ClinVar Miner

List of variants in gene GJA5 reported as likely benign for atrial fibrillation (disease)

Included ClinVar conditions (37):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 18
Download table as spreadsheet
NM_005266.6(GJA5):c.-152G= rs791286
NM_005266.6(GJA5):c.-175G>A rs35594137
NM_005266.6(GJA5):c.-61A>G rs11552588
NM_181703.4(GJA5):c.*1396G>A rs886045242
NM_181703.4(GJA5):c.*608C>T rs36005900
NM_181703.4(GJA5):c.*617_*641TGGTATGTACCTCTGGCAAATGCCC[3] rs11267274
NM_181703.4(GJA5):c.-27T>C rs2232190
NM_181703.4(GJA5):c.111G>A (p.Leu37=)
NM_181703.4(GJA5):c.117A>G (p.Thr39=)
NM_181703.4(GJA5):c.147G>A (p.Gln49=)
NM_181703.4(GJA5):c.327G>A (p.Arg109=)
NM_181703.4(GJA5):c.348G>A (p.Glu116=)
NM_181703.4(GJA5):c.369C>T (p.Tyr123=) rs2232191
NM_181703.4(GJA5):c.513G>A (p.Gln171=) rs1571066735
NM_181703.4(GJA5):c.544C>T (p.Leu182=)
NM_181703.4(GJA5):c.864C>T (p.Ala288=)
NM_181703.4(GJA5):c.903A>G (p.Val301=)
NM_181703.4(GJA5):c.995G>A (p.Arg332His) rs116551187

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.