
NM_000053.4(ATP7B):c.1470C>A (p.Cys490Ter) rs778675259
NM_000053.4(ATP7B):c.1531C>T (p.Gln511Ter) rs1449610384
NM_000053.4(ATP7B):c.1543+1G>T rs1360279134
NM_000053.4(ATP7B):c.1708-1G>A rs137853280
NM_000053.4(ATP7B):c.1708-1G>C rs137853280
NM_000053.4(ATP7B):c.1708-5T>G rs770829226
NM_000053.4(ATP7B):c.1716del (p.Gly572_Met573insTer) rs1057516893
NM_000053.4(ATP7B):c.1745_1746del (p.Ile582fs) rs753962912
NM_000053.4(ATP7B):c.1782del (p.Thr593_Tyr594insTer) rs780327716
NM_000053.4(ATP7B):c.1847G>A (p.Arg616Gln) rs752850609
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1924G>T (p.Asp642Tyr) rs72552285
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.1969A>C (p.Ser657Arg) rs372436901
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2009_2015del (p.Ile669_Tyr670insTer) rs779904655
NM_000053.4(ATP7B):c.2071G>A (p.Gly691Arg) rs121908001
NM_000053.4(ATP7B):c.2072G>T (p.Gly691Val) rs1555291801
NM_000053.4(ATP7B):c.2122-8T>G rs193922102
NM_000053.4(ATP7B):c.2123T>C (p.Leu708Pro) rs121908000
NM_000053.4(ATP7B):c.2128G>A (p.Gly710Ser) rs137853285
NM_000053.4(ATP7B):c.2131G>A (p.Gly711Arg) rs1394999756
NM_000053.4(ATP7B):c.213_214del (p.Val73fs)
NM_000053.4(ATP7B):c.2145C>A (p.Tyr715Ter) rs751202110
NM_000053.4(ATP7B):c.2145del (p.Phe714_Tyr715insTer)
NM_000053.4(ATP7B):c.2149C>T (p.Gln717Ter) rs1085307057
NM_000053.4(ATP7B):c.2165dup (p.Arg723fs) rs768729972
NM_000053.4(ATP7B):c.2293G>A (p.Asp765Asn) rs28942075
NM_000053.4(ATP7B):c.2294A>G (p.Asp765Gly) rs1555291147
NM_000053.4(ATP7B):c.2297C>G (p.Thr766Arg) rs121907997
NM_000053.4(ATP7B):c.2304del (p.Met769fs) rs137853287
NM_000053.4(ATP7B):c.2304dup (p.Met769fs) rs137853287
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2332C>G (p.Arg778Gly) rs137853284
NM_000053.4(ATP7B):c.2332C>T (p.Arg778Trp) rs137853284
NM_000053.4(ATP7B):c.2333G>A (p.Arg778Gln) rs28942074
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2336G>A (p.Trp779Ter) rs137853283
NM_000053.4(ATP7B):c.2351C>T (p.Ala784Val) rs1566532164
NM_000053.4(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.4(ATP7B):c.2478_2479delinsT (p.Gln826fs) rs1555288808
NM_000053.4(ATP7B):c.2510dup (p.Phe839fs)
NM_000053.4(ATP7B):c.2519C>T (p.Pro840Leu) rs768671894
NM_000053.4(ATP7B):c.2532del (p.Val845fs) rs755709270
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2662A>C (p.Thr888Pro)
NM_000053.4(ATP7B):c.2668G>A (p.Val890Met) rs786204718
NM_000053.4(ATP7B):c.2731-2A>G rs367956522
NM_000053.4(ATP7B):c.2755C>G (p.Arg919Gly) rs121907993
NM_000053.4(ATP7B):c.2795C>A (p.Ser932Ter) rs1566498495
NM_000053.4(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.4(ATP7B):c.2810del (p.Val937fs) rs1057516643
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.2828G>A (p.Gly943Asp) rs779323689
NM_000053.4(ATP7B):c.2865+1G>A rs587783306
NM_000053.4(ATP7B):c.2866-2A>G rs1377418826
NM_000053.4(ATP7B):c.2906G>A (p.Arg969Gln) rs121907996
NM_000053.4(ATP7B):c.2930C>T (p.Thr977Met) rs72552255
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.2975C>T (p.Pro992Leu) rs201038679
NM_000053.4(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.4(ATP7B):c.3011A>C (p.Gln1004Pro) rs587783307
NM_000053.4(ATP7B):c.3083_3085delinsG (p.Lys1028fs) rs1331370011
NM_000053.4(ATP7B):c.3121C>T (p.Arg1041Trp) rs746485916
NM_000053.4(ATP7B):c.3147del (p.Thr1050fs) rs762031690
NM_000053.4(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.4(ATP7B):c.3182G>A (p.Gly1061Glu) rs764131178
NM_000053.4(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3236G>T (p.Cys1079Phe) rs1064797072
NM_000053.4(ATP7B):c.3247C>T (p.Leu1083Phe) rs1286080173
NM_000053.4(ATP7B):c.3305T>C (p.Ile1102Thr) rs560952220
NM_000053.4(ATP7B):c.3402del (p.Ala1135fs) rs137853281
NM_000053.4(ATP7B):c.3443T>C (p.Ile1148Thr) rs60431989
NM_000053.4(ATP7B):c.3449del (p.Asn1150fs) rs1555285380
NM_000053.4(ATP7B):c.3517G>A (p.Glu1173Lys) rs756029120
NM_000053.4(ATP7B):c.3556G>A (p.Gly1186Ser) rs786204547
NM_000053.4(ATP7B):c.3659C>T (p.Thr1220Met) rs193922107
NM_000053.4(ATP7B):c.3694A>C (p.Thr1232Pro) rs568009639
NM_000053.4(ATP7B):c.3722C>T (p.Ala1241Val) rs1555283994
NM_000053.4(ATP7B):c.3796G>A (p.Gly1266Arg) rs121907992
NM_000053.4(ATP7B):c.3818C>T (p.Pro1273Leu) rs758355520
NM_000053.4(ATP7B):c.383del (p.Gly128fs) rs797045083
NM_000053.4(ATP7B):c.3884C>T (p.Ala1295Val)
NM_000053.4(ATP7B):c.3895C>T (p.Leu1299Phe) rs749472361
NM_000053.4(ATP7B):c.3904-2A>G rs1057517233
NM_000053.4(ATP7B):c.3955C>T (p.Arg1319Ter) rs193922109
NM_000053.4(ATP7B):c.4006del (p.Ile1336fs) rs1555283564
NM_000053.4(ATP7B):c.4021G>A (p.Gly1341Ser) rs587783317
NM_000053.4(ATP7B):c.4022G>A (p.Gly1341Asp)
NM_000053.4(ATP7B):c.4051C>T (p.Gln1351Ter) rs786204578
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.4090_4091GT[1] (p.Ser1365fs) rs771603301
NM_000053.4(ATP7B):c.4114C>T (p.Gln1372Ter) rs755584106
NM_000053.4(ATP7B):c.51+4A>T rs369488210
NM_000053.4(ATP7B):c.524_525del (p.Lys175fs) rs558037268
NM_000053.4(ATP7B):c.525dup (p.Val176fs) rs558037268
NM_000053.4(ATP7B):c.778dup (p.Gln260fs) rs786204570
NM_000053.4(ATP7B):c.802_808del (p.Cys268fs) rs1566598496
NM_000053.4(ATP7B):c.813C>A (p.Cys271Ter) rs572147914
NM_000053.4(ATP7B):c.845del (p.Leu282fs) rs193922111
NM_000053.4(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000053.4(ATP7B):c.994G>T (p.Glu332Ter) rs761084829
NM_000054.6(AVPR2):c.1009C>T (p.Arg337Ter) rs104894753
NM_000054.6(AVPR2):c.102del (p.Leu35fs) rs1569545523
NM_000054.6(AVPR2):c.137T>A (p.Ile46Lys) rs104894759
NM_000054.6(AVPR2):c.213G>A (p.Trp71Ter) rs104894751
NM_000054.6(AVPR2):c.24del (p.Ala9fs) rs1557100304
NM_000054.6(AVPR2):c.253G>A (p.Asp85Asn) rs104894754
NM_000054.6(AVPR2):c.310C>T (p.Arg104Cys) rs104894760
NM_000054.6(AVPR2):c.313T>G (p.Phe105Val) rs104894758
NM_000054.6(AVPR2):c.337C>T (p.Arg113Trp) rs28935496
NM_000054.6(AVPR2):c.388A>T (p.Ile130Phe) rs796052096
NM_000054.6(AVPR2):c.395C>A (p.Ala132Asp) rs104894747
NM_000054.6(AVPR2):c.409C>T (p.Arg137Cys) rs104894761
NM_000054.6(AVPR2):c.410G>A (p.Arg137His) rs104894756
NM_000054.6(AVPR2):c.410G>T (p.Arg137Leu) rs104894756
NM_000054.6(AVPR2):c.541C>T (p.Arg181Cys) rs104894757
NM_000054.6(AVPR2):c.553G>T (p.Gly185Cys) rs104894748
NM_000054.6(AVPR2):c.602G>A (p.Gly201Asp) rs104894755
NM_000054.6(AVPR2):c.607C>T (p.Arg203Cys) rs104894750
NM_000054.6(AVPR2):c.614A>G (p.Tyr205Cys) rs104894749
NM_000054.6(AVPR2):c.838dup (p.Tyr280fs) rs193922121
NM_000054.6(AVPR2):c.839A>G (p.Tyr280Cys) rs104894752
NM_000054.6(AVPR2):c.878G>A (p.Trp293Ter) rs1064797077
NM_000054.6(AVPR2):c.966del (p.Trp323fs) rs886040961
NM_000059.3(BRCA2):c.100G>T (p.Glu34Ter) rs80358391
NM_000059.3(BRCA2):c.1399A>T (p.Lys467Ter) rs80358427
NM_000059.3(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.3(BRCA2):c.3109C>T (p.Gln1037Ter) rs80358557
NM_000059.3(BRCA2):c.4243G>T (p.Glu1415Ter) rs397507327
NM_000059.3(BRCA2):c.4648G>T (p.Glu1550Ter) rs80358695
NM_000059.3(BRCA2):c.4936_4939del (p.Glu1646fs) rs80359473
NM_000059.3(BRCA2):c.4965C>G (p.Tyr1655Ter) rs80358721
NM_000059.3(BRCA2):c.5453C>A (p.Ser1818Ter) rs1566232471
NM_000059.3(BRCA2):c.5609_5610delinsAG (p.Phe1870Ter) rs276174859
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5682C>G (p.Tyr1894Ter) rs41293497
NM_000059.3(BRCA2):c.5791C>T (p.Gln1931Ter) rs80358807
NM_000059.3(BRCA2):c.5857G>T (p.Glu1953Ter) rs80358814
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.631+2T>G rs81002899
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000059.3(BRCA2):c.6656C>G (p.Ser2219Ter) rs80358893
NM_000059.3(BRCA2):c.6952C>T (p.Arg2318Ter) rs80358920
NM_000059.3(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000059.3(BRCA2):c.7464_7465insTA (p.Asp2489Ter) rs886038169
NM_000059.3(BRCA2):c.7480C>T (p.Arg2494Ter) rs80358972
NM_000059.3(BRCA2):c.7529T>C (p.Leu2510Pro) rs80358979
NM_000059.3(BRCA2):c.7579del (p.Ala2526_Val2527insTer) rs1555286294
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8219T>A (p.Leu2740Ter) rs80359070
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000059.3(BRCA2):c.8732C>A (p.Ala2911Glu) rs80359130
NM_000059.3(BRCA2):c.9117G>A (p.Pro3039=) rs28897756
NM_000059.3(BRCA2):c.9196C>T (p.Gln3066Ter) rs80359180
NM_000059.3(BRCA2):c.9294C>G (p.Tyr3098Ter) rs80359200
NM_000059.3(BRCA2):c.92G>A (p.Trp31Ter) rs397508045
NM_000059.3(BRCA2):c.9382C>T (p.Arg3128Ter) rs80359212
NM_000059.3(BRCA2):c.9672dup (p.Tyr3225fs) rs80359773
NM_000059.3(BRCA2):c.9693del (p.Leu3232fs) rs1566260827
NM_000067.3(CA2):c.120T>G (p.Tyr40Ter) rs118203934
NM_000067.3(CA2):c.21C>A (p.Tyr7Ter) rs1554709677
NM_000067.3(CA2):c.232+1G>A rs573750741
NM_000067.3(CA2):c.319C>T (p.His107Tyr) rs118203933
NM_000076.2(CDKN1C):c.139C>T (p.Gln47Ter) rs137852766
NM_000076.2(CDKN1C):c.189_190insTTCCAGCTGG (p.Asp64fs) rs1554938197
NM_000076.2(CDKN1C):c.196del (p.Gln66fs) rs1554938194
NM_000076.2(CDKN1C):c.310_311delinsG (p.Leu104fs) rs387906399
NM_000076.2(CDKN1C):c.333dup (p.Ala112fs) rs786205235
NM_000076.2(CDKN1C):c.384_391del (p.Leu129fs) rs1554938087
NM_000076.2(CDKN1C):c.387del (p.Glu130fs)
NM_000076.2(CDKN1C):c.400dup (p.Glu134fs) rs786205236
NM_000076.2(CDKN1C):c.449del (p.Pro150fs) rs786205234
NM_000076.2(CDKN1C):c.5+2T>C rs587777866
NM_000076.2(CDKN1C):c.611_635dup (p.Ala213fs) rs1554937847
NM_000076.2(CDKN1C):c.629_630insGCTCCGGCCCC (p.Ala211fs) rs786205241
NM_000076.2(CDKN1C):c.631delinsAA (p.Ala211fs) rs786205239
NM_000076.2(CDKN1C):c.632_637CCCCGG[4] (p.197_198AP[11]) rs772704243
NM_000076.2(CDKN1C):c.635del (p.Pro212fs) rs786205237
NM_000076.2(CDKN1C):c.641_644delinsGGG (p.Pro214fs) rs786205240
NM_000076.2(CDKN1C):c.647del (p.Pro216fs) rs1564929584
NM_000076.2(CDKN1C):c.673G>T (p.Glu225Ter) rs1564929520
NM_000076.2(CDKN1C):c.694C>T (p.Gln232Ter) rs797045445
NM_000076.2(CDKN1C):c.706G>T (p.Glu236Ter) rs1564929426
NM_000076.2(CDKN1C):c.740C>A (p.Ser247Ter) rs104894200
NM_000076.2(CDKN1C):c.815T>G (p.Ile272Ser) rs515726203
NM_000076.2(CDKN1C):c.820G>A (p.Asp274Asn) rs387907225
NM_000076.2(CDKN1C):c.826T>G (p.Phe276Val) rs387907223
NM_000076.2(CDKN1C):c.827T>C (p.Phe276Ser) rs387907224
NM_000076.2(CDKN1C):c.832A>G (p.Lys278Glu) rs387907226
NM_000076.2(CDKN1C):c.836G>C (p.Arg279Pro) rs318240750
NM_000076.2(CDKN1C):c.836G>T (p.Arg279Leu) rs318240750
NM_000076.2(CDKN1C):c.842G>T (p.Arg281Ile) rs886037912
NM_000076.2(CDKN1C):c.845C>A (p.Ser282Ter) rs267606716
NM_000076.2(CDKN1C):c.845C>G (p.Ser282Ter) rs267606716
NM_000085.4(CLCNKB):c.1046C>A (p.Ala349Asp) rs121909134
NM_000085.4(CLCNKB):c.1294T>C (p.Tyr432His) rs121909135
NM_000085.4(CLCNKB):c.1312C>T (p.Arg438Cys) rs121909133
NM_000085.4(CLCNKB):c.1381dup (p.Ile461fs) rs1057516207
NM_000085.4(CLCNKB):c.1476del (p.Gly493fs)
NM_000085.4(CLCNKB):c.18dup (p.Leu7fs)
NM_000085.4(CLCNKB):c.371C>T (p.Pro124Leu) rs121909131
NM_000085.4(CLCNKB):c.610G>A (p.Ala204Thr) rs121909132
NM_000085.4(CLCNKB):c.656-31del
NM_000091.4(COL4A3):c.1175G>A (p.Gly392Glu) rs1114167371
NM_000091.4(COL4A3):c.1216C>T (p.Arg406Ter) rs371334239
NM_000091.4(COL4A3):c.1594G>T (p.Gly532Cys)
NM_000091.4(COL4A3):c.2023_2030ATCCCTGG[3] (p.Gly680fs) rs1553758893
NM_000091.4(COL4A3):c.2083G>A (p.Gly695Arg) rs200287952
NM_000091.4(COL4A3):c.2162del (p.Gly721fs)
NM_000091.4(COL4A3):c.2371C>T (p.Arg791Ter) rs1060499654
NM_000091.4(COL4A3):c.2452G>A (p.Gly818Arg) rs868002181
NM_000091.4(COL4A3):c.2621_2622delinsT (p.Gly874fs) rs1553760257
NM_000091.4(COL4A3):c.2768_2778del (p.Val923fs) rs766306957
NM_000091.4(COL4A3):c.3109C>T (p.Arg1037Ter) rs766900945
NM_000091.4(COL4A3):c.3230G>A (p.Gly1077Asp) rs1559909384
NM_000091.4(COL4A3):c.3240_3243AAAG[1] (p.Lys1082fs) rs1057516204
NM_000091.4(COL4A3):c.3266G>A (p.Gly1089Asp)
NM_000091.4(COL4A3):c.345del (p.Pro116fs) rs749390823
NM_000091.4(COL4A3):c.3499G>A (p.Gly1167Arg) rs267606745
NM_000091.4(COL4A3):c.3575G>A (p.Gly1192Glu)
NM_000091.4(COL4A3):c.3580del (p.Arg1194fs)
NM_000091.4(COL4A3):c.3813del (p.Ser1272fs) rs1559914770
NM_000091.4(COL4A3):c.391G>T (p.Glu131Ter) rs1346138010
NM_000091.4(COL4A3):c.3955G>A (p.Gly1319Arg) rs765661521
NM_000091.4(COL4A3):c.40_63del (p.Leu14_Leu21del) rs876657397
NM_000091.4(COL4A3):c.4347_4353del (p.Arg1450fs) rs748026887
NM_000091.4(COL4A3):c.4382C>T (p.Pro1461Leu) rs760462252
NM_000091.4(COL4A3):c.4415_4419CTTTT[1] (p.Leu1474fs) rs1445615417
NM_000091.4(COL4A3):c.443G>T (p.Gly148Val) rs775373641
NM_000091.4(COL4A3):c.4441C>T (p.Arg1481Ter) rs121912824
NM_000091.4(COL4A3):c.4474A>T (p.Ser1492Cys) rs1057519377
NM_000091.4(COL4A3):c.4571C>G (p.Ser1524Ter) rs121912825
NM_000091.4(COL4A3):c.4803del (p.Gly1602fs) rs760846085
NM_000091.4(COL4A3):c.765G>A (p.Thr255=) rs869025328
NM_000091.4(COL4A3):c.898G>A (p.Gly300Arg)
NM_000091.4(COL4A3):c.998G>C (p.Gly333Ala) rs1057519376
NM_000091.4(COL4A3):c.[3490G>T];[687G>A]
NM_000092.4(COL4A4):c.1221_1237del (p.Gly408fs) rs1559606445
NM_000092.4(COL4A4):c.1221del (p.Pro409fs)
NM_000092.4(COL4A4):c.1320_1369+2del rs1553676221
NM_000092.4(COL4A4):c.1389del (p.Asn464fs)
NM_000092.4(COL4A4):c.1598G>A (p.Gly533Asp) rs1553669704
NM_000092.4(COL4A4):c.2171del (p.Arg724fs)
NM_000092.4(COL4A4):c.2638_2639del (p.Ala880fs) rs1553641611
NM_000092.4(COL4A4):c.2638del (p.Ala880fs) rs778043831
NM_000092.4(COL4A4):c.2906C>G (p.Ser969Ter) rs35138315
NM_000092.4(COL4A4):c.2969-1G>C rs1553639043
NM_000092.4(COL4A4):c.3601G>A (p.Gly1201Ser) rs121912858
NM_000092.4(COL4A4):c.3713C>A (p.Ser1238Ter) rs121912859
NM_000092.4(COL4A4):c.3834dup (p.Gly1279fs) rs1553625684
NM_000092.4(COL4A4):c.4129C>T (p.Arg1377Ter) rs121912861
NM_000092.4(COL4A4):c.4460_4463dup (p.Trp1488fs)
NM_000092.4(COL4A4):c.4694_4713del (p.Arg1565fs) rs1553612433
NM_000092.4(COL4A4):c.4715C>T (p.Pro1572Leu) rs121912863
NM_000092.4(COL4A4):c.4820del (p.Ala1607fs) rs1559394354
NM_000092.4(COL4A4):c.4923C>A (p.Cys1641Ter) rs121912862
NM_000092.4(COL4A4):c.594+1G>A rs1553690565
NM_000092.4(COL4A4):c.[1320_1369+2del];[2320G>C]
NM_000097.7(CPOX):c.1339C>T (p.Arg447Cys) rs28931603
NM_000102.4(CYP17A1):c.1040G>A (p.Arg347His) rs61754278
NM_000102.4(CYP17A1):c.1162A>T (p.Lys388Ter) rs1060499582
NM_000102.4(CYP17A1):c.1459_1467del (p.Asp487_Phe489del) rs756135168
NM_000102.4(CYP17A1):c.286C>T (p.Arg96Trp) rs104894138
NM_000102.4(CYP17A1):c.316T>C (p.Ser106Pro) rs104894135
NM_000118.3(ENG):c.816+6T>C rs759191907
NM_000135.2(FANCA):c.1007_3066del
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000135.2(FANCA):c.894_1006del113 (p.Trp298Cysfs)
NM_000135.2:c.1471_1626del
NM_000135.2:c.1627_1900del
NM_000135.3(FANCA):c.(?_-1)_522+?del
NM_000135.4(FANCA):c.100A>T (p.Lys34Ter) rs772858764
NM_000135.4(FANCA):c.1028_1029AG[3] (p.Glu345fs) rs769580546
NM_000135.4(FANCA):c.1074_1075del (p.Tyr359fs) rs878853660
NM_000135.4(FANCA):c.1111_1114TTGG[1] (p.Val372fs) rs397507552
NM_000135.4(FANCA):c.1158G>A (p.Trp386Ter)
NM_000135.4(FANCA):c.1226-2A>G rs773906241
NM_000135.4(FANCA):c.1303C>T (p.Arg435Cys) rs148473140
NM_000135.4(FANCA):c.1304G>A (p.Arg435His) rs1060501879
NM_000135.4(FANCA):c.1340C>G (p.Ser447Ter) rs149551759
NM_000135.4(FANCA):c.1359+1G>C rs1555561294
NM_000135.4(FANCA):c.1378C>T (p.Arg460Ter) rs1438828232
NM_000135.4(FANCA):c.1472_1566+1del rs1567628967
NM_000135.4(FANCA):c.154C>T (p.Arg52Ter) rs773159223
NM_000135.4(FANCA):c.1606del (p.Ser536fs) rs587776570
NM_000135.4(FANCA):c.1615del (p.Asp539fs) rs778507965
NM_000135.4(FANCA):c.1630dup (p.His544fs)
NM_000135.4(FANCA):c.1771C>T (p.Arg591Ter) rs753980264
NM_000135.4(FANCA):c.1809dup (p.Ile604fs) rs1343140664
NM_000135.4(FANCA):c.1812_1813AG[1] (p.Glu605fs) rs759899153
NM_000135.4(FANCA):c.1824dup (p.Arg609fs)
NM_000135.4(FANCA):c.1827-1G>A rs555449842
NM_000135.4(FANCA):c.1979T>C (p.Leu660Pro) rs1567621042
NM_000135.4(FANCA):c.1981A>T (p.Arg661Ter) rs1060501878
NM_000135.4(FANCA):c.1A>G (p.Met1Val) rs772751654
NM_000135.4(FANCA):c.2107C>T (p.Gln703Ter) rs1555548512
NM_000135.4(FANCA):c.2151+1G>A rs1555548428
NM_000135.4(FANCA):c.2172dup (p.Ser725fs) rs1555547955
NM_000135.4(FANCA):c.2314C>T (p.Gln772Ter)
NM_000135.4(FANCA):c.2317-2A>G rs1567618264
NM_000135.4(FANCA):c.238del (p.Cys80fs) rs864622187
NM_000135.4(FANCA):c.2398G>T (p.Glu800Ter) rs1555547474
NM_000135.4(FANCA):c.2529C>A (p.Tyr843Ter) rs1247378731
NM_000135.4(FANCA):c.2529_2530CT[2] (p.Leu845fs)
NM_000135.4(FANCA):c.2529_2530CT[3] (p.Cys846fs) rs763378933
NM_000135.4(FANCA):c.2546del (p.Ser849fs) rs1060501876
NM_000135.4(FANCA):c.2557C>T (p.Arg853Ter) rs752160950
NM_000135.4(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000135.4(FANCA):c.2587_2588dup (p.Leu864fs) rs1567616135
NM_000135.4(FANCA):c.258T>A (p.Tyr86Ter)
NM_000135.4(FANCA):c.2601+1G>T rs1188581065
NM_000135.4(FANCA):c.2602-2A>T rs1555545592
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000135.4(FANCA):c.2722_2723CT[4] (p.Trp911fs) rs878853663
NM_000135.4(FANCA):c.2735_2736CA[2] (p.His913fs)
NM_000135.4(FANCA):c.2738A>C (p.His913Pro) rs1302083447
NM_000135.4(FANCA):c.2749C>T (p.Arg917Ter) rs1060501880
NM_000135.4(FANCA):c.2778+1G>A
NM_000135.4(FANCA):c.2812_2830dup (p.Asp944delinsGlyAsnSerThrTer) rs1283284704
NM_000135.4(FANCA):c.283+1G>T rs1232171121
NM_000135.4(FANCA):c.283+3A>C rs786204204
NM_000135.4(FANCA):c.2839dup (p.Ser947fs) rs756367276
NM_000135.4(FANCA):c.2840C>G (p.Ser947Ter) rs745568821
NM_000135.4(FANCA):c.2851C>T (p.Arg951Trp) rs755546887
NM_000135.4(FANCA):c.2852G>A (p.Arg951Gln) rs755922289
NM_000135.4(FANCA):c.2870G>A (p.Trp957Ter) rs927630499
NM_000135.4(FANCA):c.294_295delinsTT (p.Leu98_Gln99delinsPheTer)
NM_000135.4(FANCA):c.295C>T (p.Gln99Ter) rs1057516430
NM_000135.4(FANCA):c.2T>C (p.Met1Thr) rs769479800
NM_000135.4(FANCA):c.3066+1G>T rs587783028
NM_000135.4(FANCA):c.3085G>T (p.Glu1029Ter) rs1555538740
NM_000135.4(FANCA):c.3163C>T (p.Arg1055Trp) rs753063086
NM_000135.4(FANCA):c.3188G>A (p.Trp1063Ter) rs1166286386
NM_000135.4(FANCA):c.3239+1dup
NM_000135.4(FANCA):c.3241_3626+1del
NM_000135.4(FANCA):c.3316G>T (p.Glu1106Ter) rs777825824
NM_000135.4(FANCA):c.3348+1G>A rs751266148
NM_000135.4(FANCA):c.3349A>G (p.Arg1117Gly) rs149277003
NM_000135.4(FANCA):c.3391A>G (p.Thr1131Ala) rs574034197
NM_000135.4(FANCA):c.3400_3402TTC[1] (p.Phe1135del) rs786204246
NM_000135.4(FANCA):c.3517_3519TGG[1] (p.Trp1174del) rs1555536446
NM_000135.4(FANCA):c.3521G>A (p.Trp1174Ter)
NM_000135.4(FANCA):c.3558dup (p.Arg1187fs) rs747851434
NM_000135.4(FANCA):c.3634dup (p.Ser1212fs) rs1374769712
NM_000135.4(FANCA):c.3720_3724del (p.Glu1240fs) rs794726660
NM_000135.4(FANCA):c.3755_3756AG[3] (p.Glu1254fs) rs868273545
NM_000135.4(FANCA):c.3813dup (p.His1272fs) rs1555534521
NM_000135.4(FANCA):c.3913C>T (p.Leu1305Phe) rs753700179
NM_000135.4(FANCA):c.4069_4082del (p.Ala1357fs) rs747892390
NM_000135.4(FANCA):c.4122_4123CA[1] (p.Thr1375fs) rs776969626
NM_000135.4(FANCA):c.414_415TG[1] (p.Val139fs) rs864622188
NM_000135.4(FANCA):c.4261-2A>C rs915983602
NM_000135.4(FANCA):c.427A>T (p.Lys143Ter) rs539460201
NM_000135.4(FANCA):c.513G>A (p.Trp171Ter) rs121907930
NM_000135.4(FANCA):c.548G>A (p.Trp183Ter)
NM_000135.4(FANCA):c.549G>A (p.Trp183Ter) rs758528624
NM_000135.4(FANCA):c.641_642TG[1] (p.Cys215fs) rs1338138752
NM_000135.4(FANCA):c.65G>A (p.Trp22Ter) rs761341952
NM_000135.4(FANCA):c.709+5G>A rs759877008
NM_000135.4(FANCA):c.718C>T (p.Gln240Ter) rs1184639006
NM_000135.4(FANCA):c.790C>T (p.Gln264Ter)
NM_000135.4(FANCA):c.856C>T (p.Gln286Ter) rs1291524243
NM_000135.4(FANCA):c.862G>T (p.Glu288Ter) rs148100796
NM_000135.4(FANCA):c.912_913AC[2] (p.Thr306fs) rs764122657
NM_000135.4(FANCA):c.97del (p.Glu33fs) rs786204238
NM_000135.4(FANCA):c.983_986TCAC[1] (p.His330fs) rs772359099
NM_000136.2(FANCC):c.-78-?_250+?del
NM_000136.2(FANCC):c.997-?_1154+?del
NM_000136.3(FANCC):c.1162G>T (p.Gly388Ter) rs371897078
NM_000136.3(FANCC):c.1257del (p.Thr420fs)
NM_000136.3(FANCC):c.1257dup (p.Thr420fs) rs765551897
NM_000136.3(FANCC):c.1290C>A (p.Tyr430Ter) rs766105286
NM_000136.3(FANCC):c.1302dup (p.Gly435fs) rs730881709
NM_000136.3(FANCC):c.1312_1329+68dup rs1554829415
NM_000136.3(FANCC):c.1385_1386TC[1] (p.Ala464fs) rs730881710
NM_000136.3(FANCC):c.1392_1402del (p.Gln465fs) rs1564641485
NM_000136.3(FANCC):c.1393C>T (p.Gln465Ter)
NM_000136.3(FANCC):c.1428_1429CA[1] (p.Thr477fs)
NM_000136.3(FANCC):c.1487T>G (p.Leu496Arg) rs121917785
NM_000136.3(FANCC):c.1555dup (p.Thr519fs) rs794726667
NM_000136.3(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.3(FANCC):c.165+1G>T rs794726668
NM_000136.3(FANCC):c.1661T>C (p.Leu554Pro) rs104886458
NM_000136.3(FANCC):c.1663C>T (p.Arg555Ter) rs370974124
NM_000136.3(FANCC):c.251-2A>G rs1057517219
NM_000136.3(FANCC):c.29dup (p.Cys10fs) rs878853671
NM_000136.3(FANCC):c.319C>T (p.Gln107Ter) rs730881731
NM_000136.3(FANCC):c.339G>A (p.Trp113Ter) rs1057516291
NM_000136.3(FANCC):c.355_360delinsA (p.Ser119fs) rs587779904
NM_000136.3(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000136.3(FANCC):c.389_390del (p.Glu130fs) rs1564720605
NM_000136.3(FANCC):c.455dup (p.Asn152fs) rs774170058
NM_000136.3(FANCC):c.456+4A>T rs104886456
NM_000136.3(FANCC):c.485_486GA[1] (p.Glu163fs) rs730881708
NM_000136.3(FANCC):c.485_486GA[2] (p.Asn164fs) rs730881708
NM_000136.3(FANCC):c.485dup (p.Glu163fs) rs1554842611
NM_000136.3(FANCC):c.507del (p.Phe169fs)
NM_000136.3(FANCC):c.519del (p.Arg173fs) rs1564719070
NM_000136.3(FANCC):c.520C>T (p.Arg174Ter) rs781542763
NM_000136.3(FANCC):c.535C>T (p.Arg179Ter) rs769039987
NM_000136.3(FANCC):c.553C>T (p.Arg185Ter) rs121917783
NM_000136.3(FANCC):c.65G>A (p.Trp22Ter) rs377294947
NM_000136.3(FANCC):c.67del (p.Asp23fs) rs104886459
NM_000136.3(FANCC):c.946C>T (p.Gln316Ter) rs776529713
NM_000137.2(FAH):c.82_83delCC (p.Pro28Lysfs)
NM_000137.3(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.3(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000137.3(FAH):c.1025C>T (p.Pro342Leu) rs779040832
NM_000137.3(FAH):c.1027G>T (p.Gly343Trp)
NM_000137.3(FAH):c.1062+5G>A rs80338901
NM_000137.3(FAH):c.1069G>T (p.Glu357Ter) rs121965075
NM_000137.3(FAH):c.1090G>T (p.Glu364Ter) rs121965076
NM_000137.3(FAH):c.1141A>G (p.Arg381Gly) rs121965077
NM_000137.3(FAH):c.192G>T (p.Gln64His) rs80338894
NM_000137.3(FAH):c.401C>A (p.Ala134Asp) rs121965074
NM_000137.3(FAH):c.456G>A (p.Trp152Ter) rs370686447
NM_000137.3(FAH):c.47A>T (p.Asn16Ile) rs121965073
NM_000137.3(FAH):c.520C>T (p.Arg174Ter) rs781496816
NM_000137.3(FAH):c.554-1G>T rs80338895
NM_000137.3(FAH):c.607-6T>G rs80338896
NM_000137.3(FAH):c.698A>T (p.Asp233Val) rs80338897
NM_000137.3(FAH):c.707-1G>A rs149052294
NM_000137.3(FAH):c.709C>T (p.Arg237Ter) rs769550316
NM_000137.3(FAH):c.782C>T (p.Pro261Leu) rs80338898
NM_000137.3(FAH):c.786G>A (p.Trp262Ter) rs80338899
NM_000137.3(FAH):c.835del (p.Gln279fs) rs1555441703
NM_000137.3(FAH):c.836A>G (p.Gln279Arg) rs121965078
NM_000137.3(FAH):c.978dup (p.Leu327fs)
NM_000140.3(FECH):c.1078_1137del rs879255507
NM_000140.3(FECH):c.195_314del rs786205246
NM_000140.3(FECH):c.68_194del rs786205247
NM_000140.3(FECH):c.[1224T>A;1225C>T;1231T>G]
NM_000140.4(FECH):c.1077+1G>A rs786205245
NM_000140.4(FECH):c.1085T>G (p.Val362Gly) rs118204040
NM_000140.4(FECH):c.1136del (p.Lys379fs) rs764466739
NM_000140.4(FECH):c.1137+3A>G rs202147607
NM_000140.4(FECH):c.1250T>C (p.Phe417Ser) rs118204039
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000140.4(FECH):c.314+2T>G rs149067146
NM_000140.4(FECH):c.315-48T>C rs2272783
NM_000140.4(FECH):c.553G>A (p.Ala185Thr) rs397514476
NM_000140.4(FECH):c.580_584del (p.Tyr194fs) rs786205248
NM_000140.4(FECH):c.68-23C>T rs2269219
NM_000140.4(FECH):c.801G>A (p.Met267Ile) rs118204037
NM_000140.4(FECH):c.820G>A (p.Asp274Asn) rs146269992
NM_000142.4(FGFR3):c.1138G>A (p.Gly380Arg) rs28931614
NM_000142.4(FGFR3):c.1172C>A (p.Ala391Glu) rs28931615
NM_000142.4(FGFR3):c.1620C>G (p.Asn540Lys) rs28933068
NM_000142.4(FGFR3):c.1948A>G (p.Lys650Glu) rs78311289
NM_000142.4(FGFR3):c.1949A>C (p.Lys650Thr) rs121913105
NM_000142.4(FGFR3):c.742C>T (p.Arg248Cys) rs121913482
NM_000142.4(FGFR3):c.746C>G (p.Ser249Cys) rs121913483
NM_000142.4(FGFR3):c.749C>G (p.Pro250Arg) rs4647924
NM_000143.3(FH):c.1020T>A (p.Asn340Lys) rs398123159
NM_000143.3(FH):c.1027C>T (p.Arg343Ter) rs121913122
NM_000143.3(FH):c.1041del (p.Gly348fs) rs1060499641
NM_000143.3(FH):c.1063G>T (p.Glu355Ter) rs1060499642
NM_000143.3(FH):c.1083_1086del (p.Glu362fs) rs756469140
NM_000143.3(FH):c.1093A>G (p.Ser365Gly) rs863223966
NM_000143.3(FH):c.1118A>G (p.Asn373Ser) rs1060499643
NM_000143.3(FH):c.1126C>T (p.Gln376Ter) rs398123160
NM_000143.3(FH):c.1138dup (p.Met380fs) rs781466938
NM_000143.3(FH):c.1189G>A (p.Gly397Arg) rs863224007
NM_000143.3(FH):c.1209del (p.Phe403fs) rs1060499644
NM_000143.3(FH):c.1210G>T (p.Glu404Ter) rs797044974
NM_000143.3(FH):c.1255T>C (p.Ser419Pro) rs200004220
NM_000143.3(FH):c.1293del (p.Glu432fs) rs398123163
NM_000143.3(FH):c.1298_1340dup (p.Met449fs) rs1553340681
NM_000143.3(FH):c.133-1G>A rs863224011
NM_000143.3(FH):c.139C>T (p.Gln47Ter) rs863223980
NM_000143.3(FH):c.1500G>A (p.Trp500Ter) rs886039368
NM_000143.3(FH):c.157G>T (p.Glu53Ter) rs863224013
NM_000143.3(FH):c.239dup (p.Ile81fs) rs1553341942
NM_000143.3(FH):c.267+1G>C rs878853691
NM_000143.3(FH):c.267+1_267+10delGTAAGTGGCA rs1060499629
NM_000143.3(FH):c.301C>T (p.Arg101Ter) rs121913120
NM_000143.3(FH):c.302G>C (p.Arg101Pro) rs75086406
NM_000143.3(FH):c.320A>C (p.Asn107Thr) rs121913121
NM_000143.3(FH):c.322C>T (p.Gln108Ter) rs1060499630
NM_000143.3(FH):c.390_394TAAAT[1] (p.Lys131_Leu132insTer) rs863223995
NM_000143.3(FH):c.395del (p.Lys131_Leu132insTer) rs1060499631
NM_000143.3(FH):c.439dup (p.Thr147fs) rs1060499633
NM_000143.3(FH):c.524del (p.Val175fs) rs1060499634
NM_000143.3(FH):c.553_554insTG (p.Gln185fs) rs768182640
NM_000143.3(FH):c.556-2A>T rs750273092
NM_000143.3(FH):c.560C>G (p.Ser187Ter) rs398123166
NM_000143.3(FH):c.669_670AG[1] (p.Glu224fs) rs780001199
NM_000143.3(FH):c.698G>A (p.Arg233His) rs121913123
NM_000143.3(FH):c.698G>T (p.Arg233Leu) rs121913123
NM_000143.3(FH):c.722_738+3del rs1064792900
NM_000143.3(FH):c.808del (p.Tyr270fs) rs1060499637
NM_000143.3(FH):c.905-1G>A rs797044973
NM_000143.3(FH):c.912_918del (p.Phe305fs) rs794727836
NM_000143.3(FH):c.952C>T (p.His318Tyr) rs398123168
NM_000151.4(G6PC):c.1022T>A (p.Ile341Asn) rs387906505
NM_000151.4(G6PC):c.1039C>T (p.Gln347Ter) rs80356487
NM_000151.4(G6PC):c.113A>T (p.Asp38Val) rs104894565
NM_000151.4(G6PC):c.150_151del (p.Trp50fs) rs1057516674
NM_000151.4(G6PC):c.161A>C (p.Gln54Pro) rs1057517008
NM_000151.4(G6PC):c.229T>C (p.Trp77Arg) rs104894566
NM_000151.4(G6PC):c.230+4A>G rs587776757
NM_000151.4(G6PC):c.247C>T (p.Arg83Cys) rs1801175
NM_000151.4(G6PC):c.248G>A (p.Arg83His) rs1801176
NM_000151.4(G6PC):c.255C>A (p.Tyr85Ter) rs748363083
NM_000151.4(G6PC):c.262del (p.Val88fs)
NM_000151.4(G6PC):c.328G>A (p.Glu110Lys) rs104894567
NM_000151.4(G6PC):c.370G>A (p.Ala124Thr) rs104894568
NM_000151.4(G6PC):c.377_378TA[3] (p.Tyr128fs) rs80356488
NM_000151.4(G6PC):c.388_400del (p.Met130fs) rs1567705064
NM_000151.4(G6PC):c.497T>G (p.Val166Gly) rs104894571
NM_000151.4(G6PC):c.508C>T (p.Arg170Ter) rs373345919
NM_000151.4(G6PC):c.551G>A (p.Gly184Glu) rs104894569
NM_000151.4(G6PC):c.551G>T (p.Gly184Val) rs104894569
NM_000151.4(G6PC):c.562G>A (p.Gly188Ser) rs80356482
NM_000151.4(G6PC):c.562G>C (p.Gly188Arg) rs80356482
NM_000151.4(G6PC):c.648G>T (p.Leu216=) rs80356484
NM_000151.4(G6PC):c.724C>T (p.Gln242Ter) rs80356485
NM_000151.4(G6PC):c.79del (p.Gln27fs) rs80356479
NM_000151.4(G6PC):c.809G>T (p.Gly270Val) rs80356483
NM_000151.4(G6PC):c.883C>T (p.Arg295Cys) rs104894563
NM_000151.4(G6PC):c.980_982del (p.Phe327del) rs80356486
NM_000154.2(GALK1):c.1144C>T (p.Gln382Ter) rs111033608
NM_000154.2(GALK1):c.238G>T (p.Glu80Ter) rs104894577
NM_000154.2(GALK1):c.410dup (p.Gly138fs) rs767329054
NM_000154.2(GALK1):c.593C>T (p.Ala198Val) rs80084721
NM_000154.2(GALK1):c.766C>T (p.Arg256Trp)
NM_000154.2(GALK1):c.82C>A (p.Pro28Thr) rs104894572
NM_000154.2(GALK1):c.94G>A (p.Val32Met) rs104894576
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.2(GALT):c.[-1039_753del;820+50_*789delinsGAATAGACCCCA]
NM_000155.2(GALT):c.[940A>G;-119_-116delGTCA]
NM_000155.3(GALT):c.1078_1083delGCACTTins20 (p.?)
NM_000155.3(GALT):c.377+53_1059+87del
NM_000155.3(GALT):c.779_790delATGTGCGGCGGC (p.His260_Arg263del) rs111033762
NM_000155.3(GALT):c.790_792invCTA (p.Leu264Ter)
NM_000155.4(GALT):c.1001A>G (p.Lys334Arg) rs111033809
NM_000155.4(GALT):c.1006A>T (p.Met336Leu) rs111033810
NM_000155.4(GALT):c.100T>A (p.Tyr34Asn) rs111033836
NM_000155.4(GALT):c.1018G>A (p.Glu340Lys) rs111033806
NM_000155.4(GALT):c.1018G>T (p.Glu340Ter) rs111033806
NM_000155.4(GALT):c.1024C>A (p.Leu342Ile) rs111033812
NM_000155.4(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.4(GALT):c.1034C>A (p.Ala345Asp) rs111033815
NM_000155.4(GALT):c.1047del (p.Thr350fs) rs111033816
NM_000155.4(GALT):c.1048A>G (p.Thr350Ala) rs111033817
NM_000155.4(GALT):c.1052del (p.Pro351fs) rs111033813
NM_000155.4(GALT):c.1057C>T (p.Gln353Ter) rs111033818
NM_000155.4(GALT):c.1059+56C>T rs111033821
NM_000155.4(GALT):c.1060-1G>A rs367543268
NM_000155.4(GALT):c.1072del (p.Arg357_Leu358insTer) rs397515629
NM_000155.4(GALT):c.107C>T (p.Pro36Leu) rs111033645
NM_000155.4(GALT):c.1098C>A (p.Tyr366Ter) rs111033822
NM_000155.4(GALT):c.1108C>T (p.Gln370Ter) rs111033823
NM_000155.4(GALT):c.1132A>G (p.Ile378Val) rs111033819
NM_000155.4(GALT):c.1138T>C (p.Ter380Arg) rs111033824
NM_000155.4(GALT):c.113A>C (p.Gln38Pro) rs111033646
NM_000155.4(GALT):c.1140A>C (p.Ter380Cys) rs111033827
NM_000155.4(GALT):c.130G>A (p.Val44Met) rs111033647
NM_000155.4(GALT):c.130G>T (p.Val44Leu) rs111033647
NM_000155.4(GALT):c.134C>T (p.Ser45Leu) rs111033652
NM_000155.4(GALT):c.136_140del (p.Ala46fs) rs111033651
NM_000155.4(GALT):c.152G>A (p.Arg51Gln) rs111033648
NM_000155.4(GALT):c.152G>T (p.Arg51Leu) rs111033648
NM_000155.4(GALT):c.160C>T (p.Gln54Ter) rs111033649
NM_000155.4(GALT):c.163G>T (p.Gly55Cys) rs111033654
NM_000155.4(GALT):c.197C>A (p.Pro66His) rs111033656
NM_000155.4(GALT):c.197C>T (p.Pro66Leu) rs111033656
NM_000155.4(GALT):c.199C>T (p.Arg67Cys) rs111033658
NM_000155.4(GALT):c.1A>G (p.Met1Val) rs111033639
NM_000155.4(GALT):c.207_214del (p.Asp69fs) rs111033655
NM_000155.4(GALT):c.218_219CT[1] (p.Leu74fs) rs111033662
NM_000155.4(GALT):c.220_221insG (p.Leu74fs) rs111033659
NM_000155.4(GALT):c.221T>C (p.Leu74Pro) rs111033663
NM_000155.4(GALT):c.238C>T (p.Arg80Ter) rs111033664
NM_000155.4(GALT):c.241G>A (p.Ala81Thr) rs111033665
NM_000155.4(GALT):c.247G>A (p.Gly83Arg) rs111033660
NM_000155.4(GALT):c.253-2A>G rs111033661
NM_000155.4(GALT):c.25C>T (p.Gln9Ter) rs111033848
NM_000155.4(GALT):c.265T>C (p.Tyr89His) rs111033666
NM_000155.4(GALT):c.265T>G (p.Tyr89Asp) rs111033666
NM_000155.4(GALT):c.27G>C (p.Gln9His) rs111033637
NM_000155.4(GALT):c.285T>G (p.Phe95Leu) rs111033668
NM_000155.4(GALT):c.290A>G (p.Asn97Ser) rs111033669
NM_000155.4(GALT):c.292G>A (p.Asp98Asn) rs111033670
NM_000155.4(GALT):c.292G>C (p.Asp98His) rs111033670
NM_000155.4(GALT):c.308A>G (p.Gln103Arg) rs367543252
NM_000155.4(GALT):c.328+2T>C rs111033849
NM_000155.4(GALT):c.329-2A>C rs111033667
NM_000155.4(GALT):c.334dup (p.Ser112fs) rs111033676
NM_000155.4(GALT):c.336T>C (p.Ser112=) rs367543254
NM_000155.4(GALT):c.337G>A (p.Asp113Asn) rs111033677
NM_000155.4(GALT):c.341A>T (p.His114Leu) rs111033678
NM_000155.4(GALT):c.350T>C (p.Phe117Ser) rs111033679
NM_000155.4(GALT):c.354A>C (p.Gln118His) rs111033673
NM_000155.4(GALT):c.367C>G (p.Arg123Gly) rs111033674
NM_000155.4(GALT):c.367C>T (p.Arg123Ter)
NM_000155.4(GALT):c.368G>A (p.Arg123Gln) rs111033675
NM_000155.4(GALT):c.374T>C (p.Val125Ala) rs111033680
NM_000155.4(GALT):c.377+1G>T rs111033681
NM_000155.4(GALT):c.379A>G (p.Lys127Glu) rs111033682
NM_000155.4(GALT):c.386T>C (p.Met129Thr) rs111033683
NM_000155.4(GALT):c.389G>A (p.Cys130Tyr) rs367543255
NM_000155.4(GALT):c.392T>G (p.Phe131Cys) rs111033684
NM_000155.4(GALT):c.394C>T (p.His132Tyr) rs111033688
NM_000155.4(GALT):c.396C>A (p.His132Gln) rs367543256
NM_000155.4(GALT):c.398_399dup (p.Trp134fs) rs367543269
NM_000155.4(GALT):c.400del (p.Trp134fs) rs111033689
NM_000155.4(GALT):c.404C>G (p.Ser135Trp) rs111033690
NM_000155.4(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.4(GALT):c.410dup (p.Thr138fs) rs397515628
NM_000155.4(GALT):c.413C>T (p.Thr138Met) rs111033686
NM_000155.4(GALT):c.416T>C (p.Leu139Pro) rs111033687
NM_000155.4(GALT):c.41delinsTT (p.Ala14fs) rs111033634
NM_000155.4(GALT):c.424A>G (p.Met142Val) rs111033692
NM_000155.4(GALT):c.425T>A (p.Met142Lys) rs111033695
NM_000155.4(GALT):c.425T>C (p.Met142Thr) rs111033695
NM_000155.4(GALT):c.428C>T (p.Ser143Leu) rs111033697
NM_000155.4(GALT):c.442C>G (p.Arg148Gly) rs111033693
NM_000155.4(GALT):c.442C>T (p.Arg148Trp) rs111033693
NM_000155.4(GALT):c.443G>A (p.Arg148Gln) rs111033694
NM_000155.4(GALT):c.448G>C (p.Val150Leu) rs111033699
NM_000155.4(GALT):c.452T>C (p.Val151Ala) rs111033701
NM_000155.4(GALT):c.460T>C (p.Trp154Arg) rs111033702
NM_000155.4(GALT):c.460T>G (p.Trp154Gly) rs111033702
NM_000155.4(GALT):c.462G>A (p.Trp154Ter) rs111033704
NM_000155.4(GALT):c.482T>C (p.Leu161Pro) rs111033700
NM_000155.4(GALT):c.490C>T (p.Gln164Ter) rs111033705
NM_000155.4(GALT):c.496C>G (p.Pro166Ala) rs367543257
NM_000155.4(GALT):c.499T>C (p.Trp167Arg) rs111033708
NM_000155.4(GALT):c.502G>T (p.Val168Leu) rs367543258
NM_000155.4(GALT):c.505C>A (p.Gln169Lys) rs111033709
NM_000155.4(GALT):c.507+2T>C rs111033710
NM_000155.4(GALT):c.508-5G>C rs111033714
NM_000155.4(GALT):c.509T>A (p.Ile170Asn) rs111033839
NM_000155.4(GALT):c.509T>C (p.Ile170Thr) rs111033839
NM_000155.4(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.4(GALT):c.524G>A (p.Gly175Asp) rs111033718
NM_000155.4(GALT):c.528_529insG (p.Met177fs) rs111033719
NM_000155.4(GALT):c.536G>A (p.Gly179Asp) rs111033720
NM_000155.4(GALT):c.539G>T (p.Cys180Phe) rs111033844
NM_000155.4(GALT):c.541T>G (p.Ser181Ala) rs111033828
NM_000155.4(GALT):c.542C>T (p.Ser181Phe) rs367543259
NM_000155.4(GALT):c.547C>A (p.Pro183Thr) rs111033721
NM_000155.4(GALT):c.550C>G (p.His184Asp) rs111033716
NM_000155.4(GALT):c.552C>A (p.His184Gln) rs111033717
NM_000155.4(GALT):c.553C>T (p.Pro185Ser) rs111033826
NM_000155.4(GALT):c.554C>A (p.Pro185His) rs111033722
NM_000155.4(GALT):c.554C>T (p.Pro185Leu) rs111033722
NM_000155.4(GALT):c.556C>T (p.His186Tyr) rs111033725
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.564+1G>A rs111033723
NM_000155.4(GALT):c.565-2A>G rs111033731
NM_000155.4(GALT):c.574A>G (p.Ser192Gly) rs111033830
NM_000155.4(GALT):c.575G>A (p.Ser192Asn) rs111033734
NM_000155.4(GALT):c.580T>C (p.Phe194Leu) rs111033726
NM_000155.4(GALT):c.584T>C (p.Leu195Pro) rs111033728
NM_000155.4(GALT):c.594T>G (p.Ile198Met) rs111033729
NM_000155.4(GALT):c.595G>A (p.Ala199Thr) rs111033730
NM_000155.4(GALT):c.598del (p.Gln200fs) rs111033738
NM_000155.4(GALT):c.601C>T (p.Arg201Cys) rs111033739
NM_000155.4(GALT):c.602G>A (p.Arg201His) rs111033735
NM_000155.4(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.4(GALT):c.610C>T (p.Arg204Ter) rs111033737
NM_000155.4(GALT):c.611G>C (p.Arg204Pro) rs111033740
NM_000155.4(GALT):c.616C>T (p.Gln206Ter) rs1554709366
NM_000155.4(GALT):c.619C>T (p.Gln207Ter) rs111033743
NM_000155.4(GALT):c.626A>C (p.Tyr209Ser) rs111033744
NM_000155.4(GALT):c.626A>G (p.Tyr209Cys) rs111033744
NM_000155.4(GALT):c.634C>T (p.Gln212Ter) rs111033746
NM_000155.4(GALT):c.635A>C (p.Gln212Pro) rs111033833
NM_000155.4(GALT):c.650T>C (p.Leu217Pro) rs111033741
NM_000155.4(GALT):c.652C>G (p.Leu218Val) rs2070075
NM_000155.4(GALT):c.652del (p.Leu217_Leu218insTer) rs111033742
NM_000155.4(GALT):c.658G>A (p.Glu220Lys) rs111033747
NM_000155.4(GALT):c.658dup (p.Glu220fs) rs111033825
NM_000155.4(GALT):c.667C>A (p.Arg223Ser) rs111033750
NM_000155.4(GALT):c.676C>G (p.Leu226Val) rs111033751
NM_000155.4(GALT):c.677T>C (p.Leu226Pro) rs111033752
NM_000155.4(GALT):c.67A>G (p.Thr23Ala) rs111033635
NM_000155.4(GALT):c.680T>C (p.Leu227Pro) rs111033846
NM_000155.4(GALT):c.687+2T>C rs111033748
NM_000155.4(GALT):c.687G>T (p.Lys229Asn) rs111033753
NM_000155.4(GALT):c.691C>T (p.Arg231Cys) rs111033749
NM_000155.4(GALT):c.692G>A (p.Arg231His) rs111033754
NM_000155.4(GALT):c.697G>C (p.Val233Leu) rs111033843
NM_000155.4(GALT):c.719_728del (p.Leu240fs) rs111033838
NM_000155.4(GALT):c.745T>C (p.Trp249Arg) rs111033757
NM_000155.4(GALT):c.747G>A (p.Trp249Ter) rs111033758
NM_000155.4(GALT):c.748C>A (p.Pro250Thr) rs111033759
NM_000155.4(GALT):c.752A>C (p.Tyr251Ser) rs111033755
NM_000155.4(GALT):c.752A>G (p.Tyr251Cys) rs111033755
NM_000155.4(GALT):c.756G>T (p.Gln252His) rs111033769
NM_000155.4(GALT):c.768_770del (p.Pro257del) rs111033770
NM_000155.4(GALT):c.770C>T (p.Pro257Leu) rs111033845
NM_000155.4(GALT):c.777G>A (p.Arg259=) rs111033761
NM_000155.4(GALT):c.785G>C (p.Arg262Pro) rs111033763
NM_000155.4(GALT):c.793C>G (p.Pro265Ala) rs111033764
NM_000155.4(GALT):c.812A>G (p.Glu271Gly) rs111033765
NM_000155.4(GALT):c.814C>G (p.Arg272Gly) rs111033766
NM_000155.4(GALT):c.815G>A (p.Arg272His) rs111033831
NM_000155.4(GALT):c.821-2A>G rs111033767
NM_000155.4(GALT):c.821-7A>G
NM_000155.4(GALT):c.824del (p.Leu275fs) rs111033777
NM_000155.4(GALT):c.82G>A (p.Asp28Asn) rs111033636
NM_000155.4(GALT):c.82G>C (p.Asp28His) rs111033636
NM_000155.4(GALT):c.82G>T (p.Asp28Tyr) rs111033636
NM_000155.4(GALT):c.833T>A (p.Ile278Asn) rs111033778
NM_000155.4(GALT):c.836T>G (p.Met279Arg) rs111033779
NM_000155.4(GALT):c.844C>G (p.Leu282Val) rs111033772
NM_000155.4(GALT):c.854A>G (p.Lys285Arg) rs367543263
NM_000155.4(GALT):c.855G>T (p.Lys285Asn) rs111033773
NM_000155.4(GALT):c.857A>G (p.Tyr286Cys) rs367543262
NM_000155.4(GALT):c.865C>T (p.Leu289Phe) rs111033774
NM_000155.4(GALT):c.866T>G (p.Leu289Arg) rs111033775
NM_000155.4(GALT):c.871G>A (p.Glu291Lys) rs111033780
NM_000155.4(GALT):c.872A>T (p.Glu291Val) rs111033841
NM_000155.4(GALT):c.881T>A (p.Phe294Tyr) rs111033781
NM_000155.4(GALT):c.882del (p.Tyr296fs) rs111033782
NM_000155.4(GALT):c.883C>A (p.Pro295Thr) rs111033783
NM_000155.4(GALT):c.904+1G>T rs367543271
NM_000155.4(GALT):c.904+5G>A rs367543264
NM_000155.4(GALT):c.90G>C (p.Gln30His) rs111033834
NM_000155.4(GALT):c.91C>A (p.His31Asn) rs111033643
NM_000155.4(GALT):c.920C>A (p.Ser307Ter) rs367543265
NM_000155.4(GALT):c.922G>A (p.Glu308Lys) rs111033784
NM_000155.4(GALT):c.938G>A (p.Trp313Ter) rs1410159094
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.947G>A (p.Trp316Ter) rs111033790
NM_000155.4(GALT):c.948G>A (p.Trp316Ter) rs111033791
NM_000155.4(GALT):c.949del (p.Gln317fs) rs111033785
NM_000155.4(GALT):c.950A>G (p.Gln317Arg) rs111033786
NM_000155.4(GALT):c.951G>T (p.Gln317His) rs111033787
NM_000155.4(GALT):c.952del (p.Leu318fs) rs111033788
NM_000155.4(GALT):c.957C>A (p.His319Gln) rs111033792
NM_000155.4(GALT):c.958G>A (p.Ala320Thr) rs111033795
NM_000155.4(GALT):c.95T>A (p.Ile32Asn) rs111033644
NM_000155.4(GALT):c.961C>T (p.His321Tyr) rs367543266
NM_000155.4(GALT):c.967T>C (p.Tyr323His) rs111033796
NM_000155.4(GALT):c.967T>G (p.Tyr323Asp) rs111033796
NM_000155.4(GALT):c.968A>G (p.Tyr323Cys) rs367543267
NM_000155.4(GALT):c.970C>T (p.Pro324Ser) rs111033798
NM_000155.4(GALT):c.974C>T (p.Pro325Leu) rs111033794
NM_000155.4(GALT):c.976del (p.Leu326fs) rs111033799
NM_000155.4(GALT):c.979del (p.Leu327fs) rs111033801
NM_000155.4(GALT):c.980T>C (p.Leu327Pro) rs111033832
NM_000155.4(GALT):c.983G>A (p.Arg328His) rs111033802
NM_000155.4(GALT):c.986C>T (p.Ser329Phe) rs111033803
NM_000155.4(GALT):c.989C>T (p.Ala330Val) rs111033804
NM_000155.4(GALT):c.98G>A (p.Arg33His) rs111033829
NM_000155.4(GALT):c.997C>G (p.Arg333Gly) rs111033800
NM_000155.4(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000155.4(GALT):c.998G>A (p.Arg333Gln) rs111033808
NM_000155.4(GALT):c.998G>T (p.Arg333Leu) rs111033808
NM_000163.5(GHR):c.184G>A (p.Glu62Lys) rs121909361
NM_000163.5(GHR):c.484G>A (p.Val162Ile) rs6413484
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000163.5(GHR):c.559T>C (p.Trp187Arg) rs886037910
NM_000163.5(GHR):c.726G>C (p.Glu242Asp) rs45588036
NM_000163.5(GHR):c.876-1G>C rs730880308
NM_000168.5(GLI3):c.2770_2771insNC_012920.1:g.12243..12314
NM_000168.6(GLI3):c.1096C>T (p.Arg366Ter)
NM_000168.6(GLI3):c.1433_1434del (p.Ile477_Tyr478insTer)
NM_000168.6(GLI3):c.1451G>A (p.Trp484Ter) rs1562690271
NM_000168.6(GLI3):c.1778del (p.Arg593fs)
NM_000168.6(GLI3):c.1874G>A (p.Arg625Gln) rs1554306094
NM_000168.6(GLI3):c.1878del (p.Lys626fs) rs1554306093
NM_000168.6(GLI3):c.1999_2002CGAC[1] (p.Pro668fs) rs116840742
NM_000168.6(GLI3):c.2012del (p.Gly671fs) rs116840743
NM_000168.6(GLI3):c.2023del (p.Glu675fs) rs116840744
NM_000168.6(GLI3):c.2032del (p.Asp678fs) rs116840745
NM_000168.6(GLI3):c.2058_2059delinsAT (p.Glu687Ter) rs116840746
NM_000168.6(GLI3):c.2062G>T (p.Glu688Ter) rs116840747
NM_000168.6(GLI3):c.2110C>T (p.Gln704Ter) rs116840748
NM_000168.6(GLI3):c.2139del (p.Ser712_Cys713insTer) rs116840749
NM_000168.6(GLI3):c.2146C>T (p.Gln716Ter) rs116840750
NM_000168.6(GLI3):c.2149C>T (p.Gln717Ter) rs116840751
NM_000168.6(GLI3):c.2157del (p.Ile720fs) rs116840752
NM_000168.6(GLI3):c.2172dup (p.Asn725fs) rs116840753
NM_000168.6(GLI3):c.2188_2206del (p.Leu730fs) rs116840754
NM_000168.6(GLI3):c.2197_2198del (p.Thr733fs) rs116840755
NM_000168.6(GLI3):c.2346_2356del (p.Arg782fs) rs116840756
NM_000168.6(GLI3):c.2351_2355del (p.Lys784fs) rs116840757
NM_000168.6(GLI3):c.2431+1G>A rs116840758
NM_000168.6(GLI3):c.2483del (p.Pro828fs) rs116840759
NM_000168.6(GLI3):c.2567C>A (p.Ser856Ter) rs116840760
NM_000168.6(GLI3):c.2620del (p.Arg874fs) rs116840761
NM_000168.6(GLI3):c.2628del (p.Ser877fs) rs116840762
NM_000168.6(GLI3):c.2799C>G (p.Tyr933Ter) rs116840763
NM_000168.6(GLI3):c.2935del (p.Cys979fs) rs116840764
NM_000168.6(GLI3):c.3004del (p.Gly1001_Val1002insTer) rs116840765
NM_000168.6(GLI3):c.3324C>A (p.Tyr1108Ter) rs116840766
NM_000168.6(GLI3):c.3324C>G (p.Tyr1108Ter) rs116840766
NM_000168.6(GLI3):c.3386_3387del (p.Asp1128_Phe1129insTer) rs116840767
NM_000168.6(GLI3):c.3439G>T (p.Glu1147Ter) rs116840768
NM_000168.6(GLI3):c.3456G>T (p.Glu1152Asp) rs116840769
NM_000168.6(GLI3):c.3481C>T (p.Gln1161Ter) rs116840770
NM_000168.6(GLI3):c.3904_3912delinsT (p.Asn1302fs) rs1562657560
NM_000168.6(GLI3):c.4395del (p.Ser1466fs) rs1554304380
NM_000168.6(GLI3):c.4431dup (p.Glu1478Ter) rs1057520063
NM_000168.6(GLI3):c.4498G>T (p.Glu1500Ter) rs1562656759
NM_000168.6(GLI3):c.753T>G (p.Tyr251Ter)
NM_000168.6(GLI3):c.868C>T (p.Arg290Ter) rs121917713
NM_000169.2(GLA):c.1017_1027del (p.Trp340fs)
NM_000169.2(GLA):c.101A>G (p.Asn34Ser) rs104894835
NM_000169.2(GLA):c.1020G>A (p.Trp340Ter) rs104894842
NM_000169.2(GLA):c.1021G>A (p.Glu341Lys) rs869312214
NM_000169.2(GLA):c.1021G>T (p.Glu341Ter) rs869312214
NM_000169.2(GLA):c.1024C>T (p.Arg342Ter) rs104894843
NM_000169.2(GLA):c.1025G>A (p.Arg342Gln) rs28935493
NM_000169.2(GLA):c.1029_1030TC[2] (p.Ser345fs) rs398123198
NM_000169.2(GLA):c.104G>A (p.Gly35Glu) rs869312137
NM_000169.2(GLA):c.1066C>T (p.Arg356Trp) rs104894827
NM_000169.2(GLA):c.1067G>C (p.Arg356Pro) rs869312163
NM_000169.2(GLA):c.1072_1074del (p.Glu358del) rs730880453
NM_000169.2(GLA):c.107T>G (p.Leu36Trp) rs869312138
NM_000169.2(GLA):c.1081G>C (p.Gly361Arg) rs28935494
NM_000169.2(GLA):c.1088G>A (p.Arg363His) rs111422676
NM_000169.2(GLA):c.1095T>A (p.Tyr365Ter) rs104894849
NM_000169.2(GLA):c.109G>C (p.Ala37Pro)
NM_000169.2(GLA):c.1124_1176del (p.Gly375fs)
NM_000169.2(GLA):c.1125_1140del (p.Val376fs) rs876661347
NM_000169.2(GLA):c.1147_1149del (p.Phe383del) rs1057519609
NM_000169.2(GLA):c.118C>T (p.Pro40Ser) rs104894831
NM_000169.2(GLA):c.1192G>T (p.Glu398Ter) rs104894844
NM_000169.2(GLA):c.1209_1211AAG[1] (p.Arg404del)
NM_000169.2(GLA):c.1225C>G (p.Pro409Ala) rs878853698
NM_000169.2(GLA):c.1228A>G (p.Thr410Ala) rs104894852
NM_000169.2(GLA):c.1235_1236del (p.Thr412fs) rs797044777
NM_000169.2(GLA):c.1244T>C (p.Leu415Pro) rs112341092
NM_000169.2(GLA):c.124A>C (p.Met42Leu) rs797044613
NM_000169.2(GLA):c.125T>C (p.Met42Thr) rs398123201
NM_000169.2(GLA):c.125_137del (p.Met42fs)
NM_000169.2(GLA):c.1277_1278del (p.Lys426fs)
NM_000169.2(GLA):c.1280_1283ACTT[1] (p.Leu428fs)
NM_000169.2(GLA):c.131G>A (p.Trp44Ter) rs104894829
NM_000169.2(GLA):c.141G>C (p.Trp47Cys) rs1555987101
NM_000169.2(GLA):c.166T>G (p.Cys56Gly) rs104894836
NM_000169.2(GLA):c.190A>T (p.Ile64Phe) rs869312139
NM_000169.2(GLA):c.194G>C (p.Ser65Thr) rs104894848
NM_000169.2(GLA):c.195-1G>T rs398123206
NM_000169.2(GLA):c.256T>C (p.Tyr86His) rs869312140
NM_000169.2(GLA):c.26del (p.His9fs) rs1555987215
NM_000169.2(GLA):c.272T>A (p.Ile91Asn) rs869312141
NM_000169.2(GLA):c.290C>T (p.Ala97Val) rs1569304867
NM_000169.2(GLA):c.2T>C (p.Met1Thr) rs1555987232
NM_000169.2(GLA):c.307G>T (p.Glu103Ter) rs1569304851
NM_000169.2(GLA):c.334C>T (p.Arg112Cys) rs104894834
NM_000169.2(GLA):c.335G>A (p.Arg112His) rs372966991
NM_000169.2(GLA):c.369+2T>G rs387906483
NM_000169.2(GLA):c.404C>T (p.Ala135Val) rs1569304221
NM_000169.2(GLA):c.422C>T (p.Thr141Ile) rs886044843
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.2(GLA):c.436C>T (p.Pro146Ser) rs104894837
NM_000169.2(GLA):c.439G>A (p.Gly147Arg) rs1555985830
NM_000169.2(GLA):c.456C>A (p.Tyr152Ter) rs1555985827
NM_000169.2(GLA):c.45_49GCTTC[1] (p.Arg17fs) rs869312316
NM_000169.2(GLA):c.466G>A (p.Ala156Thr) rs28935195
NM_000169.2(GLA):c.484T>C (p.Trp162Arg) rs28935196
NM_000169.2(GLA):c.485G>A (p.Trp162Ter) rs727504350
NM_000169.2(GLA):c.496_497delinsGG (p.Leu166Gly)
NM_000169.2(GLA):c.520T>C (p.Cys174Arg)
NM_000169.2(GLA):c.540G>T (p.Leu180Phe) rs869312145
NM_000169.2(GLA):c.561G>A (p.Met187Ile) rs869312146
NM_000169.2(GLA):c.59C>A (p.Ala20Asp) rs869312134
NM_000169.2(GLA):c.606T>G (p.Cys202Trp) rs104894838
NM_000169.2(GLA):c.610T>C (p.Trp204Arg) rs869312148
NM_000169.2(GLA):c.62T>C (p.Leu21Pro) rs869312135
NM_000169.2(GLA):c.638A>G (p.Lys213Arg) rs869312149
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000169.2(GLA):c.640-1G>A
NM_000169.2(GLA):c.644A>G (p.Asn215Ser) rs28935197
NM_000169.2(GLA):c.647A>G (p.Tyr216Cys) rs398123217
NM_000169.2(GLA):c.658C>T (p.Arg220Ter) rs727503949
NM_000169.2(GLA):c.666C>A (p.Tyr222Ter) rs104894851
NM_000169.2(GLA):c.679C>T (p.Arg227Ter) rs104894841
NM_000169.2(GLA):c.680G>A (p.Arg227Gln) rs104894840
NM_000169.2(GLA):c.680G>C (p.Arg227Pro) rs104894840
NM_000169.2(GLA):c.707G>A (p.Trp236Ter) rs879254022
NM_000169.2(GLA):c.713G>A (p.Ser238Asn) rs730880450
NM_000169.2(GLA):c.718_719del (p.Lys240fs) rs869312389
NM_000169.2(GLA):c.724A>G (p.Ile242Val) rs397515873
NM_000169.2(GLA):c.735G>A (p.Trp245Ter) rs1060500747
NM_000169.2(GLA):c.748C>T (p.Gln250Ter) rs398123221
NM_000169.2(GLA):c.758T>C (p.Ile253Thr) rs727505292
NM_000169.2(GLA):c.776C>G (p.Pro259Arg) rs869312399
NM_000169.2(GLA):c.782G>T (p.Gly261Val) rs869312401
NM_000169.2(GLA):c.784T>C (p.Trp262Arg) rs869312154
NM_000169.2(GLA):c.786dup (p.Asn263fs) rs1555985091
NM_000169.2(GLA):c.790G>T (p.Asp264Tyr) rs190347120
NM_000169.2(GLA):c.791A>T (p.Asp264Val) rs28935486
NM_000169.2(GLA):c.797A>T (p.Asp266Val) rs28935487
NM_000169.2(GLA):c.801G>A (p.Met267Ile) rs730880451
NM_000169.2(GLA):c.805G>A (p.Val269Met) rs869312427
NM_000169.2(GLA):c.806T>C (p.Val269Ala) rs28935488
NM_000169.2(GLA):c.806T>G (p.Val269Gly) rs28935488
NM_000169.2(GLA):c.815A>G (p.Asn272Ser) rs28935495
NM_000169.2(GLA):c.826A>G (p.Ser276Gly)
NM_000169.2(GLA):c.830G>A (p.Trp277Ter) rs886044766
NM_000169.2(GLA):c.85dup (p.Ala29fs) rs1569306181
NM_000169.2(GLA):c.861G>A (p.Trp287Ter) rs104894839
NM_000169.2(GLA):c.890C>T (p.Ser297Phe) rs28935489
NM_000169.2(GLA):c.899T>C (p.Leu300Pro) rs398123223
NM_000169.2(GLA):c.901C>T (p.Arg301Ter) rs398123224
NM_000169.2(GLA):c.902G>A (p.Arg301Gln) rs104894828
NM_000169.2(GLA):c.950T>G (p.Ile317Ser) rs869312158
NM_000169.2(GLA):c.950_954dup (p.Ile319fs)
NM_000169.2(GLA):c.966C>A (p.Asp322Glu) rs398123226
NM_000169.2(GLA):c.974G>A (p.Gly325Asp) rs398123228
NM_000169.2(GLA):c.979C>A (p.Gln327Lys) rs28935491
NM_000169.2(GLA):c.980A>G (p.Gln327Arg) rs869312160
NM_000169.2(GLA):c.980A>T (p.Gln327Leu) rs869312160
NM_000169.2(GLA):c.982G>A (p.Gly328Arg) rs104894832
NM_000169.2(GLA):c.983G>C (p.Gly328Ala) rs28935492
NM_000169.2(GLA):c.98A>G (p.Asp33Gly) rs869312136
NM_000169.2(GLA):c.994dup (p.Arg332fs) rs1569302887
NM_000169.2(GLA):c.[196G>C;334C>T]
NM_000176.3(NR3C1):c.1430G>A (p.Arg477His) rs104893913
NM_000176.3(NR3C1):c.1676T>A (p.Ile559Asn) rs104893909
NM_000176.3(NR3C1):c.1891_1892+2del rs587776832
NM_000176.3(NR3C1):c.1922A>T (p.Asp641Val) rs104893908
NM_000176.3(NR3C1):c.2035G>A (p.Gly679Ser) rs104893914
NM_000176.3(NR3C1):c.2209T>C (p.Phe737Leu) rs121909727
NM_000176.3(NR3C1):c.2241T>G (p.Ile747Met) rs104893910
NM_000176.3(NR3C1):c.2318T>C (p.Leu773Pro) rs104893912
NM_000186.3(CFH):c.1126C>T (p.Gln376Ter)
NM_000186.3(CFH):c.1291T>A (p.Cys431Ser) rs121913056
NM_000186.3(CFH):c.1318_1327del (p.Pro440fs) rs1558162157
NM_000186.3(CFH):c.1606T>C (p.Cys536Arg) rs121913052
NM_000186.3(CFH):c.2397del (p.Glu800fs) rs1131690796
NM_000186.3(CFH):c.2876G>A (p.Cys959Tyr) rs121913053
NM_000186.3(CFH):c.2950T>C (p.Cys984Arg) rs886039869
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3590T>C (p.Val1197Ala) rs460184
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000186.3(CFH):c.380G>T (p.Arg127Leu) rs121913058
NM_000186.3(CFH):c.565G>T (p.Glu189Ter) rs121913054
NM_000186.3(CFH):c.668_670AGA[1] (p.Lys224del) rs796052138
NM_000186.3(CFH):c.710_711del (p.Lys236_Cys237insTer) rs1553273733
NM_000190.3:c.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT rs1555206402
NM_000190.4(HMBS):c.100C>A (p.Gln34Lys) rs118204105
NM_000190.4(HMBS):c.163G>T (p.Ala55Ser) rs118204106
NM_000190.4(HMBS):c.174del (p.Thr59fs) rs1565754285
NM_000190.4(HMBS):c.181dup (p.Asp61fs) rs1565754296
NM_000190.4(HMBS):c.211-1G>A rs1565754452
NM_000190.4(HMBS):c.242T>C (p.Leu81Pro) rs118204119
NM_000190.4(HMBS):c.266+1G>C rs1565754565
NM_000190.4(HMBS):c.331G>A (p.Gly111Arg) rs118204107
NM_000190.4(HMBS):c.346C>T (p.Arg116Trp) rs118204094
NM_000190.4(HMBS):c.445C>T (p.Arg149Ter) rs118204120
NM_000190.4(HMBS):c.446G>A (p.Arg149Gln) rs118204098
NM_000190.4(HMBS):c.463C>T (p.Gln155Ter) rs118204097
NM_000190.4(HMBS):c.499-1G>A rs1565756481
NM_000190.4(HMBS):c.499C>T (p.Arg167Trp) rs118204101
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.500G>T (p.Arg167Leu) rs118204095
NM_000190.4(HMBS):c.518G>A (p.Arg173Gln) rs118204096
NM_000190.4(HMBS):c.530T>G (p.Leu177Arg) rs118204108
NM_000190.4(HMBS):c.593G>A (p.Trp198Ter) rs118204100
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.647G>A (p.Gly216Asp) rs118204116
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000190.4(HMBS):c.669_698del (p.Glu223_Leu232del) rs1555206128
NM_000190.4(HMBS):c.728_729CT[1] (p.Leu244fs) rs1565757839
NM_000190.4(HMBS):c.734T>G (p.Leu245Arg) rs118204099
NM_000190.4(HMBS):c.734_741dup (p.Ile248fs) rs1565757857
NM_000190.4(HMBS):c.739T>C (p.Cys247Arg) rs118204111
NM_000190.4(HMBS):c.748G>A (p.Glu250Lys) rs118204112
NM_000190.4(HMBS):c.754G>A (p.Ala252Thr) rs118204113
NM_000190.4(HMBS):c.755C>T (p.Ala252Val) rs118204114
NM_000190.4(HMBS):c.766C>A (p.His256Asn) rs118204115
NM_000190.4(HMBS):c.771+1G>C rs1565758008
NM_000190.4(HMBS):c.77G>A (p.Arg26His) rs118204103
NM_000190.4(HMBS):c.849G>A (p.Trp283Ter) rs118204117
NM_000190.4(HMBS):c.900del (p.His300fs) rs1565758825
NM_000190.4(HMBS):c.91G>A (p.Ala31Thr) rs118204104
NM_000194.2(HPRT1):c.-707_27+2236del
NM_000194.2(HPRT1):c.122T>C (p.Leu41Pro) rs137852480
NM_000194.2(HPRT1):c.151C>G (p.Arg51Gly) rs137852494
NM_000194.2(HPRT1):c.151C>T (p.Arg51Ter) rs137852494
NM_000194.2(HPRT1):c.155A>G (p.Asp52Gly) rs137852502
NM_000194.2(HPRT1):c.172G>A (p.Gly58Arg) rs137852500
NM_000194.2(HPRT1):c.209G>A (p.Gly70Glu) rs137852487
NM_000194.2(HPRT1):c.211G>C (p.Gly71Arg) rs137852488
NM_000194.2(HPRT1):c.222C>A (p.Phe74Leu) rs137852481
NM_000194.2(HPRT1):c.232C>G (p.Leu78Val) rs137852501
NM_000194.2(HPRT1):c.239A>T (p.Asp80Val) rs137852478
NM_000194.2(HPRT1):c.312C>A (p.Ser104Arg) rs137852485
NM_000194.2(HPRT1):c.329C>T (p.Ser110Leu) rs137852482
NM_000194.2(HPRT1):c.389T>A (p.Val130Asp) rs137852483
NM_000194.2(HPRT1):c.396T>G (p.Ile132Met) rs137852477
NM_000194.2(HPRT1):c.419G>A (p.Gly140Asp) rs137852503
NM_000194.2(HPRT1):c.459T>G (p.Tyr153Ter) rs137852505
NM_000194.2(HPRT1):c.46G>A (p.Gly16Ser) rs137852499
NM_000194.2(HPRT1):c.481G>T (p.Ala161Ser) rs137852484
NM_000194.2(HPRT1):c.503C>T (p.Thr168Ile) rs137852498
NM_000194.2(HPRT1):c.580G>A (p.Asp194Asn) rs267606863
NM_000194.2(HPRT1):c.582C>G (p.Asp194Glu) rs137852504
NM_000194.2(HPRT1):c.595T>G (p.Phe199Val) rs137852486
NM_000194.2(HPRT1):c.602A>G (p.Asp201Gly) rs137852479
NM_000194.2(HPRT1):c.643_*6del21 (p.Lys215fs) rs387906428
NM_000194.3(HPRT1):c.134G>A (p.Arg45Lys) rs137852491
NM_000194.3(HPRT1):c.143G>A (p.Arg48His) rs387906725
NM_000194.3(HPRT1):c.193C>T (p.Leu65Phe) rs137852506
NM_000194.3(HPRT1):c.28-2A>T rs1569354918
NM_000194.3(HPRT1):c.319-2A>G
NM_000194.3(HPRT1):c.325C>T (p.Gln109Ter) rs137852489
NM_000194.3(HPRT1):c.368C>G (p.Ser123Ter)
NM_000194.3(HPRT1):c.428T>A (p.Met143Lys) rs137852496
NM_000194.3(HPRT1):c.47G>T (p.Gly16Val) rs1135401801
NM_000194.3(HPRT1):c.508C>T (p.Arg170Ter) rs137852497
NM_000194.3(HPRT1):c.527C>T (p.Pro176Leu) rs137852493
NM_000194.3(HPRT1):c.529G>T (p.Asp177Tyr) rs137852492
NM_000194.3(HPRT1):c.532+5G>A rs1569360089
NM_000194.3(HPRT1):c.609+5G>A rs1569360139
NM_000194.3(HPRT1):c.610-4_610-2delinsTTT rs672601245
NM_000194.3(HPRT1):c.610C>G (p.His204Asp) rs137852490
NM_000196.3(HSD11B2):c.1010_1012delGCT (p.Arg337_Tyr338delinsHis) rs397509434
NM_000196.4(HSD11B2):c.1009C>T (p.Arg337Cys) rs121917781
NM_000196.4(HSD11B2):c.1012T>C (p.Tyr338His) rs387907117
NM_000196.4(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000196.4(HSD11B2):c.623G>A (p.Arg208His) rs28934592
NM_000196.4(HSD11B2):c.637C>T (p.Arg213Cys) rs28934591
NM_000196.4(HSD11B2):c.664+14C>T rs376023420
NM_000196.4(HSD11B2):c.667G>A (p.Asp223Asn) rs121917833
NM_000196.4(HSD11B2):c.77_78del (p.Arg25_Ser26insTer) rs794726684
NM_000196.4(HSD11B2):c.835C>T (p.Arg279Cys) rs28934594
NM_000196.4(HSD11B2):c.895_897del (p.Tyr299del) rs794726670
NM_000198.4(HSD3B2):c.1022C>T (p.Pro341Leu) rs121964897
NM_000198.4(HSD3B2):c.1119A>C (p.Ter373Cys) rs80358218
NM_000198.4(HSD3B2):c.29C>A (p.Ala10Glu) rs28934880
NM_000198.4(HSD3B2):c.424G>A (p.Glu142Lys) rs80358219
NM_000198.4(HSD3B2):c.512G>A (p.Trp171Ter) rs80358216
NM_000198.4(HSD3B2):c.664C>A (p.Pro222Thr) rs80358220
NM_000198.4(HSD3B2):c.742_743delinsAA (p.Val248Asn) rs121964896
NM_000198.4(HSD3B2):c.776C>T (p.Thr259Met) rs80358221
NM_000204.4(CFI):c.782G>A (p.Gly261Asp) rs112534524
NM_000214.2(JAG1):c.2096_2100delGAAAG (p.Gly699Aspfs) rs886039393
NM_000214.3(JAG1):c.1057G>T (p.Glu353Ter)
NM_000214.3(JAG1):c.110T>C (p.Leu37Ser) rs121918352
NM_000214.3(JAG1):c.1205dup (p.Gln403fs) rs35615084
NM_000214.3(JAG1):c.1353dup (p.Asn452Ter) rs1060501347
NM_000214.3(JAG1):c.1375C>T (p.Gln459Ter)
NM_000214.3(JAG1):c.142G>T (p.Glu48Ter)
NM_000214.3(JAG1):c.1446_1448delinsC (p.His483fs) rs1568796241
NM_000214.3(JAG1):c.1485_1486del (p.Cys496fs) rs876660981
NM_000214.3(JAG1):c.1656del (p.Glu553fs) rs1568795820
NM_000214.3(JAG1):c.1713dup (p.Cys572fs) rs1555828546
NM_000214.3(JAG1):c.1856_1857del (p.Lys619fs)
NM_000214.3(JAG1):c.1977G>A (p.Trp659Ter)
NM_000214.3(JAG1):c.2096_2100del rs886039393
NM_000214.3(JAG1):c.2113+1G>T rs1294950721
NM_000214.3(JAG1):c.2113+5G>C rs886044704
NM_000214.3(JAG1):c.2118_2121CAGT[1] (p.Gln708fs) rs727504412
NM_000214.3(JAG1):c.2173dup (p.Asp725fs) rs1568794128
NM_000214.3(JAG1):c.2342dup (p.Asn782fs) rs886039887
NM_000214.3(JAG1):c.238A>T (p.Lys80Ter)
NM_000214.3(JAG1):c.2418C>A (p.Cys806Ter) rs533306015
NM_000214.3(JAG1):c.2429C>T (p.Pro810Leu) rs769531968
NM_000214.3(JAG1):c.2473C>T (p.Gln825Ter) rs1437309558
NM_000214.3(JAG1):c.2503_2504TG[2] (p.Val836fs)
NM_000214.3(JAG1):c.2532T>A (p.Cys844Ter)
NM_000214.3(JAG1):c.2639_2640del (p.Asp879_Cys880insTer) rs1568792286
NM_000214.3(JAG1):c.2688G>A (p.Trp896Ter) rs1060501350
NM_000214.3(JAG1):c.2774_2788delinsCCAGGGCA (p.Cys925fs) rs1555827769
NM_000214.3(JAG1):c.2840del (p.Lys947fs) rs1060501349
NM_000214.3(JAG1):c.2844C>A (p.Cys948Ter) rs1060501352
NM_000214.3(JAG1):c.2895dup (p.Asn966Ter) rs878853752
NM_000214.3(JAG1):c.2916+1G>C rs1568791920
NM_000214.3(JAG1):c.2966dup (p.Leu989fs) rs1555827729
NM_000214.3(JAG1):c.3006C>A (p.Cys1002Ter) rs372984801
NM_000214.3(JAG1):c.3008_3012dup (p.Pro1006fs)
NM_000214.3(JAG1):c.3164_3167del (p.Val1055fs) rs1555827653
NM_000214.3(JAG1):c.3166_3167AG[1] (p.Arg1056fs) rs1555827650
NM_000214.3(JAG1):c.350del (p.Arg117fs) rs1555830929
NM_000214.3(JAG1):c.439C>T (p.Gln147Ter) rs886043606
NM_000214.3(JAG1):c.543T>A (p.Tyr181Ter) rs1060501351
NM_000214.3(JAG1):c.550C>T (p.Arg184Cys) rs121918350
NM_000214.3(JAG1):c.551G>A (p.Arg184His) rs121918351
NM_000214.3(JAG1):c.693_694del (p.Arg231Serfs) rs876660978
NM_000214.3(JAG1):c.703C>T (p.Arg235Ter) rs876660980
NM_000214.3(JAG1):c.841C>T (p.Gln281Ter) rs886043603
NM_000214.3(JAG1):c.910C>T (p.Gln304Ter) rs863223649
NM_000214.3(JAG1):c.932del (p.Thr311fs) rs1555829037
NM_000218.2(KCNQ1):c.1085A>G (p.Lys362Arg) rs12720458
NM_000218.2(KCNQ1):c.1588C>T (p.Gln530Ter) rs397508097
NM_000218.2(KCNQ1):c.1615C>T (p.Arg539Trp) rs199472795
NM_000218.2(KCNQ1):c.692G>A (p.Arg231His) rs199472709
NM_000218.2(KCNQ1):c.805G>A (p.Gly269Ser) rs120074193
NM_000229.1(LCAT):c.[349G>A;544C>T]
NM_000229.2(LCAT):c.101C>T (p.Pro34Leu) rs121908051
NM_000229.2(LCAT):c.1034C>T (p.Thr345Met) rs28940888
NM_000229.2(LCAT):c.1112C>T (p.Thr371Met) rs121908053
NM_000229.2(LCAT):c.1197dup (p.Gln400fs) rs794726663
NM_000229.2(LCAT):c.1210A>G (p.Met404Val) rs779114194
NM_000229.2(LCAT):c.321C>A (p.Tyr107Ter) rs121908055
NM_000229.2(LCAT):c.440C>T (p.Thr147Ile) rs121908050
NM_000229.2(LCAT):c.463A>G (p.Asn155Asp) rs121908057
NM_000229.2(LCAT):c.475C>T (p.Arg159Trp) rs28940887
NM_000229.2(LCAT):c.491_493dup (p.Ala165_Ala166insGly) rs794726662
NM_000229.2(LCAT):c.508T>C (p.Trp170Arg) rs267607211
NM_000229.2(LCAT):c.524-22T>C rs794726664
NM_000229.2(LCAT):c.698T>C (p.Leu233Pro) rs28942087
NM_000229.2(LCAT):c.756C>A (p.Asn252Lys) rs121908049
NM_000229.2(LCAT):c.827T>A (p.Met276Lys) rs121908054
NM_000229.2(LCAT):c.951G>A (p.Met317Ile) rs121908048
NM_000229.2(LCAT):c.969_971CCT[1] (p.Leu325del) rs121908056
NM_000229.2(LCAT):c.997G>A (p.Val333Met) rs776035233
NM_000239.2(LYZ):c.199G>C (p.Asp67His) rs387906535
NM_000239.2(LYZ):c.221T>C (p.Ile74Thr) rs121913547
NM_000239.2(LYZ):c.223T>A (p.Phe75Ile) rs121913549
NM_000239.2(LYZ):c.244T>A (p.Trp82Arg) rs387906536
NM_000239.2(LYZ):c.244T>C (p.Trp82Arg) rs387906536
NM_000243.2(MEFV):c.1099C>G (p.Leu367Val) rs1057519328
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1211A>G (p.His404Arg) rs755659290
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1432C>T (p.His478Tyr) rs104895105
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.2(MEFV):c.1730C>A (p.Thr577Asn) rs1057516210
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.1958G>A (p.Arg653His) rs104895085
NM_000243.2(MEFV):c.2040G>A (p.Met680Ile) rs28940580
NM_000243.2(MEFV):c.2040G>C (p.Met680Ile) rs28940580
NM_000243.2(MEFV):c.2064C>G (p.Tyr688Ter) rs104895098
NM_000243.2(MEFV):c.2078_2080TGA[1] (p.Met694del) rs104895091
NM_000243.2(MEFV):c.2080A>G (p.Met694Val) rs61752717
NM_000243.2(MEFV):c.2082G>A (p.Met694Ile) rs28940578
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.2(MEFV):c.250G>A (p.Glu84Lys) rs150819742
NM_000243.2(MEFV):c.289C>T (p.Gln97Ter) rs747515115
NM_000243.2(MEFV):c.332G>A (p.Gly111Glu) rs751454741
NM_000243.2(MEFV):c.436C>T (p.Gln146Ter) rs876660990
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.490A>T (p.Lys164Ter)
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.65del (p.Glu22fs)
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.2(MEFV):c.884dup (p.Gly296fs)
NM_000243.2(MEFV):c.[1437C>G;501G>C]
NM_000243.2(MEFV):c.[442G>C;2082G>A]
NM_000244.3(MEN1):c.1037G>A (p.Trp346Ter) rs1114167482
NM_000244.3(MEN1):c.1064+1G>A rs1114167489
NM_000244.3(MEN1):c.1065-2A>G
NM_000244.3(MEN1):c.1065-2A>T rs1565642765
NM_000244.3(MEN1):c.1077C>A (p.Cys359Ter) rs104894265
NM_000244.3(MEN1):c.1102_1104del (p.Glu368del) rs869025185
NM_000244.3(MEN1):c.1118C>A (p.Ala373Asp) rs1555164707
NM_000244.3(MEN1):c.1189G>T (p.Glu397Ter) rs772588551
NM_000244.3(MEN1):c.1189del (p.Glu397fs) rs386134247
NM_000244.3(MEN1):c.1208dup (p.Ser404fs) rs1555164430
NM_000244.3(MEN1):c.1228C>T (p.Gln410Ter) rs864622615
NM_000244.3(MEN1):c.1234_1235del (p.Asp411_Pro412insTer)
NM_000244.3(MEN1):c.1235_1236del (p.Pro412fs)
NM_000244.3(MEN1):c.1239_1240insGTCC (p.Cys414fs) rs1114167524
NM_000244.3(MEN1):c.1258C>T (p.Arg420Ter) rs1060499974
NM_000244.3(MEN1):c.1267G>A (p.Asp423Asn) rs104894264
NM_000244.3(MEN1):c.1268_1271del (p.Asp423fs)
NM_000244.3(MEN1):c.1321T>A (p.Trp441Arg) rs104894259
NM_000244.3(MEN1):c.1322G>A (p.Trp441Ter) rs104894260
NM_000244.3(MEN1):c.1326del (p.Thr443fs)
NM_000244.3(MEN1):c.1339C>T (p.Gln447Ter) rs794728654
NM_000244.3(MEN1):c.1349del (p.Gly450fs) rs1565640081
NM_000244.3(MEN1):c.1365+1_1365+11del rs764570645
NM_000244.3(MEN1):c.1366-2_*132del rs1565634591
NM_000244.3(MEN1):c.1366_*820del (p.Val456fs)
NM_000244.3(MEN1):c.1390_1397del (p.Ser464fs) rs1555163883
NM_000244.3(MEN1):c.1393C>T (p.Arg465Ter) rs104894267
NM_000244.3(MEN1):c.1397_1404dup (p.Ala469fs) rs1114167531
NM_000244.3(MEN1):c.1397_1419dup (p.Glu474fs) rs1555163780
NM_000244.3(MEN1):c.1415_1428del (p.Ala472fs)
NM_000244.3(MEN1):c.1421_1428dup (p.Gly477fs) rs1114167536
NM_000244.3(MEN1):c.1427G>A (p.Trp476Ter) rs1060499991
NM_000244.3(MEN1):c.142del (p.Leu48fs) rs1555166681
NM_000244.3(MEN1):c.1435del (p.Glu479fs)
NM_000244.3(MEN1):c.1444G>T (p.Glu482Ter) rs863224526
NM_000244.3(MEN1):c.1488del (p.Glu496fs) rs1555163646
NM_000244.3(MEN1):c.1550C>G (p.Ser517Ter) rs141679530
NM_000244.3(MEN1):c.1561del (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1561dup (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1594C>T (p.Arg532Ter) rs104894261
NM_000244.3(MEN1):c.1669A>T (p.Thr557Ser) rs121913035
NM_000244.3(MEN1):c.1675C>T (p.Gln559Ter) rs794728631
NM_000244.3(MEN1):c.1679G>A (p.Ser560Asn) rs863224527
NM_000244.3(MEN1):c.1685del (p.Lys562fs)
NM_000244.3(MEN1):c.1689dup (p.Lys564fs) rs1565635941
NM_000244.3(MEN1):c.168del (p.Asn57fs) rs1060499990
NM_000244.3(MEN1):c.191_195AGCCC[3] (p.Asp70fs) rs1555166609
NM_000244.3(MEN1):c.197_201GCCCC[3] (p.Asp70fs) rs730882136
NM_000244.3(MEN1):c.211_212del (p.Pro71fs) rs386134251
NM_000244.3(MEN1):c.231C>G (p.Tyr77Ter) rs1555166567
NM_000244.3(MEN1):c.237del (p.Val80fs) rs1114167486
NM_000244.3(MEN1):c.249_252del (p.Ile85fs) rs587776841
NM_000244.3(MEN1):c.252_253insTT (p.Ile85fs) rs386134253
NM_000244.3(MEN1):c.280_284dup (p.Gln96fs) rs1555166494
NM_000244.3(MEN1):c.307del (p.Leu103fs) rs794728639
NM_000244.3(MEN1):c.317_318del (p.Tyr106fs) rs1555166466
NM_000244.3(MEN1):c.318T>A (p.Tyr106Ter) rs1060499987
NM_000244.3(MEN1):c.322C>T (p.Arg108Ter) rs794728647
NM_000244.3(MEN1):c.322_323insT (p.Arg108fs) rs1565651568
NM_000244.3(MEN1):c.323del (p.Arg108fs) rs878855191
NM_000244.3(MEN1):c.346G>T (p.Glu116Ter) rs1060499992
NM_000244.3(MEN1):c.355_357AAG[1] (p.Lys120del) rs794728657
NM_000244.3(MEN1):c.358A>T (p.Lys120Ter) rs878855192
NM_000244.3(MEN1):c.378G>A (p.Trp126Ter) rs1555166365
NM_000244.3(MEN1):c.386del (p.Leu129fs) rs1565651223
NM_000244.3(MEN1):c.3G>A (p.Met1Ile) rs786204242
NM_000244.3(MEN1):c.402del (p.Phe134fs) rs397515385
NM_000244.3(MEN1):c.406_415delinsTCCCT (p.Asp136fs)
NM_000244.3(MEN1):c.415C>G (p.His139Asp) rs104894263
NM_000244.3(MEN1):c.421C>T (p.Gln141Ter) rs886039553
NM_000244.3(MEN1):c.461-1G>C
NM_000244.3(MEN1):c.493G>C (p.Ala165Pro) rs1565648656
NM_000244.3(MEN1):c.510C>A (p.Cys170Ter)
NM_000244.3(MEN1):c.518T>C (p.Leu173Pro) rs386134256
NM_000244.3(MEN1):c.563G>A (p.Trp188Ter) rs794728650
NM_000244.3(MEN1):c.566T>A (p.Val189Glu) rs104894262
NM_000244.3(MEN1):c.578_579del (p.Pro193fs) rs1555165756
NM_000244.3(MEN1):c.608G>A (p.Trp203Ter) rs104894258
NM_000244.3(MEN1):c.609G>A (p.Trp203Ter) rs104894257
NM_000244.3(MEN1):c.638_1065-143del
NM_000244.3(MEN1):c.640C>T (p.Gln214Ter) rs1565647767
NM_000244.3(MEN1):c.643_646del (p.Thr215fs) rs794728640
NM_000244.3(MEN1):c.648del (p.Asn217fs) rs878855196
NM_000244.3(MEN1):c.65T>G (p.Leu22Arg) rs104894256
NM_000244.3(MEN1):c.669+1G>A
NM_000244.3(MEN1):c.669+1G>T rs794728622
NM_000244.3(MEN1):c.670-1G>A
NM_000244.3(MEN1):c.674G>A (p.Trp225Ter) rs1565647197
NM_000244.3(MEN1):c.696C>A (p.Tyr232Ter) rs778921501
NM_000244.3(MEN1):c.749del (p.Pro250fs) rs1565646772
NM_000244.3(MEN1):c.754_760del (p.Ile252fs) rs1555165503
NM_000244.3(MEN1):c.761_764dup (p.Thr256fs)
NM_000244.3(MEN1):c.773del (p.Ser258fs)
NM_000244.3(MEN1):c.778G>A (p.Glu260Lys) rs104894268
NM_000244.3(MEN1):c.787C>T (p.Gln263Ter) rs886039416
NM_000244.3(MEN1):c.793C>T (p.Gln265Ter) rs104894266
NM_000244.3(MEN1):c.796C>T (p.Gln266Ter) rs1057520733
NM_000244.3(MEN1):c.798+1G>A rs794728652
NM_000244.3(MEN1):c.799-9G>A rs794728625
NM_000244.3(MEN1):c.810G>A (p.Trp270Ter)
NM_000244.3(MEN1):c.838del (p.Arg280fs) rs1555165360
NM_000244.3(MEN1):c.839+1G>A
NM_000244.3(MEN1):c.839+1G>T rs1060499976
NM_000244.3(MEN1):c.839G>A (p.Arg280Lys)
NM_000244.3(MEN1):c.843C>A (p.Tyr281Ter) rs1060503789
NM_000244.3(MEN1):c.85C>T (p.Arg29Ter) rs794728615
NM_000244.3(MEN1):c.928-2A>G rs1114167498
NM_000244.3(MEN1):c.955_1065-227del rs1555164870
NM_000244.3(MEN1):c.984C>A (p.Tyr328Ter) rs750904332
NM_000244.3(MEN1):c.984C>G (p.Tyr328Ter) rs750904332
NM_000254.2(MTR):c.1228G>C (p.Ala410Pro) rs121913582
NM_000254.2(MTR):c.1753C>T (p.Arg585Ter) rs121913580
NM_000254.2(MTR):c.1992_1993insATCA (p.Glu665fs)
NM_000254.2(MTR):c.2112_2113TC[1] (p.Leu705fs) rs797044444
NM_000254.2(MTR):c.2476del (p.Asp825_Ile826insTer)
NM_000254.2(MTR):c.2640_2642del (p.Ile881del) rs797044443
NM_000254.2(MTR):c.2758C>G (p.His920Asp) rs121913579
NM_000254.2(MTR):c.3380dup (p.Ala1128fs) rs797044445
NM_000254.2(MTR):c.3439C>T (p.Arg1147Ter)
NM_000254.2(MTR):c.3518C>T (p.Pro1173Leu) rs121913578
NM_000254.2(MTR):c.3613G>T (p.Glu1205Ter) rs121913581
NM_000255.3(MMUT):c.1332+1delG rs771542321
NM_000255.3(MMUT):c.322C>T rs121918257
NM_000255.3(MMUT):c.[1891delG];[322C>T]
NM_000255.4(MMUT):c.-39-1G>A rs879253822
NM_000255.4(MMUT):c.1022dup (p.Asn341fs) rs752898811
NM_000255.4(MMUT):c.1025C>A (p.Ser342Ter) rs770466993
NM_000255.4(MMUT):c.1032_1034TCT[2] (p.Leu347del) rs765373403
NM_000255.4(MMUT):c.1084-10A>G rs777031588
NM_000255.4(MMUT):c.1084-1G>A rs879253838
NM_000255.4(MMUT):c.1084-2A>G rs879253839
NM_000255.4(MMUT):c.1097A>G (p.Asn366Ser) rs864309737
NM_000255.4(MMUT):c.1105C>T (p.Arg369Cys) rs772552898
NM_000255.4(MMUT):c.1106G>A (p.Arg369His) rs564069299
NM_000255.4(MMUT):c.1126_1127del (p.Ala376fs) rs1554159950
NM_000255.4(MMUT):c.1130C>A (p.Ala377Glu) rs121918250
NM_000255.4(MMUT):c.1164T>A (p.Asn388Lys) rs879253840
NM_000255.4(MMUT):c.1181dup (p.Leu394fs) rs879253841
NM_000255.4(MMUT):c.1194_1195TG[1] (p.Val399fs) rs1227030642
NM_000255.4(MMUT):c.1207C>G (p.Arg403Gly) rs727504020
NM_000255.4(MMUT):c.1207C>T (p.Arg403Ter) rs727504020
NM_000255.4(MMUT):c.1271C>T (p.Pro424Leu) rs879253842
NM_000255.4(MMUT):c.1277G>A (p.Gly426Glu) rs533755473
NM_000255.4(MMUT):c.1280G>A (p.Gly427Asp) rs753288303
NM_000255.4(MMUT):c.1287C>G (p.Tyr429Ter) rs1346775255
NM_000255.4(MMUT):c.129G>A (p.Trp43Ter) rs879253825
NM_000255.4(MMUT):c.1333-20_1333-9del rs879253843
NM_000255.4(MMUT):c.1399C>T (p.Arg467Ter) rs774159791
NM_000255.4(MMUT):c.1420C>T (p.Arg474Ter) rs887126161
NM_000255.4(MMUT):c.1481T>A (p.Leu494Ter) rs764173488
NM_000255.4(MMUT):c.1489G>T (p.Glu497Ter) rs879253844
NM_000255.4(MMUT):c.1531C>T (p.Arg511Ter) rs761525156
NM_000255.4(MMUT):c.1553T>C (p.Leu518Pro) rs864309738
NM_000255.4(MMUT):c.1560+1G>T rs200019422
NM_000255.4(MMUT):c.160A>T (p.Lys54Ter) rs1554161054
NM_000255.4(MMUT):c.1655C>T (p.Ala552Val) rs879253845
NM_000255.4(MMUT):c.1663G>A (p.Ala555Thr) rs753564352
NM_000255.4(MMUT):c.1677-1G>A rs754369323
NM_000255.4(MMUT):c.1677-1G>C rs754369323
NM_000255.4(MMUT):c.1677_1747dup (p.Val583Aspfs) rs1554158970
NM_000255.4(MMUT):c.1741C>T (p.Arg581Ter) rs1238694184
NM_000255.4(MMUT):c.1849_1851CTT[1] (p.Leu618del) rs398123277
NM_000255.4(MMUT):c.1853T>C (p.Leu618Pro) rs879253846
NM_000255.4(MMUT):c.1867G>A (p.Gly623Arg) rs121918254
NM_000255.4(MMUT):c.1874A>G (p.Asp625Gly) rs879253847
NM_000255.4(MMUT):c.1880A>G (p.His627Arg) rs372486357
NM_000255.4(MMUT):c.1885dup (p.Arg629fs) rs1561952122
NM_000255.4(MMUT):c.1889G>A (p.Gly630Glu) rs143023066
NM_000255.4(MMUT):c.1956+2T>C rs750619189
NM_000255.4(MMUT):c.1957-2A>G rs1554158379
NM_000255.4(MMUT):c.1962_1963del (p.Pro654_Arg655insTer) rs1554158377
NM_000255.4(MMUT):c.1975C>T (p.Gln659Ter) rs879253848
NM_000255.4(MMUT):c.19C>T (p.Gln7Ter) rs761773115
NM_000255.4(MMUT):c.2026G>A (p.Ala676Thr)
NM_000255.4(MMUT):c.2054T>G (p.Leu685Arg) rs864309739
NM_000255.4(MMUT):c.2078del (p.Gly693fs) rs879253849
NM_000255.4(MMUT):c.2080C>T (p.Arg694Trp) rs777758903
NM_000255.4(MMUT):c.2099T>A (p.Met700Lys) rs140600746
NM_000255.4(MMUT):c.2107G>C (p.Gly703Arg) rs121918255
NM_000255.4(MMUT):c.2125-3C>G
NM_000255.4(MMUT):c.2150G>T (p.Gly717Val) rs121918252
NM_000255.4(MMUT):c.2179C>T (p.Arg727Ter) rs779990936
NM_000255.4(MMUT):c.2193_2196dup (p.Val733fs) rs879253850
NM_000255.4(MMUT):c.2194_2197delinsTGGAA (p.Ala732fs) rs879253851
NM_000255.4(MMUT):c.2200C>T (p.Gln734Ter) rs879253852
NM_000255.4(MMUT):c.278G>A (p.Arg93His) rs121918251
NM_000255.4(MMUT):c.281G>T (p.Gly94Val)
NM_000255.4(MMUT):c.284C>G (p.Pro95Arg) rs190834116
NM_000255.4(MMUT):c.299A>G (p.Tyr100Cys) rs864309735
NM_000255.4(MMUT):c.29dup (p.Leu10fs) rs1437477079
NM_000255.4(MMUT):c.2T>C (p.Met1Thr) rs879253820
NM_000255.4(MMUT):c.30dup (p.Leu11fs) rs879253821
NM_000255.4(MMUT):c.313T>C (p.Trp105Arg) rs121918249
NM_000255.4(MMUT):c.323G>A (p.Arg108His) rs483352778
NM_000255.4(MMUT):c.330T>G (p.Tyr110Ter) rs879253826
NM_000255.4(MMUT):c.349G>T (p.Glu117Ter) rs121918253
NM_000255.4(MMUT):c.360dup (p.Lys121Ter) rs1554160919
NM_000255.4(MMUT):c.378C>A (p.Asn126Lys) rs879253827
NM_000255.4(MMUT):c.394C>T (p.Gln132Ter) rs1554160743
NM_000255.4(MMUT):c.397G>A (p.Gly133Arg) rs879253828
NM_000255.4(MMUT):c.415G>A (p.Asp139Asn) rs879253829
NM_000255.4(MMUT):c.454C>T (p.Arg152Ter) rs780068818
NM_000255.4(MMUT):c.467A>T (p.Asp156Val) rs757000253
NM_000255.4(MMUT):c.521T>C (p.Phe174Ser) rs864309733
NM_000255.4(MMUT):c.52C>T (p.Gln18Ter) rs121918248
NM_000255.4(MMUT):c.55dup (p.Val19fs) rs879253823
NM_000255.4(MMUT):c.560C>G (p.Thr187Ser) rs879253830
NM_000255.4(MMUT):c.566A>T (p.Asn189Ile) rs200908035
NM_000255.4(MMUT):c.572C>A (p.Ala191Glu) rs760782399
NM_000255.4(MMUT):c.607G>A (p.Gly203Arg) rs778702777
NM_000255.4(MMUT):c.610_612GAA[1] (p.Glu205del) rs879253831
NM_000255.4(MMUT):c.622del (p.Val208fs)
NM_000255.4(MMUT):c.630del (p.Glu211fs) rs879253832
NM_000255.4(MMUT):c.643G>A (p.Gly215Ser) rs121918258
NM_000255.4(MMUT):c.643G>T (p.Gly215Cys) rs121918258
NM_000255.4(MMUT):c.653A>G (p.Gln218Arg) rs869320653
NM_000255.4(MMUT):c.655A>T (p.Asn219Tyr) rs121918256
NM_000255.4(MMUT):c.671_678dup (p.Val227fs) rs758008398
NM_000255.4(MMUT):c.682C>T (p.Arg228Ter) rs200596762
NM_000255.4(MMUT):c.689C>G (p.Thr230Arg) rs879253833
NM_000255.4(MMUT):c.691T>A (p.Tyr231Asn) rs864309736
NM_000255.4(MMUT):c.692dup (p.Tyr231Ter) rs747777227
NM_000255.4(MMUT):c.693C>G (p.Tyr231Ter) rs879253834
NM_000255.4(MMUT):c.729_730insTT (p.Asp244fs) rs780283588
NM_000255.4(MMUT):c.753+2T>A rs796052006
NM_000255.4(MMUT):c.806C>T (p.Ala269Val) rs767593892
NM_000255.4(MMUT):c.828G>C (p.Glu276Asp) rs12175488
NM_000255.4(MMUT):c.850G>A (p.Gly284Arg) rs761477436
NM_000255.4(MMUT):c.850G>T (p.Gly284Ter) rs761477436
NM_000255.4(MMUT):c.851G>A (p.Gly284Glu) rs879253835
NM_000255.4(MMUT):c.88C>T (p.Gln30Ter) rs879253824
NM_000255.4(MMUT):c.890C>T (p.Thr297Ile) rs547709692
NM_000255.4(MMUT):c.91C>T (p.Arg31Ter) rs398123278
NM_000255.4(MMUT):c.927G>A (p.Trp309Ter) rs879253836
NM_000255.4(MMUT):c.935G>T (p.Gly312Val) rs864309734
NM_000255.4(MMUT):c.947A>G (p.Tyr316Cys)
NM_000255.4(MMUT):c.974G>A (p.Gly325Asp) rs879253837
NM_000255.4(MMUT):c.977G>A (p.Arg326Lys) rs758577372
NM_000267.3(NF1):c.-383_*3522del
NM_000267.3(NF1):c.1017_1018CT[1] (p.Ser340fs) rs1555610903
NM_000267.3(NF1):c.1020dup (p.Val341fs) rs1555610905
NM_000267.3(NF1):c.1041_1045del (p.Gln347fs) rs1135402800
NM_000267.3(NF1):c.1059del (p.Lys354fs) rs863224488
NM_000267.3(NF1):c.1062+3A>G rs1057521098
NM_000267.3(NF1):c.1063-2A>G rs1060500358
NM_000267.3(NF1):c.1066del (p.Leu356fs)
NM_000267.3(NF1):c.1070T>C (p.Leu357Pro) rs137854563
NM_000267.3(NF1):c.1094C>A (p.Ser365Ter) rs864622107
NM_000267.3(NF1):c.1094C>G (p.Ser365Ter) rs864622107
NM_000267.3(NF1):c.1095_1096del (p.Gly367fs)
NM_000267.3(NF1):c.1139T>C (p.Leu380Pro) rs1555611004
NM_000267.3(NF1):c.1152del (p.Arg385fs) rs1135402803
NM_000267.3(NF1):c.1174C>T (p.Gln392Ter)
NM_000267.3(NF1):c.1185+1G>A rs864622161
NM_000267.3(NF1):c.1218del (p.His407fs) rs1131691106
NM_000267.3(NF1):c.1237T>C (p.Ser413Pro) rs1555611093
NM_000267.3(NF1):c.1238C>A (p.Ser413Ter)
NM_000267.3(NF1):c.1238C>G (p.Ser413Ter) rs1241533665
NM_000267.3(NF1):c.1246C>T (p.Arg416Ter) rs764079291
NM_000267.3(NF1):c.125_126dup (p.Leu43fs) rs1555604897
NM_000267.3(NF1):c.1260+1604A>G rs1131691067
NM_000267.3(NF1):c.1260+1G>A rs267606603
NM_000267.3(NF1):c.1260+1G>T
NM_000267.3(NF1):c.1260+220_7553-1095del
NM_000267.3(NF1):c.1280_1292del (p.Pro427fs) rs1135402804
NM_000267.3(NF1):c.1299T>G (p.Tyr433Ter) rs876660099
NM_000267.3(NF1):c.129_130ins568 (p.?)
NM_000267.3(NF1):c.1318C>T (p.Arg440Ter) rs778405030
NM_000267.3(NF1):c.1322_1323AT[1] (p.Met442fs) rs1135402805
NM_000267.3(NF1):c.1331del (p.Gly444fs) rs1567838293
NM_000267.3(NF1):c.1343dup (p.His448fs) rs1555611584
NM_000267.3(NF1):c.1344dup (p.Lys449Ter) rs1567838311
NM_000267.3(NF1):c.1354C>T (p.Gln452Ter) rs1555611590
NM_000267.3(NF1):c.1374dup (p.Ala459fs) rs1135402806
NM_000267.3(NF1):c.1381C>T (p.Arg461Ter) rs878853865
NM_000267.3(NF1):c.1392+1G>A rs267604791
NM_000267.3(NF1):c.1392+1G>C
NM_000267.3(NF1):c.1392+1delG rs1060500347
NM_000267.3(NF1):c.1393-1905_2251+85dup
NM_000267.3(NF1):c.1393-2488_1642-648delinsAATAG
NM_000267.3(NF1):c.1393-2652_1528-892del
NM_000267.3(NF1):c.1393-2A>G rs1555612266
NM_000267.3(NF1):c.1393-3329_3975-6377del
NM_000267.3(NF1):c.1393_1394delAG
NM_000267.3(NF1):c.1400_1415del (p.Thr467fs) rs1555612270
NM_000267.3(NF1):c.1400del (p.Thr467fs) rs1135402808
NM_000267.3(NF1):c.1423dup (p.Leu475fs) rs1555612274
NM_000267.3(NF1):c.1462del (p.Ser488fs) rs1135402810
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.1469_1470insTTAT (p.Lys490fs) rs1060500307
NM_000267.3(NF1):c.1469_1472del (p.Lys490fs) rs1135402811
NM_000267.3(NF1):c.1496T>G (p.Leu499Arg) rs1555612288
NM_000267.3(NF1):c.1514del (p.Lys505fs) rs1555612289
NM_000267.3(NF1):c.1523T>C (p.Leu508Pro) rs137854558
NM_000267.3(NF1):c.1525del (p.Cys509fs) rs1135402813
NM_000267.3(NF1):c.1525dup (p.Cys509fs) rs1135402813
NM_000267.3(NF1):c.1527+1509_1641+1137del
NM_000267.3(NF1):c.1527+1G>A rs1060500331
NM_000267.3(NF1):c.1527+443_3709-761dup
NM_000267.3(NF1):c.1527+5G>A rs1060500352
NM_000267.3(NF1):c.1528-960_1761del
NM_000267.3(NF1):c.1540C>T (p.Gln514Ter) rs1316926587
NM_000267.3(NF1):c.1541_1542del (p.Gln514fs) rs267606600
NM_000267.3(NF1):c.1541del (p.Gln514fs) rs1555612815
NM_000267.3(NF1):c.1549G>T (p.Glu517Ter) rs587778548
NM_000267.3(NF1):c.1561del (p.Ser521fs) rs1135402814
NM_000267.3(NF1):c.1570G>T (p.Glu524Ter) rs1135402815
NM_000267.3(NF1):c.1595T>C (p.Leu532Pro) rs199474737
NM_000267.3(NF1):c.1595T>G (p.Leu532Arg) rs199474737
NM_000267.3(NF1):c.1603C>T (p.Gln535Ter) rs1567843917
NM_000267.3(NF1):c.1607C>A (p.Ser536Ter) rs1555612859
NM_000267.3(NF1):c.1613del (p.Met538fs) rs1135402817
NM_000267.3(NF1):c.1618G>T (p.Glu540Ter) rs1567843930
NM_000267.3(NF1):c.1619del (p.Glu540fs) rs1567843934
NM_000267.3(NF1):c.1627C>T (p.Gln543Ter) rs894292181
NM_000267.3(NF1):c.1641+156_3975-2222del
NM_000267.3(NF1):c.1642-1G>A rs1555613185
NM_000267.3(NF1):c.1642-2A>T
NM_000267.3(NF1):c.1642-8A>G rs267606602
NM_000267.3(NF1):c.1646T>C (p.Leu549Pro) rs199474758
NM_000267.3(NF1):c.1658A>G (p.His553Arg) rs1064794274
NM_000267.3(NF1):c.1667_1670del (p.Asp556fs) rs1135402819
NM_000267.3(NF1):c.1680del (p.Leu560fs) rs1567845069
NM_000267.3(NF1):c.1683G>A (p.Trp561Ter) rs1135402820
NM_000267.3(NF1):c.1713G>A (p.Trp571Ter) rs863224489
NM_000267.3(NF1):c.1714del (p.Glu572fs) rs876660135
NM_000267.3(NF1):c.1721+1G>A rs1131691096
NM_000267.3(NF1):c.1721+1G>T rs1131691096
NM_000267.3(NF1):c.1721+3A>G rs1057518904
NM_000267.3(NF1):c.1721G>A (p.Ser574Asn) rs1555613206
NM_000267.3(NF1):c.1722-2A>G rs763983337
NM_000267.3(NF1):c.1724C>G (p.Ser575Ter)
NM_000267.3(NF1):c.1726C>T (p.Gln576Ter) rs1060500278
NM_000267.3(NF1):c.1738dup (p.Tyr580fs) rs786204255
NM_000267.3(NF1):c.1748A>G (p.Lys583Arg) rs199474760
NM_000267.3(NF1):c.1756_1759del (p.Thr586fs) rs786202782
NM_000267.3(NF1):c.1765C>T (p.Gln589Ter) rs1282299543
NM_000267.3(NF1):c.1783G>T (p.Glu595Ter)
NM_000267.3(NF1):c.1783_1784del (p.Glu595fs) rs786204059
NM_000267.3(NF1):c.1797G>A (p.Trp599Ter) rs1567845906
NM_000267.3(NF1):c.1804dup (p.Glu602fs)
NM_000267.3(NF1):c.1815del (p.Cys606fs) rs1567845935
NM_000267.3(NF1):c.1818C>A (p.Cys606Ter) rs1567845937
NM_000267.3(NF1):c.181dup (p.Ile61fs) rs1555604935
NM_000267.3(NF1):c.1845+1G>A rs1567845945
NM_000267.3(NF1):c.1845+537_4661+331del
NM_000267.3(NF1):c.1846-496_2410-645delinsTAGC
NM_000267.3(NF1):c.1846-613_4773-1009delinsTTAGGTTTAT
NM_000267.3(NF1):c.1857_1863del (p.Arg619fs) rs1567846634
NM_000267.3(NF1):c.1861del (p.Ser621fs)
NM_000267.3(NF1):c.1866T>A (p.Cys622Ter) rs753245823
NM_000267.3(NF1):c.1882dup (p.Tyr628fs) rs1555613558
NM_000267.3(NF1):c.1883_1885delinsCC (p.Tyr628fs) rs1135402823
NM_000267.3(NF1):c.1884C>A (p.Tyr628Ter) rs555635097
NM_000267.3(NF1):c.1885G>A (p.Gly629Arg) rs199474738
NM_000267.3(NF1):c.1895del (p.Cys632fs)
NM_000267.3(NF1):c.1912G>T (p.Gly638Ter) rs1555613567
NM_000267.3(NF1):c.1918dup (p.Thr640fs) rs1135402825
NM_000267.3(NF1):c.1949T>A (p.Leu650Ter) rs1135402826
NM_000267.3(NF1):c.1984A>T (p.Lys662Ter)
NM_000267.3(NF1):c.1988_2410-218delinsTGTC
NM_000267.3(NF1):c.1A>G (p.Met1Val) rs1060500252
NM_000267.3(NF1):c.2002-1G>A rs1555613743
NM_000267.3(NF1):c.2033del (p.Pro678fs) rs587781807
NM_000267.3(NF1):c.2033dup (p.Ile679fs) rs587781807
NM_000267.3(NF1):c.2034del (p.Ile679fs) rs1567847384
NM_000267.3(NF1):c.2034delinsCA (p.Ile679fs) rs1064796331
NM_000267.3(NF1):c.204+155_2990+53del
NM_000267.3(NF1):c.204+1G>A rs886039548
NM_000267.3(NF1):c.204+1G>T rs886039548
NM_000267.3(NF1):c.204+3_204+6delGAGT rs1567814632
NM_000267.3(NF1):c.2041C>T (p.Arg681Ter) rs768638173
NM_000267.3(NF1):c.2041del (p.Arg681fs) rs1567847398
NM_000267.3(NF1):c.2045_2049dup (p.Gln684fs)
NM_000267.3(NF1):c.2048_5041del
NM_000267.3(NF1):c.205-1284_289-944del
NM_000267.3(NF1):c.205-1G>C rs1555605362
NM_000267.3(NF1):c.205-2A>G
NM_000267.3(NF1):c.2062G>T (p.Glu688Ter) rs1555613784
NM_000267.3(NF1):c.2064dup (p.Val689fs) rs1555613786
NM_000267.3(NF1):c.206_207delGA rs1060500321
NM_000267.3(NF1):c.2071del (p.Leu691fs) rs1060500364
NM_000267.3(NF1):c.2122del (p.Ser708fs)
NM_000267.3(NF1):c.2148_2159delinsTGAAGTGTCT (p.Glu716fs) rs1567847538
NM_000267.3(NF1):c.2158dup (p.Arg720fs)
NM_000267.3(NF1):c.2167del (p.Val723fs) rs1567847571
NM_000267.3(NF1):c.2208_2209CA[1] (p.Thr737fs) rs1555613831
NM_000267.3(NF1):c.2218G>T (p.Glu740Ter) rs1135402827
NM_000267.3(NF1):c.221_222dup (p.Ala75fs)
NM_000267.3(NF1):c.2251+1G>A rs1555613843
NM_000267.3(NF1):c.2252-2A>C rs1131691105
NM_000267.3(NF1):c.2252-2A>G rs1131691105
NM_000267.3(NF1):c.2252-70_2326-39dup rs1555613896
NM_000267.3(NF1):c.2266C>T (p.Gln756Ter) rs1567847905
NM_000267.3(NF1):c.2272A>T (p.Arg758Ter)
NM_000267.3(NF1):c.2293del (p.Arg765fs)
NM_000267.3(NF1):c.2298_2304del (p.Glu767fs) rs786204154
NM_000267.3(NF1):c.2322_2323del (p.Glu775fs) rs1567847962
NM_000267.3(NF1):c.2325+1G>A rs1555613933
NM_000267.3(NF1):c.2325+1G>T rs1555613933