ClinVar Miner

List of variants in gene GJA5 studied for atrial fibrillation (disease)

Included ClinVar conditions (37):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 87
Download table as spreadsheet
GRCh37/hg19 1q21.2(chr1:147245049-147246661)
NM_005266.6(GJA5):c.-108G>A rs782165709
NM_005266.6(GJA5):c.-152G= rs791286
NM_005266.6(GJA5):c.-175G>A rs35594137
NM_005266.6(GJA5):c.-51G>C rs759091909
NM_005266.6(GJA5):c.-61A>G rs11552588
NM_005266.6(GJA5):c.-67G>A rs36214923
NM_005266.6(GJA5):c.-68C>T rs763234536
NM_181703.4(GJA5):c.*1211A>G rs886045244
NM_181703.4(GJA5):c.*1259C>T rs886045243
NM_181703.4(GJA5):c.*1396G>A rs886045242
NM_181703.4(GJA5):c.*364C>T rs886045247
NM_181703.4(GJA5):c.*46T>C rs886045249
NM_181703.4(GJA5):c.*508G>A rs587741640
NM_181703.4(GJA5):c.*520A>T rs886045246
NM_181703.4(GJA5):c.*608C>T rs36005900
NM_181703.4(GJA5):c.*60C>T rs886045248
NM_181703.4(GJA5):c.*616T>C rs202133825
NM_181703.4(GJA5):c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3] rs11267274
NM_181703.4(GJA5):c.-27T>C rs2232190
NM_181703.4(GJA5):c.1006G>A (p.Gly336Ser)
NM_181703.4(GJA5):c.1024C>T (p.Arg342Ter)
NM_181703.4(GJA5):c.1035_1038del (p.Ser345fs)
NM_181703.4(GJA5):c.1057T>G (p.Ser353Ala)
NM_181703.4(GJA5):c.1068A>G (p.Leu356=) rs886045250
NM_181703.4(GJA5):c.111G>A (p.Leu37=)
NM_181703.4(GJA5):c.117A>G (p.Thr39=)
NM_181703.4(GJA5):c.13A>G (p.Ser5Gly) rs144069395
NM_181703.4(GJA5):c.145C>T (p.Gln49Ter) rs387906612
NM_181703.4(GJA5):c.147G>A (p.Gln49=)
NM_181703.4(GJA5):c.148G>A (p.Ala50Thr) rs782167622
NM_181703.4(GJA5):c.170T>G (p.Ile57Ser)
NM_181703.4(GJA5):c.199G>A (p.Asp67Asn)
NM_181703.4(GJA5):c.199G>T (p.Asp67Tyr) rs150906806
NM_181703.4(GJA5):c.223A>T (p.Ile75Phe) rs587777304
NM_181703.4(GJA5):c.241C>T (p.Gln81Ter) rs1557943827
NM_181703.4(GJA5):c.253G>A (p.Val85Ile) rs387906613
NM_181703.4(GJA5):c.259A>T (p.Thr87Ser) rs1557943770
NM_181703.4(GJA5):c.278T>C (p.Met93Thr)
NM_181703.4(GJA5):c.286G>T (p.Ala96Ser) rs121434557
NM_181703.4(GJA5):c.297T>G (p.Thr99=)
NM_181703.4(GJA5):c.325C>T (p.Arg109Trp) rs782392307
NM_181703.4(GJA5):c.327G>A (p.Arg109=)
NM_181703.4(GJA5):c.334G>C (p.Glu112Gln) rs886045252
NM_181703.4(GJA5):c.342C>G (p.Ala114=) rs886045251
NM_181703.4(GJA5):c.348G>A (p.Glu116=)
NM_181703.4(GJA5):c.353G>A (p.Arg118Gln) rs782580208
NM_181703.4(GJA5):c.358T>C (p.Ser120Pro)
NM_181703.4(GJA5):c.365C>T (p.Ser122Phe) rs781831348
NM_181703.4(GJA5):c.369C>T (p.Tyr123=) rs2232191
NM_181703.4(GJA5):c.377C>T (p.Pro126Leu)
NM_181703.4(GJA5):c.411G>T (p.Glu137Asp) rs200288659
NM_181703.4(GJA5):c.430G>A (p.Ala144Thr) rs782438073
NM_181703.4(GJA5):c.433del (p.Leu145fs) rs781802553
NM_181703.4(GJA5):c.472C>T (p.Leu158=)
NM_181703.4(GJA5):c.478C>T (p.Arg160Cys)
NM_181703.4(GJA5):c.479G>T (p.Arg160Leu)
NM_181703.4(GJA5):c.496G>A (p.Gly166Ser) rs782065420
NM_181703.4(GJA5):c.513G>A (p.Gln171=) rs1571066735
NM_181703.4(GJA5):c.525C>G (p.Tyr175Ter)
NM_181703.4(GJA5):c.544C>T (p.Leu182=)
NM_181703.4(GJA5):c.592G>A (p.Val198Ile)
NM_181703.4(GJA5):c.661C>A (p.Leu221Ile) rs387906614
NM_181703.4(GJA5):c.685C>A (p.Leu229Met) rs387906615
NM_181703.4(GJA5):c.726G>A (p.Arg242=) rs150432230
NM_181703.4(GJA5):c.744C>A (p.Cys248Ter) rs1557942871
NM_181703.4(GJA5):c.771dup (p.Val258fs)
NM_181703.4(GJA5):c.787C>T (p.Pro263Ser)
NM_181703.4(GJA5):c.790C>A (p.Pro264Thr)
NM_181703.4(GJA5):c.793C>T (p.Pro265Ser) rs148311482
NM_181703.4(GJA5):c.864C>T (p.Ala288=)
NM_181703.4(GJA5):c.903A>G (p.Val301=)
NM_181703.4(GJA5):c.938T>C (p.Ile313Thr)
NM_181703.4(GJA5):c.941A>G (p.Gln314Arg)
NM_181703.4(GJA5):c.947G>A (p.Arg316His)
NM_181703.4(GJA5):c.956A>T (p.Gln319Leu)
NM_181703.4(GJA5):c.973A>C (p.Asn325His) rs782592443
NM_181703.4(GJA5):c.977G>A (p.Gly326Glu) rs782703462
NM_181703.4(GJA5):c.995G>A (p.Arg332His) rs116551187

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.