ClinVar Miner

List of variants in gene MESP2 reported as benign for bone disorder

Included ClinVar conditions (1350):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 18
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001039958.2(MESP2):c.*431C>T rs11073889 0.62378
NM_001039958.2(MESP2):c.573G>A (p.Gly191=) rs113097169 0.13255
NM_001039958.2(MESP2):c.412G>A (p.Val138Met) rs28462216 0.06491
NM_001039958.2(MESP2):c.558G>A (p.Gln186=) rs28546919 0.05106
NM_001039958.2(MESP2):c.531G>A (p.Ala177=) rs75049807 0.04869
NM_001039958.2(MESP2):c.671C>T (p.Ser224Phe) rs71647807 0.02596
NM_001039958.2(MESP2):c.717G>C (p.Gly239=) rs181559095 0.00329
NM_001039958.2(MESP2):c.67G>A (p.Gly23Ser) rs548112443 0.00101
NM_001039958.2(MESP2):c.185G>A (p.Arg62Gln) rs566641514 0.00041
NM_001039958.2(MESP2):c.408G>T (p.Ser136=) rs760746152 0.00011
NM_001039958.1(MESP2):c.535GGGCAGGGGCAA[2_4] rs397507446
NM_001039958.2(MESP2):c.197C>G (p.Ala66Gly) rs71647809
NM_001039958.2(MESP2):c.498C>A (p.Pro166=) rs200336355
NM_001039958.2(MESP2):c.498C>G (p.Pro166=) rs200336355
NM_001039958.2(MESP2):c.534GGGGCAGGGGCAAGGGCAGGGGCA[1] (p.180QG[9]) rs200021459
NM_001039958.2(MESP2):c.549_584del (p.180_181QG[7]) rs749710849
NM_001039958.2(MESP2):c.552GGGGCA[1] (p.180QG[11]) rs56192595
NM_001039958.2(MESP2):c.670T>C (p.Ser224Pro) rs118204033

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.