ClinVar Miner

List of variants studied for adrenal gland disease

Included ClinVar conditions (124):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 6502
Download table as spreadsheet
HGVS dbSNP
-4C-T, PRO105LEU, AND PRO453SER
ABCD1, 1-BP DEL, 2204G
ABCD1, 2-BP DEL, 2177TA
ABCD1, IVS1DS, G-A, -1
ARMC5, 1-BP DEL, G
CHEK2, 1-BP DEL, 1100C
CHEK2, 1-BP DEL, 1422T
CLCN2, ARG172GLN
CLCN2, LYS362DEL
CLCN2, MET22LYS
CLCN2, SER865ARG
CLCN2, TYR26ASN
CYP11A1, 1-BP DEL, 835A
CYP11A1, 1-BP INS, IVS3, T
CYP11A1, 6-BP INS
CYP11B1, 2-BP INS
CYP11B1, 954G-A
CYP11B1, CYP11B1/CYP11B2 ANTI-LEPORE-LIKE CHIMERA
CYP11B1, CYP11B1/CYP11B2 CHIMERA
CYP11B1, IVS3DS, G-T, +16
CYP11B1, IVS8, A-G, +4
CYP11B2, 5-BP DEL
CYP11B2, 6-BP DUP, CODON 143
CYP21A2, 1-BP INS, 1003A
CYP21A2, 1-BP INS, 82C
CYP21A2, 30-KB DEL
CYP21A2, ARG339HIS AND PRO453SER
CYP21A2, ARG408CYS
CYP21A2, ARG426HIS
CYP21A2, GENE CONVERSION CYP21 FROM CYP21P
CYP21A2, GLU380ASP
CYP21A2, GLY424SER
CYP21A2, IVS2, A-G, -2
CYP21A2, IVS7DS, G-C, +1
GMPPA, TRP214TER
GRCh37/hg19 Xq28(chrX:152980470-153032459)
HSD11B1, LYS187ASN
HSD3B2, 1-BP DEL, 867G
HSD3B2, 1-BP INS
MC2R, 1-BP INS, 1347A
MEN1, 1-BP DEL, 7773C
MEN1, 1-BP INS, 1657C
MEN1, 12-BP DEL, NT1466
MEN1, 3-BP DEL, 2641GAA
MEN1, 4-BP DEL, 4480CAGT
MEN1, 6-BP INS, NT879
MRAP, IVS3, G DEL, +1
MRAP, IVS3, G-A, +1
MRAP, IVS3, G-C, +1
MRAP, IVS3, G-T, +1
MRAP, IVS3, T INS, +3
NC_000001.10:g.(?_160786670)_(161332233_?)dup
NC_000001.10:g.(?_161284186)_(161332233_?)dup
NC_000001.10:g.(?_161284190)_(161332229_?)del
NC_000001.10:g.(?_161284190)_(161332229_?)dup
NC_000001.10:g.(?_161293394)_(161332233_?)dup
NC_000001.10:g.(?_161293398)_(161332229_?)dup
NC_000001.10:g.(?_161293404)_(161293460_?)del
NC_000001.10:g.(?_161310374)_(161332233_?)dup
NC_000001.10:g.(?_161310378)_(161332229_?)dup
NC_000001.10:g.(?_161310384)_(161310445_?)dup
NC_000001.10:g.(?_161326457)_(161326640_?)del
NC_000001.10:g.(?_161326457)_(161332233_?)del
NC_000001.10:g.(?_161326457)_(161332233_?)dup
NC_000001.10:g.(?_161326461)_(161332229_?)dup
NC_000001.10:g.(?_161326467)_(161326630_?)del
NC_000001.10:g.(?_17345217)_(17345453_?)del
NC_000001.10:g.(?_17345217)_(17380665_?)dup
NC_000001.10:g.(?_17345366)_(17345463_?)del
NC_000001.10:g.(?_17345366)_(17380524_?)del
NC_000001.10:g.(?_17345366)_(17380524_?)dup
NC_000001.10:g.(?_17345370)_(17355237_?)dup
NC_000001.10:g.(?_17345370)_(17359646_?)del
NC_000001.10:g.(?_17345370)_(17371389_?)del
NC_000001.10:g.(?_17345376)_(17397986_?)del
NC_000001.10:g.(?_17359545)_(17359650_?)del
NC_000001.10:g.(?_17359545)_(17380524_?)dup
NC_000001.10:g.(?_17359549)_(17359646_?)del
NC_000001.10:g.(?_17371246)_(17371393_?)del
NC_000001.10:g.(?_17371246)_(17380524_?)dup
NC_000001.10:g.(?_17371256)_(17371383_?)del
NC_000001.10:g.(?_17380433)_(17380524_?)del
NC_000001.10:g.(?_17380437)_(17380520_?)del
NC_000001.10:g.17375249_17390927del15679
NC_000001.10:g.17376556_17396932del20377
NC_000001.9:g.157610062_160185096del2575035
NC_000002.11:g.(?_96919536)_(96931129_?)del
NC_000002.11:g.(?_96919536)_(96931129_?)dup
NC_000002.11:g.178562111_178577218dup
NC_000003.11:g.(?_10094061)_(10191659_?)del
NC_000003.11:g.(?_10094061)_(10191659_?)dup
NC_000003.11:g.(?_10106403)_(10191659_?)dup
NC_000003.11:g.(?_10183319)_(10183871_?)del
NC_000003.11:g.(?_10183522)_(10183881_?)del
NC_000003.11:g.(?_10183522)_(10191659_?)del
NC_000003.11:g.(?_10183526)_(10191655_?)dup
NC_000003.11:g.(?_10188188)_(10188330_?)del
NC_000003.11:g.(?_10188188)_(10188330_?)dup
NC_000003.11:g.(?_10188188)_(10191659_?)del
NC_000003.11:g.(?_10188198)_(10188320_?)del
NC_000003.11:g.(?_10191461)_(10191659_?)del
NC_000003.11:g.(?_10191461)_(10191659_?)dup
NC_000003.11:g.(?_10191471)_(10195354_?)dup
NC_000011.9:g.(?_111957622)_(111965704_?)del
NC_000011.9:g.(?_111957622)_(111965704_?)dup
NC_000011.9:g.(?_111959581)_(111965704_?)del
NC_000011.9:g.(?_111965519)_(111965704_?)del
NC_000011.9:g.(?_111965523)_(111965700_?)del
NC_000011.9:g.(?_61205087)_(61213553_?)dup
NC_000011.9:g.(?_64570986)_(64572288_?)del
NC_000011.9:g.(?_64570986)_(64577604_?)del
NC_000011.9:g.(?_64571796)_(64578188_?)del
NC_000011.9:g.(?_64577131)_(64577587_?)del
NC_000012.12:g.53306793_53321761del
NC_000014.8:g.(?_65560420)_(65569063_?)del
NC_000014.8:g.(?_65568254)_(65569067_?)del
NC_000014.8:g.(?_65568264)_(65569262_?)del
NC_000016.10:g.31464785_31464789GGCGC[3]
NC_000017.10:g.(?_66508520)_(66526600_?)del
NC_000017.10:g.(?_66511525)_(66525142_?)del
NC_000017.10:g.(?_66511535)_(66526596_?)del
NC_000017.10:g.(?_7571720)_(7573008_?)del
NC_000017.10:g.(?_7572917)_(7579922_?)del
NC_000017.10:g.(?_7572917)_(7579922_?)dup
NC_000017.10:g.(?_7572917)_(7591611_?)del
NC_000017.10:g.(?_7572917)_(8285638_?)del
NC_000017.10:g.(?_7572921)_(7574039_?)del
NC_000017.10:g.(?_7572921)_(7579918_?)del
NC_000017.10:g.(?_7572921)_(7579918_?)dup
NC_000017.10:g.(?_7576843)_(7591611_?)dup
NC_000017.10:g.(?_7576847)_(7591611_?)dup
NC_000017.10:g.(?_7578171)_(7579918_?)dup
NC_000017.10:g.(?_7589449)_(7590046_?)dup
NC_000017.10:g.(?_7590924)_(7591611_?)del
NC_000017.11:g.(?_68512379)_(68512548_?)del
NC_000017.11:g.(?_68512379)_(68533431_?)del
NC_000017.11:g.(?_68515394)_(68515576_?)del
NC_000017.11:g.(?_68528870)_(68530449_?)del
NC_000021.8:g.(?_45629566)_(46330717_?)dup
NC_000021.8:g.(?_45705870)_(45717630_?)del
NC_000021.8:g.(?_45713652)_(45717630_?)dup
NC_000023.10:g.(28450110_28771544)_(31838019_32614088)del
NC_000023.10:g.(29155333_29973170)_(30327505_30577779)del
NC_000023.10:g.(29976475_30082636)_(31196736_31462831)del
NC_000023.10:g.(?_152954020)_(154096327_?)del
NC_000023.10:g.(?_152959340)_(153009209_?)del
NC_000023.10:g.(?_153005536)_(153005701_?)del
NC_000023.10:g.(?_153008421)_(153009209_?)del
NC_000023.10:g.(?_153008431)_(153009199_?)del
NC_000023.10:g.(?_153008655)_(153009209_?)del
NC_000023.10:g.(?_30322696)_(30327480_?)del
NG_012340.1:g.21597_29501del
NM_000033.3(ABCD1):c.*1035C>T rs6643782
NM_000033.3(ABCD1):c.874_876delGAG (p.Glu292del) rs387906496
NM_000033.4(ABCD1):c.*10C>T rs1057515814
NM_000033.4(ABCD1):c.*123C>T rs186542134
NM_000033.4(ABCD1):c.*196C>G rs367591611
NM_000033.4(ABCD1):c.*208G>C rs193922092
NM_000033.4(ABCD1):c.*259A>G rs374092960
NM_000033.4(ABCD1):c.*412T>C rs1057515815
NM_000033.4(ABCD1):c.*473C>T rs782343473
NM_000033.4(ABCD1):c.*481G>T rs199942817
NM_000033.4(ABCD1):c.*530G>A rs67211405
NM_000033.4(ABCD1):c.*548_*554GAGAGGG[1] rs1057515816
NM_000033.4(ABCD1):c.*564G>A rs782819878
NM_000033.4(ABCD1):c.*608G>A rs73640819
NM_000033.4(ABCD1):c.*668C>T rs187420166
NM_000033.4(ABCD1):c.*795C>T rs1057515817
NM_000033.4(ABCD1):c.*870G>T rs72616452
NM_000033.4(ABCD1):c.*877C>T rs11803
NM_000033.4(ABCD1):c.*894G>A rs1055847
NM_000033.4(ABCD1):c.*8G>C rs2229539
NM_000033.4(ABCD1):c.*903G>A rs78155328
NM_000033.4(ABCD1):c.*985C>G rs782309410
NM_000033.4(ABCD1):c.-10C>T rs782754717
NM_000033.4(ABCD1):c.-16_10del (p.Met1fs) rs387906497
NM_000033.4(ABCD1):c.-202C>G rs781978041
NM_000033.4(ABCD1):c.-342G>A rs912340339
NM_000033.4(ABCD1):c.-59C>T rs4148030
NM_000033.4(ABCD1):c.1047C>A (p.Val349=) rs185931852
NM_000033.4(ABCD1):c.1096A>T (p.Lys366Ter) rs1569541000
NM_000033.4(ABCD1):c.1101_1108dup (p.Leu370fs)
NM_000033.4(ABCD1):c.1126G>T (p.Glu376Ter)
NM_000033.4(ABCD1):c.1141C>T (p.Arg381Cys) rs781983308
NM_000033.4(ABCD1):c.1157C>G (p.Thr386Ser)
NM_000033.4(ABCD1):c.1165C>G (p.Arg389Gly) rs128624215
NM_000033.4(ABCD1):c.1165C>T (p.Arg389Cys) rs128624215
NM_000033.4(ABCD1):c.1181C>T (p.Ala394Val) rs1324874967
NM_000033.4(ABCD1):c.1183G>C (p.Ala395Pro) rs1557054176
NM_000033.4(ABCD1):c.1186G>A (p.Ala396Thr) rs1569541006
NM_000033.4(ABCD1):c.1201C>T (p.Arg401Trp) rs727503786
NM_000033.4(ABCD1):c.1202G>A (p.Arg401Gln) rs128624219
NM_000033.4(ABCD1):c.1215G>A (p.Ser405=) rs138233092
NM_000033.4(ABCD1):c.1225-7_1239del rs1569541009
NM_000033.4(ABCD1):c.1252C>T (p.Arg418Trp) rs128624220
NM_000033.4(ABCD1):c.1261G>A (p.Glu421Lys) rs1255903649
NM_000033.4(ABCD1):c.1270C>T (p.Gln424Ter) rs1557054210
NM_000033.4(ABCD1):c.1288C>T (p.Gln430Ter) rs797044726
NM_000033.4(ABCD1):c.1334C>T (p.Ala445Val) rs1432758988
NM_000033.4(ABCD1):c.1354C>T (p.Arg452Trp) rs368061976
NM_000033.4(ABCD1):c.1366dup (p.Arg456fs) rs193922093
NM_000033.4(ABCD1):c.1390C>T (p.Arg464Ter) rs128624221
NM_000033.4(ABCD1):c.1404G>A (p.Val468=) rs782072629
NM_000033.4(ABCD1):c.1415_1416del (p.Gln472fs) rs387906494
NM_000033.4(ABCD1):c.1428C>T (p.Cys476=) rs141446687
NM_000033.4(ABCD1):c.1429G>T (p.Glu477Ter) rs128624222
NM_000033.4(ABCD1):c.1448C>T (p.Thr483Met) rs1569541035
NM_000033.4(ABCD1):c.1451C>G (p.Pro484Arg) rs128624214
NM_000033.4(ABCD1):c.1452C>G (p.Pro484=) rs782546330
NM_000033.4(ABCD1):c.1454C>G (p.Ser485Ter)
NM_000033.4(ABCD1):c.1467G>A (p.Val489=) rs782516659
NM_000033.4(ABCD1):c.146_159del (p.Pro49fs) rs1569540676
NM_000033.4(ABCD1):c.1489-1G>A
NM_000033.4(ABCD1):c.1489-6del rs398123101
NM_000033.4(ABCD1):c.1523C>A (p.Pro508His) rs1569541087
NM_000033.4(ABCD1):c.1526A>G (p.Asn509Ser) rs782158792
NM_000033.4(ABCD1):c.1532G>A (p.Cys511Tyr) rs1557054745
NM_000033.4(ABCD1):c.1533C>G (p.Cys511Trp) rs782370364
NM_000033.4(ABCD1):c.1534G>A (p.Gly512Ser) rs1569541088
NM_000033.4(ABCD1):c.1544C>T (p.Ser515Phe) rs128624223
NM_000033.4(ABCD1):c.1548G>A (p.Leu516=) rs41314153
NM_000033.4(ABCD1):c.1552C>G (p.Arg518Gly) rs128624224
NM_000033.4(ABCD1):c.1552C>T (p.Arg518Trp) rs128624224
NM_000033.4(ABCD1):c.1552del (p.Arg518fs) rs387906495
NM_000033.4(ABCD1):c.1553G>A (p.Arg518Gln) rs398123102
NM_000033.4(ABCD1):c.1567C>T (p.Leu523Phe) rs1159943880
NM_000033.4(ABCD1):c.1582G>A (p.Gly528Ser) rs376472029
NM_000033.4(ABCD1):c.1592T>C (p.Leu531Pro) rs193922094
NM_000033.4(ABCD1):c.1597A>C (p.Lys533Gln) rs781862879
NM_000033.4(ABCD1):c.1599G>T (p.Lys533Asn) rs1569541092
NM_000033.4(ABCD1):c.1628C>T (p.Pro543Leu) rs1557054776
NM_000033.4(ABCD1):c.1628del (p.Pro543fs)
NM_000033.4(ABCD1):c.1634+1G>A rs1569541096
NM_000033.4(ABCD1):c.1635-2A>G rs1569541109
NM_000033.4(ABCD1):c.1637C>T (p.Pro546Leu)
NM_000033.4(ABCD1):c.1644G>A (p.Met548Ile) rs1569541112
NM_000033.4(ABCD1):c.1660dup (p.Arg554fs) rs1569541115
NM_000033.4(ABCD1):c.1679C>T (p.Pro560Leu) rs398123105
NM_000033.4(ABCD1):c.16_22delinsCT (p.Arg6fs) rs1557052133
NM_000033.4(ABCD1):c.1743_1745CGT[1] (p.Val583del) rs1557054859
NM_000033.4(ABCD1):c.1744G>A (p.Val582Ile) rs76180859
NM_000033.4(ABCD1):c.1747G>A (p.Val583Met) rs1569541120
NM_000033.4(ABCD1):c.1748T>A (p.Val583Glu) rs79383557
NM_000033.4(ABCD1):c.1763T>A (p.Ile588Asn) rs1569541122
NM_000033.4(ABCD1):c.1771C>T (p.Arg591Trp) rs398123106
NM_000033.4(ABCD1):c.1772G>A (p.Arg591Gln) rs1557054873
NM_000033.4(ABCD1):c.1780+2T>G rs1557054875
NM_000033.4(ABCD1):c.1780+4G>A rs193922095
NM_000033.4(ABCD1):c.1784G>A (p.Trp595Ter)
NM_000033.4(ABCD1):c.1810G>A (p.Val604Ile) rs151201945
NM_000033.4(ABCD1):c.1816T>C (p.Ser606Pro) rs201774661
NM_000033.4(ABCD1):c.1817C>T (p.Ser606Leu) rs128624225
NM_000033.4(ABCD1):c.1820_1823del (p.Gly607fs) rs1557055253
NM_000033.4(ABCD1):c.1825G>A (p.Glu609Lys) rs150346282
NM_000033.4(ABCD1):c.1826A>G (p.Glu609Gly) rs1557055260
NM_000033.4(ABCD1):c.1849C>T (p.Arg617Cys) rs4010613
NM_000033.4(ABCD1):c.1850G>A (p.Arg617His) rs11146842
NM_000033.4(ABCD1):c.1865+1G>A rs1569541198
NM_000033.4(ABCD1):c.1866-10G>A rs398123108
NM_000033.4(ABCD1):c.1866-1G>A rs1557055311
NM_000033.4(ABCD1):c.1876G>A (p.Ala626Thr) rs1557055316
NM_000033.4(ABCD1):c.1893C>T (p.Cys631=) rs1557055319
NM_000033.4(ABCD1):c.1900G>A (p.Ala634Thr) rs782041940
NM_000033.4(ABCD1):c.1902C>T (p.Ala634=) rs141110958
NM_000033.4(ABCD1):c.1914C>T (p.Asp638=) rs199723613
NM_000033.4(ABCD1):c.1919A>G (p.Glu640Gly)
NM_000033.4(ABCD1):c.1973C>T (p.Thr658Ile) rs1557055337
NM_000033.4(ABCD1):c.1978C>T (p.Arg660Trp) rs1569541203
NM_000033.4(ABCD1):c.1979G>A (p.Arg660Gln) rs1557055340
NM_000033.4(ABCD1):c.1979G>T (p.Arg660Leu) rs1557055340
NM_000033.4(ABCD1):c.1998C>A (p.Tyr666Ter) rs1170974058
NM_000033.4(ABCD1):c.1998_1999insGC (p.His667fs) rs1557055392
NM_000033.4(ABCD1):c.2003C>T (p.Thr668Ile) rs1557055398
NM_000033.4(ABCD1):c.2010dup (p.Leu671fs) rs1569541207
NM_000033.4(ABCD1):c.2019C>T (p.Phe673=) rs76637913
NM_000033.4(ABCD1):c.2035T>A (p.Trp679Arg) rs1557055405
NM_000033.4(ABCD1):c.2043C>T (p.Phe681=) rs782327280
NM_000033.4(ABCD1):c.2044G>C (p.Glu682Gln) rs781793261
NM_000033.4(ABCD1):c.208G>A (p.Val70Ile)
NM_000033.4(ABCD1):c.2112G>A (p.Ala704=) rs372309740
NM_000033.4(ABCD1):c.2131C>T (p.Arg711Trp)
NM_000033.4(ABCD1):c.2134C>T (p.Arg712Cys) rs1557055441
NM_000033.4(ABCD1):c.2188C>T (p.Pro730Ser)
NM_000033.4(ABCD1):c.2190G>A (p.Pro730=) rs193922096
NM_000033.4(ABCD1):c.2201C>T (p.Pro734Leu) rs368462762
NM_000033.4(ABCD1):c.229_237del (p.Trp77_Leu79del) rs1569540680
NM_000033.4(ABCD1):c.234_242dup (p.Arg80_Leu82dup)
NM_000033.4(ABCD1):c.238C>T (p.Arg80Trp) rs868977355
NM_000033.4(ABCD1):c.249C>T (p.Phe83=) rs782628755
NM_000033.4(ABCD1):c.253dup (p.Arg85fs) rs713993050
NM_000033.4(ABCD1):c.258C>T (p.Val86=) rs200660869
NM_000033.4(ABCD1):c.293C>T (p.Ser98Leu) rs1557052294
NM_000033.4(ABCD1):c.298G>C (p.Ala100Pro)
NM_000033.4(ABCD1):c.311G>A (p.Arg104His) rs1557052302
NM_000033.4(ABCD1):c.320T>C (p.Leu107Pro) rs1569540688
NM_000033.4(ABCD1):c.346G>C (p.Gly116Arg)
NM_000033.4(ABCD1):c.36del (p.Asn13fs)
NM_000033.4(ABCD1):c.386C>A (p.Ala129Asp)
NM_000033.4(ABCD1):c.38A>C (p.Asn13Thr) rs183021839
NM_000033.4(ABCD1):c.392G>T (p.Gly131Val) rs367799134
NM_000033.4(ABCD1):c.408del (p.Gln136fs)
NM_000033.4(ABCD1):c.412_414CTC[1] (p.Leu139del) rs1557052351
NM_000033.4(ABCD1):c.41C>G (p.Thr14Arg) rs782161942
NM_000033.4(ABCD1):c.421G>A (p.Ala141Thr) rs193922097
NM_000033.4(ABCD1):c.433A>G (p.Thr145Ala) rs1292006620
NM_000033.4(ABCD1):c.442A>T (p.Asn148Tyr) rs1557052362
NM_000033.4(ABCD1):c.443A>G (p.Asn148Ser) rs128624216
NM_000033.4(ABCD1):c.452T>C (p.Ile151Thr) rs1569540692
NM_000033.4(ABCD1):c.454C>T (p.Arg152Cys) rs1569540693
NM_000033.4(ABCD1):c.471A>G (p.Gln157=) rs151148684
NM_000033.4(ABCD1):c.487C>T (p.Arg163Cys) rs1569540695
NM_000033.4(ABCD1):c.488G>A (p.Arg163His) rs1057517954
NM_000033.4(ABCD1):c.508G>A (p.Ala170Thr)
NM_000033.4(ABCD1):c.50G>A (p.Arg17His)
NM_000033.4(ABCD1):c.515G>A (p.Arg172His)
NM_000033.4(ABCD1):c.520T>G (p.Tyr174Asp) rs128624217
NM_000033.4(ABCD1):c.521A>G (p.Tyr174Cys) rs1557052390
NM_000033.4(ABCD1):c.537_544dup (p.Arg182fs) rs1557052397
NM_000033.4(ABCD1):c.544C>G (p.Arg182Gly)
NM_000033.4(ABCD1):c.565C>T (p.Arg189Trp) rs1131691916
NM_000033.4(ABCD1):c.582C>G (p.Asp194Glu) rs1569540703
NM_000033.4(ABCD1):c.593C>T (p.Thr198Met) rs1569540704
NM_000033.4(ABCD1):c.595G>A (p.Glu199Lys) rs1569540705
NM_000033.4(ABCD1):c.638C>A (p.Ser213Tyr)
NM_000033.4(ABCD1):c.647C>T (p.Thr216Ile)
NM_000033.4(ABCD1):c.651G>C (p.Lys217Asn) rs864309520
NM_000033.4(ABCD1):c.653C>T (p.Pro218Leu) rs1569540710
NM_000033.4(ABCD1):c.673A>G (p.Thr225Ala)
NM_000033.4(ABCD1):c.696G>T (p.Ala232=) rs147595334
NM_000033.4(ABCD1):c.701G>T (p.Arg234Leu) rs782723557
NM_000033.4(ABCD1):c.707G>A (p.Arg236His) rs201455322
NM_000033.4(ABCD1):c.70del (p.Leu24fs) rs1557052171
NM_000033.4(ABCD1):c.723del (p.Trp242fs)
NM_000033.4(ABCD1):c.739G>A (p.Ala247Thr) rs782487174
NM_000033.4(ABCD1):c.756C>A (p.Phe252Leu)
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000033.4(ABCD1):c.761C>T (p.Thr254Met) rs1131691743
NM_000033.4(ABCD1):c.766_769dup (p.Val257fs) rs1557052530
NM_000033.4(ABCD1):c.773T>C (p.Leu258Pro) rs1569540731
NM_000033.4(ABCD1):c.794T>C (p.Phe265Ser)
NM_000033.4(ABCD1):c.796G>A (p.Gly266Arg) rs128624218
NM_000033.4(ABCD1):c.80A>C (p.Tyr27Ser) rs1569540665
NM_000033.4(ABCD1):c.823C>T (p.Arg275Trp) rs782083931
NM_000033.4(ABCD1):c.829G>A (p.Gly277Arg)
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000033.4(ABCD1):c.871G>A (p.Glu291Lys) rs128624213
NM_000033.4(ABCD1):c.876G>C (p.Glu292Asp) rs1557052573
NM_000033.4(ABCD1):c.880G>A (p.Ala294Thr) rs1131691954
NM_000033.4(ABCD1):c.887A>G (p.Tyr296Cys) rs797044610
NM_000033.4(ABCD1):c.892G>A (p.Gly298Ser)
NM_000033.4(ABCD1):c.901-10C>T rs2269365
NM_000033.4(ABCD1):c.919C>T (p.Gln307Ter)
NM_000033.4(ABCD1):c.988_1005del (p.Leu330_Met335del)
NM_000076.2(CDKN1C):c.-266G>A rs147317732
NM_000076.2(CDKN1C):c.353C>T (p.Pro118Leu) rs771731330
NM_000076.2(CDKN1C):c.815T>G (p.Ile272Ser) rs515726203
NM_000076.2(CDKN1C):c.820G>A (p.Asp274Asn) rs387907225
NM_000076.2(CDKN1C):c.826T>G (p.Phe276Val) rs387907223
NM_000076.2(CDKN1C):c.827T>C (p.Phe276Ser) rs387907224
NM_000076.2(CDKN1C):c.832A>G (p.Lys278Glu) rs387907226
NM_000076.2(CDKN1C):c.836G>C (p.Arg279Pro) rs318240750
NM_000076.2(CDKN1C):c.836G>T (p.Arg279Leu) rs318240750
NM_000076.2(CDKN1C):c.842G>T (p.Arg281Ile) rs886037912
NM_000076.2(CDKN1C):c.848C>T (p.Ala283Val) rs776541692
NM_000102.3(CYP17A1):c.-166G>C rs58519757
NM_000102.4(CYP17A1):c.*130C>T rs886046665
NM_000102.4(CYP17A1):c.*165dup rs45455494
NM_000102.4(CYP17A1):c.*65C>A rs537220295
NM_000102.4(CYP17A1):c.*67C>A rs886046666
NM_000102.4(CYP17A1):c.-14G>A rs17115125
NM_000102.4(CYP17A1):c.-15C>T rs140012815
NM_000102.4(CYP17A1):c.-30dup rs886046667
NM_000102.4(CYP17A1):c.-34T>C rs743572
NM_000102.4(CYP17A1):c.1040G>A (p.Arg347His) rs61754278
NM_000102.4(CYP17A1):c.1162A>T (p.Lys388Ter) rs1060499582
NM_000102.4(CYP17A1):c.1241C>T (p.Pro414Leu) rs1554879846
NM_000102.4(CYP17A1):c.1269C>G (p.Thr423=) rs554217514
NM_000102.4(CYP17A1):c.1363A>G (p.Ile455Val) rs138630127
NM_000102.4(CYP17A1):c.138C>T (p.His46=) rs6162
NM_000102.4(CYP17A1):c.1435_1438dup (p.Pro480fs) rs556794126
NM_000102.4(CYP17A1):c.1459_1467del (p.Asp487_Phe489del) rs756135168
NM_000102.4(CYP17A1):c.195G>T (p.Ser65=) rs6163
NM_000102.4(CYP17A1):c.286C>T (p.Arg96Trp) rs104894138
NM_000102.4(CYP17A1):c.297+2T>C rs764723654
NM_000102.4(CYP17A1):c.298-11G>C rs188885755
NM_000102.4(CYP17A1):c.316T>C (p.Ser106Pro) rs104894135
NM_000102.4(CYP17A1):c.628A>G (p.Ser210Gly) rs142435666
NM_000102.4(CYP17A1):c.62G>A (p.Arg21Lys) rs61754263
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000102.4(CYP17A1):c.847G>C (p.Asp283His) rs746480412
NM_000163.5(GHR):c.184G>A (p.Glu62Lys) rs121909361
NM_000163.5(GHR):c.484G>A (p.Val162Ile) rs6413484
NM_000163.5(GHR):c.497G>A (p.Gly166Glu) rs761856079
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000163.5(GHR):c.559T>C (p.Trp187Arg) rs886037910
NM_000163.5(GHR):c.686G>A (p.Arg229His) rs6177
NM_000163.5(GHR):c.726G>C (p.Glu242Asp) rs45588036
NM_000163.5(GHR):c.876-1G>C rs730880308
NM_000176.3(NR3C1):c.*1176C>T rs61753504
NM_000176.3(NR3C1):c.*1628A>G rs372713535
NM_000176.3(NR3C1):c.*2042C>T rs13306586
NM_000176.3(NR3C1):c.*2056dup rs886060046
NM_000176.3(NR3C1):c.*2188A>G rs6193
NM_000176.3(NR3C1):c.*2567A>G rs886060044
NM_000176.3(NR3C1):c.*290A>C rs72542758
NM_000176.3(NR3C1):c.*3003A>G rs61753509
NM_000176.3(NR3C1):c.*3076C>T rs72542769
NM_000176.3(NR3C1):c.*3153C>T rs2301177
NM_000176.3(NR3C1):c.*3298G>T rs6191
NM_000176.3(NR3C1):c.*3300G>T rs72542770
NM_000176.3(NR3C1):c.*3550G>A rs10482714
NM_000176.3(NR3C1):c.*3833A>G rs6198
NM_000176.3(NR3C1):c.*3937A>T rs4518436
NM_000176.3(NR3C1):c.*937C>A rs72542760
NM_000176.3(NR3C1):c.1088A>G (p.Asn363Ser) rs56149945
NM_000176.3(NR3C1):c.1242A>G (p.Thr414=) rs67902340
NM_000176.3(NR3C1):c.1430G>A (p.Arg477His) rs104893913
NM_000176.3(NR3C1):c.1676T>A (p.Ile559Asn) rs104893909
NM_000176.3(NR3C1):c.1764C>T (p.His588=) rs6194
NM_000176.3(NR3C1):c.1891_1892+2del rs587776832
NM_000176.3(NR3C1):c.1922A>T (p.Asp641Val) rs104893908
NM_000176.3(NR3C1):c.2034C>T (p.Asp678=) rs258751
NM_000176.3(NR3C1):c.2035G>A (p.Gly679Ser) rs104893914
NM_000176.3(NR3C1):c.2182-9C>G rs72542757
NM_000176.3(NR3C1):c.2209T>C (p.Phe737Leu) rs121909727
NM_000176.3(NR3C1):c.2241T>G (p.Ile747Met) rs104893910
NM_000176.3(NR3C1):c.2250C>T (p.Pro750=) rs67300719
NM_000176.3(NR3C1):c.2298T>C (p.Asn766=) rs6196
NM_000176.3(NR3C1):c.2318T>C (p.Leu773Pro) rs104893912
NM_000176.3(NR3C1):c.631A>G (p.Ser211Gly) rs886060061
NM_000176.3(NR3C1):c.66G>A (p.Glu22=) rs6189
NM_000176.3(NR3C1):c.68G>A (p.Arg23Lys) rs6190
NM_000176.3(NR3C1):c.753G>A (p.Pro251=) rs375379753
NM_000176.3(NR3C1):c.879G>A (p.Lys293=) rs10482622
NM_000176.3(NR3C1):c.897A>G (p.Thr299=) rs13306588
NM_000196.3(HSD11B2):c.1010_1012delGCT (p.Arg337_Tyr338delinsHis) rs397509434
NM_000196.4(HSD11B2):c.1009C>T (p.Arg337Cys) rs121917781
NM_000196.4(HSD11B2):c.1012T>C (p.Tyr338His) rs387907117
NM_000196.4(HSD11B2):c.220_222delinsGG (p.Arg74fs) rs1567529174
NM_000196.4(HSD11B2):c.272A>C (p.Asp91Ala) rs1356598056
NM_000196.4(HSD11B2):c.343_348del (p.Glu115_Leu116del) rs794726669
NM_000196.4(HSD11B2):c.588G>A (p.Ala196=) rs5480
NM_000196.4(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000196.4(HSD11B2):c.623G>A (p.Arg208His) rs28934592
NM_000196.4(HSD11B2):c.637C>T (p.Arg213Cys) rs28934591
NM_000196.4(HSD11B2):c.664+14C>T rs376023420
NM_000196.4(HSD11B2):c.667G>A (p.Asp223Asn) rs121917833
NM_000196.4(HSD11B2):c.77_78del (p.Arg25_Ser26insTer) rs794726684
NM_000196.4(HSD11B2):c.835C>T (p.Arg279Cys) rs28934594
NM_000196.4(HSD11B2):c.895_897del (p.Tyr299del) rs794726670
NM_000196.4(HSD11B2):c.956_964dup (p.Val322_Asp323insAlaProVal) rs1567530910
NM_000198.3(HSD3B2):c.-145G>A rs35226381
NM_000198.4(HSD3B2):c.*121C>A rs886045198
NM_000198.4(HSD3B2):c.*177C>T rs886045199
NM_000198.4(HSD3B2):c.*202A>G rs9282704
NM_000198.4(HSD3B2):c.*276C>T rs1819698
NM_000198.4(HSD3B2):c.*321C>G rs1361530
NM_000198.4(HSD3B2):c.*397T>A rs753468192
NM_000198.4(HSD3B2):c.*46C>T rs371081728
NM_000198.4(HSD3B2):c.*96C>G rs9282703
NM_000198.4(HSD3B2):c.1022C>T (p.Pro341Leu) rs121964897
NM_000198.4(HSD3B2):c.1056C>G (p.Thr352=) rs781770416
NM_000198.4(HSD3B2):c.1064G>A (p.Trp355Ter) rs767128094
NM_000198.4(HSD3B2):c.1084C>T (p.Arg362Trp) rs199919404
NM_000198.4(HSD3B2):c.1119A>C (p.Ter373Cys) rs80358218
NM_000198.4(HSD3B2):c.13T>A (p.Cys5Ser) rs376207606
NM_000198.4(HSD3B2):c.222C>T (p.Asp74=) rs150892928
NM_000198.4(HSD3B2):c.29C>A (p.Ala10Glu) rs28934880
NM_000198.4(HSD3B2):c.308-8G>A rs371712928
NM_000198.4(HSD3B2):c.333T>G (p.Cys111Trp) rs886045196
NM_000198.4(HSD3B2):c.423C>T (p.His141=) rs751470493
NM_000198.4(HSD3B2):c.424G>A (p.Glu142Lys) rs80358219
NM_000198.4(HSD3B2):c.501G>A (p.Ala167=) rs6207
NM_000198.4(HSD3B2):c.510G>C (p.Gly170=) rs886045197
NM_000198.4(HSD3B2):c.512G>A (p.Trp171Ter) rs80358216
NM_000198.4(HSD3B2):c.621C>T (p.Asn207=) rs143758913
NM_000198.4(HSD3B2):c.625G>A (p.Gly209Arg) rs587669956
NM_000198.4(HSD3B2):c.664C>A (p.Pro222Thr) rs80358220
NM_000198.4(HSD3B2):c.707T>C (p.Leu236Ser) rs35887327
NM_000198.4(HSD3B2):c.742_743delinsAA (p.Val248Asn) rs121964896
NM_000198.4(HSD3B2):c.750T>C (p.Gly250=) rs755461071
NM_000198.4(HSD3B2):c.776C>T (p.Thr259Met) rs80358221
NM_000198.4(HSD3B2):c.777G>A (p.Thr259=) rs33926546
NM_000198.4(HSD3B2):c.789C>G (p.Ser263Arg) rs771688849
NM_000244.3(MEN1):c.-20G>A rs386134244
NM_000244.3(MEN1):c.-22C>A rs374749001
NM_000244.3(MEN1):c.-2C>T rs653534
NM_000244.3(MEN1):c.1003C>T (p.Arg335Cys) rs1565644005
NM_000244.3(MEN1):c.1004G>A (p.Arg335His) rs373135175
NM_000244.3(MEN1):c.1004G>C (p.Arg335Pro) rs373135175
NM_000244.3(MEN1):c.1004G>T (p.Arg335Leu) rs373135175
NM_000244.3(MEN1):c.1008C>T (p.Asn336=) rs370176253
NM_000244.3(MEN1):c.100C>A (p.Leu34Met) rs771554497
NM_000244.3(MEN1):c.100C>T (p.Leu34=) rs771554497
NM_000244.3(MEN1):c.1014T>C (p.Asn338=) rs763133775
NM_000244.3(MEN1):c.1018C>A (p.Arg340=) rs371364206
NM_000244.3(MEN1):c.1018C>T (p.Arg340Trp) rs371364206
NM_000244.3(MEN1):c.1019G>A (p.Arg340Gln) rs764998893
NM_000244.3(MEN1):c.1024G>C (p.Ala342Pro) rs2071312
NM_000244.3(MEN1):c.1027C>G (p.Leu343Val) rs759337318
NM_000244.3(MEN1):c.1028dup (p.Gln344fs) rs386134245
NM_000244.3(MEN1):c.1035C>A (p.Ala345=) rs1060503796
NM_000244.3(MEN1):c.1037G>A (p.Trp346Ter) rs1114167482
NM_000244.3(MEN1):c.1039G>C (p.Ala347Pro) rs776561706
NM_000244.3(MEN1):c.1040C>T (p.Ala347Val) rs377715802
NM_000244.3(MEN1):c.1041G>A (p.Ala347=) rs878855184
NM_000244.3(MEN1):c.1044C>G (p.Asp348Glu) rs878855185
NM_000244.3(MEN1):c.1046C>T (p.Thr349Met) rs1259681826
NM_000244.3(MEN1):c.1047G>A (p.Thr349=) rs760183888
NM_000244.3(MEN1):c.1055T>A (p.Val352Asp)
NM_000244.3(MEN1):c.1064+1G>A rs1114167489
NM_000244.3(MEN1):c.1064+2T>C rs1555164946
NM_000244.3(MEN1):c.1064+9C>A rs200517349
NM_000244.3(MEN1):c.1064+9C>G rs200517349
NM_000244.3(MEN1):c.1064+9C>T rs200517349
NM_000244.3(MEN1):c.1065-2A>G
NM_000244.3(MEN1):c.1065-2A>T rs1565642765
NM_000244.3(MEN1):c.1073A>C (p.Tyr358Ser)
NM_000244.3(MEN1):c.1075T>C (p.Cys359Arg) rs371503251
NM_000244.3(MEN1):c.1076G>A (p.Cys359Tyr) rs904261642
NM_000244.3(MEN1):c.1077C>A (p.Cys359Ter) rs104894265
NM_000244.3(MEN1):c.1078C>A (p.Arg360=) rs863224807
NM_000244.3(MEN1):c.1078C>T (p.Arg360Trp) rs863224807
NM_000244.3(MEN1):c.1078del (p.Arg360fs) rs386134246
NM_000244.3(MEN1):c.1079G>A (p.Arg360Gln) rs1114167474
NM_000244.3(MEN1):c.1084G>A (p.Asp362Asn)
NM_000244.3(MEN1):c.1086C>T (p.Asp362=) rs371964966
NM_000244.3(MEN1):c.1087_1089GAG[1] (p.Glu364del) rs1060499971
NM_000244.3(MEN1):c.1089G>A (p.Glu363=) rs776834299
NM_000244.3(MEN1):c.108_122dup (p.Leu37_Leu41dup) rs1555166695
NM_000244.3(MEN1):c.1095C>T (p.Ile365=) rs147331514
NM_000244.3(MEN1):c.1098C>T (p.Tyr366=) rs1168237114
NM_000244.3(MEN1):c.1102_1104del (p.Glu368del) rs869025185
NM_000244.3(MEN1):c.1107C>A (p.Phe369Leu) rs863224808
NM_000244.3(MEN1):c.1108T>C (p.Phe370Leu)
NM_000244.3(MEN1):c.1113A>T (p.Glu371Asp) rs149383809
NM_000244.3(MEN1):c.1114G>A (p.Val372Ile) rs758404089
NM_000244.3(MEN1):c.1118C>A (p.Ala373Asp) rs1555164707
NM_000244.3(MEN1):c.1132C>T (p.Pro378Ser)
NM_000244.3(MEN1):c.1138C>G (p.Leu380Val) rs1211957325
NM_000244.3(MEN1):c.113C>T (p.Ser38Phe) rs794728616
NM_000244.3(MEN1):c.1145A>G (p.Lys382Arg) rs766075737
NM_000244.3(MEN1):c.1146G>A (p.Lys382=) rs1555164674
NM_000244.3(MEN1):c.114C>G (p.Ser38=) rs1252317486
NM_000244.3(MEN1):c.1154C>G (p.Ala385Gly) rs1565642307
NM_000244.3(MEN1):c.115T>C (p.Leu39=) rs863224438
NM_000244.3(MEN1):c.1164G>A (p.Leu388=) rs1555164667
NM_000244.3(MEN1):c.1169C>T (p.Ala390Val) rs1298484645
NM_000244.3(MEN1):c.1170G>A (p.Ala390=) rs201091135
NM_000244.3(MEN1):c.1172G>A (p.Gly391Asp) rs761360623
NM_000244.3(MEN1):c.1173C>T (p.Gly391=) rs794728653
NM_000244.3(MEN1):c.1174G>A (p.Glu392Lys) rs773978650
NM_000244.3(MEN1):c.1180C>T (p.Arg394Trp) rs566593066
NM_000244.3(MEN1):c.1181G>A (p.Arg394Gln) rs775267651
NM_000244.3(MEN1):c.1181G>C (p.Arg394Pro)
NM_000244.3(MEN1):c.1182G>C (p.Arg394=) rs1194388602
NM_000244.3(MEN1):c.1184C>G (p.Pro395Arg) rs761102084
NM_000244.3(MEN1):c.1184C>T (p.Pro395Leu) rs761102084
NM_000244.3(MEN1):c.1185G>A (p.Pro395=) rs587780841
NM_000244.3(MEN1):c.1185G>C (p.Pro395=) rs587780841
NM_000244.3(MEN1):c.1189G>T (p.Glu397Ter) rs772588551
NM_000244.3(MEN1):c.1189del (p.Glu397fs) rs386134247
NM_000244.3(MEN1):c.1189dup (p.Glu397fs) rs386134247
NM_000244.3(MEN1):c.1192C>G (p.Gln398Glu) rs1060499984
NM_000244.3(MEN1):c.1196G>C (p.Ser399Thr) rs934222398
NM_000244.3(MEN1):c.119_124del (p.Val40_Leu41del) rs386134248
NM_000244.3(MEN1):c.11A>C (p.Lys4Thr)
NM_000244.3(MEN1):c.1200+4A>G rs863224809
NM_000244.3(MEN1):c.1200+5A>G
NM_000244.3(MEN1):c.1201-6G>A rs576193460
NM_000244.3(MEN1):c.1201-7C>T rs587780842
NM_000244.3(MEN1):c.1201-8del rs1555164452
NM_000244.3(MEN1):c.1201-9C>T rs1555164455
NM_000244.3(MEN1):c.1206C>T (p.Thr402=) rs1166154585
NM_000244.3(MEN1):c.1208dup (p.Ser404fs) rs1555164430
NM_000244.3(MEN1):c.1209G>C (p.Gln403His)
NM_000244.3(MEN1):c.1217G>T (p.Gly406Val) rs878855186
NM_000244.3(MEN1):c.1218T>C (p.Gly406=) rs878855187
NM_000244.3(MEN1):c.1221C>A (p.Ser407=) rs770037856
NM_000244.3(MEN1):c.1221C>T (p.Ser407=) rs770037856
NM_000244.3(MEN1):c.1222G>A (p.Ala408Thr) rs746135199
NM_000244.3(MEN1):c.1225C>T (p.Leu409Phe) rs1060499989
NM_000244.3(MEN1):c.1227C>G (p.Leu409=) rs577268289
NM_000244.3(MEN1):c.1228C>T (p.Gln410Ter) rs864622615
NM_000244.3(MEN1):c.1234C>G (p.Pro412Ala) rs1060499985
NM_000244.3(MEN1):c.1234_1235del (p.Asp411_Pro412insTer)
NM_000244.3(MEN1):c.1235_1236del (p.Pro412fs)
NM_000244.3(MEN1):c.1239_1240insGTCC (p.Cys414fs) rs1114167524
NM_000244.3(MEN1):c.1241G>A (p.Cys414Tyr) rs1060499988
NM_000244.3(MEN1):c.1245C>T (p.Phe415=) rs878855188
NM_000244.3(MEN1):c.1246G>A (p.Ala416Thr) rs757179911
NM_000244.3(MEN1):c.1246G>T (p.Ala416Ser) rs757179911
NM_000244.3(MEN1):c.1258C>T (p.Arg420Ter) rs1060499974
NM_000244.3(MEN1):c.1259G>A (p.Arg420Gln) rs1446518998
NM_000244.3(MEN1):c.1259G>C (p.Arg420Pro) rs1446518998
NM_000244.3(MEN1):c.125G>C (p.Gly42Ala)
NM_000244.3(MEN1):c.1266C>T (p.Tyr422=) rs751481164
NM_000244.3(MEN1):c.1267G>A (p.Asp423Asn) rs104894264
NM_000244.3(MEN1):c.1268_1271del (p.Asp423fs)
NM_000244.3(MEN1):c.1269C>G (p.Asp423Glu)
NM_000244.3(MEN1):c.1269C>T (p.Asp423=) rs2071313
NM_000244.3(MEN1):c.1277G>A (p.Cys426Tyr) rs386134249
NM_000244.3(MEN1):c.1282T>C (p.Trp428Arg) rs1555164270
NM_000244.3(MEN1):c.1294A>C (p.Ser432Arg) rs1555164245
NM_000244.3(MEN1):c.129C>G (p.Phe43Leu)
NM_000244.3(MEN1):c.1302G>A (p.Thr434=) rs376598079
NM_000244.3(MEN1):c.1302G>T (p.Thr434=) rs376598079
NM_000244.3(MEN1):c.1309_1317del (p.Leu437_Val439del) rs1555164218
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.1314C>T (p.His438=) rs540012
NM_000244.3(MEN1):c.1321T>A (p.Trp441Arg) rs104894259
NM_000244.3(MEN1):c.1322G>A (p.Trp441Ter) rs104894260
NM_000244.3(MEN1):c.1323G>T (p.Trp441Cys) rs398124435
NM_000244.3(MEN1):c.1326del (p.Thr443fs)
NM_000244.3(MEN1):c.1326dup (p.Thr443fs) rs1555164184
NM_000244.3(MEN1):c.1329C>G (p.Thr443=) rs897481809
NM_000244.3(MEN1):c.132G>T (p.Val44=) rs1555166691
NM_000244.3(MEN1):c.1339C>T (p.Gln447Ter) rs794728654
NM_000244.3(MEN1):c.133G>A (p.Glu45Lys) rs1114167491
NM_000244.3(MEN1):c.1343C>A (p.Ser448Tyr) rs1060499981
NM_000244.3(MEN1):c.1348G>T (p.Gly450Cys) rs1555164153
NM_000244.3(MEN1):c.1349del (p.Gly450fs) rs1565640081
NM_000244.3(MEN1):c.134A>G (p.Glu45Gly)
NM_000244.3(MEN1):c.1351C>T (p.Arg451Cys)
NM_000244.3(MEN1):c.1352G>A (p.Arg451His) rs1555164143
NM_000244.3(MEN1):c.135G>C (p.Glu45Asp) rs778670301
NM_000244.3(MEN1):c.1365+1_1365+11del rs764570645
NM_000244.3(MEN1):c.1365+2T>C rs1555164115
NM_000244.3(MEN1):c.1365+5G>A rs1565639811
NM_000244.3(MEN1):c.1365+6G>A
NM_000244.3(MEN1):c.1366-10A>G rs757569943
NM_000244.3(MEN1):c.1366-1G>A rs794728629
NM_000244.3(MEN1):c.1366-1G>C rs794728629
NM_000244.3(MEN1):c.1366-2A>G rs1060499986
NM_000244.3(MEN1):c.1366-2_*132del rs1565634591
NM_000244.3(MEN1):c.1366-4C>T rs764408631
NM_000244.3(MEN1):c.1366-6G>A rs1555164004
NM_000244.3(MEN1):c.1366-8T>G rs751932519
NM_000244.3(MEN1):c.1366-9C>G
NM_000244.3(MEN1):c.1366_*820del (p.Val456fs)
NM_000244.3(MEN1):c.1369C>T (p.Arg457Trp) rs863224810
NM_000244.3(MEN1):c.1370G>A (p.Arg457Gln)
NM_000244.3(MEN1):c.1379T>A (p.Val460Glu) rs878855189
NM_000244.3(MEN1):c.1382G>A (p.Arg461His) rs372468697
NM_000244.3(MEN1):c.1390_1397del (p.Ser464fs) rs1555163883
NM_000244.3(MEN1):c.1393C>A (p.Arg465=) rs104894267
NM_000244.3(MEN1):c.1393C>T (p.Arg465Ter) rs104894267
NM_000244.3(MEN1):c.1394G>A (p.Arg465Gln) rs200035619
NM_000244.3(MEN1):c.1394G>C (p.Arg465Pro) rs200035619
NM_000244.3(MEN1):c.1397_1404dup (p.Ala469fs) rs1114167531
NM_000244.3(MEN1):c.1397_1419dup (p.Glu474fs) rs1555163780
NM_000244.3(MEN1):c.1401C>A (p.Ala467=) rs771827808
NM_000244.3(MEN1):c.1401C>G (p.Ala467=) rs771827808
NM_000244.3(MEN1):c.1401C>T (p.Ala467=) rs771827808
NM_000244.3(MEN1):c.1404G>C (p.Glu468Asp) rs1555163863
NM_000244.3(MEN1):c.1406C>T (p.Ala469Val) rs778728934
NM_000244.3(MEN1):c.1406_1411dup (p.Ala469_Ala470dup) rs1555163821
NM_000244.3(MEN1):c.1406_1420del (p.Ala469_Glu473del)
NM_000244.3(MEN1):c.1407G>A (p.Ala469=) rs754445482
NM_000244.3(MEN1):c.1408_1422del (p.Ala470_Glu474del) rs1064792907
NM_000244.3(MEN1):c.1409_1417dup (p.467_469AEA[3])
NM_000244.3(MEN1):c.1410C>T (p.Ala470=) rs748820252
NM_000244.3(MEN1):c.1412A>T (p.Glu471Val) rs1352053477
NM_000244.3(MEN1):c.1413G>T (p.Glu471Asp) rs990566024
NM_000244.3(MEN1):c.1414G>A (p.Ala472Thr) rs779589005
NM_000244.3(MEN1):c.1415_1428del (p.Ala472fs)
NM_000244.3(MEN1):c.1416C>T (p.Ala472=) rs878855190
NM_000244.3(MEN1):c.1419G>A (p.Glu473=) rs755734265
NM_000244.3(MEN1):c.1421A>C (p.Glu474Ala) rs1565638407
NM_000244.3(MEN1):c.1421_1428dup (p.Gly477fs) rs1114167536
NM_000244.3(MEN1):c.1422_1436del (p.Pro475_Glu479del) rs1033303123
NM_000244.3(MEN1):c.1424C>T (p.Pro475Leu) rs750112288
NM_000244.3(MEN1):c.1425G>A (p.Pro475=) rs1060503795
NM_000244.3(MEN1):c.1427G>A (p.Trp476Ter) rs1060499991
NM_000244.3(MEN1):c.142del (p.Leu48fs) rs1555166681
NM_000244.3(MEN1):c.1431C>T (p.Gly477=) rs764509990
NM_000244.3(MEN1):c.1435del (p.Glu479fs)
NM_000244.3(MEN1):c.1439_1447del (p.Ala480_Glu482del)
NM_000244.3(MEN1):c.1443G>C (p.Arg481=) rs1555163730
NM_000244.3(MEN1):c.1444G>C (p.Glu482Gln) rs863224526
NM_000244.3(MEN1):c.1444G>T (p.Glu482Ter) rs863224526
NM_000244.3(MEN1):c.1446A>T (p.Glu482Asp) rs863224811
NM_000244.3(MEN1):c.1449C>T (p.Gly483=) rs200280309
NM_000244.3(MEN1):c.1451G>C (p.Arg484Pro) rs1555163716
NM_000244.3(MEN1):c.1458G>A (p.Arg486=) rs864622641
NM_000244.3(MEN1):c.1468C>T (p.Arg490Trp) rs1254459338
NM_000244.3(MEN1):c.146C>T (p.Ala49Val) rs1555166674
NM_000244.3(MEN1):c.1473G>A (p.Glu491=) rs1413990417
NM_000244.3(MEN1):c.1474T>C (p.Ser492Pro) rs1057427859
NM_000244.3(MEN1):c.1480C>T (p.Pro494Ser) rs587778440
NM_000244.3(MEN1):c.1488G>A (p.Glu496=) rs1555163642
NM_000244.3(MEN1):c.1488del (p.Glu496fs) rs1555163646
NM_000244.3(MEN1):c.1493C>T (p.Pro498Leu) rs766604600
NM_000244.3(MEN1):c.1494G>A (p.Pro498=) rs546721780
NM_000244.3(MEN1):c.1496C>T (p.Pro499Leu) rs1060499993
NM_000244.3(MEN1):c.1497G>A (p.Pro499=) rs773363654
NM_000244.3(MEN1):c.1507C>G (p.Pro503Ala)
NM_000244.3(MEN1):c.1509A>T (p.Pro503=) rs1037335560
NM_000244.3(MEN1):c.1521G>C (p.Lys507Asn) rs774296730
NM_000244.3(MEN1):c.1523G>A (p.Gly508Asp) rs375804228
NM_000244.3(MEN1):c.1531A>C (p.Thr511Pro) rs1060499994
NM_000244.3(MEN1):c.1532C>T (p.Thr511Ile) rs1347992299
NM_000244.3(MEN1):c.1533C>T (p.Thr511=) rs749265222
NM_000244.3(MEN1):c.1534G>T (p.Gly512Cys) rs1423874145
NM_000244.3(MEN1):c.1537C>A (p.Gln513Lys) rs386833403
NM_000244.3(MEN1):c.153C>T (p.Asn51=) rs1555166669
NM_000244.3(MEN1):c.1541G>T (p.Gly514Val) rs769355346
NM_000244.3(MEN1):c.1550C>G (p.Ser517Ter) rs141679530
NM_000244.3(MEN1):c.1550C>T (p.Ser517Leu) rs141679530
NM_000244.3(MEN1):c.1555C>A (p.Pro519Thr) rs150202288
NM_000244.3(MEN1):c.1555C>T (p.Pro519Ser)
NM_000244.3(MEN1):c.1556C>G (p.Pro519Arg) rs753022747
NM_000244.3(MEN1):c.1556C>T (p.Pro519Leu) rs753022747
NM_000244.3(MEN1):c.1558C>T (p.Pro520Ser)
NM_000244.3(MEN1):c.1560C>A (p.Pro520=) rs1555163491
NM_000244.3(MEN1):c.1561C>G (p.Arg521Gly)
NM_000244.3(MEN1):c.1561del (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1561dup (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1562G>A (p.Arg521Gln)
NM_000244.3(MEN1):c.1567C>T (p.Pro523Ser)
NM_000244.3(MEN1):c.1576A>T (p.Thr526Ser) rs1565636917
NM_000244.3(MEN1):c.1577C>G (p.Thr526Ser)
NM_000244.3(MEN1):c.1577C>T (p.Thr526Ile) rs1565636898
NM_000244.3(MEN1):c.1579G>C (p.Val527Leu) rs1060499983
NM_000244.3(MEN1):c.1582G>A (p.Ala528Thr) rs760683615
NM_000244.3(MEN1):c.1582G>C (p.Ala528Pro) rs760683615
NM_000244.3(MEN1):c.1593C>A (p.Ala531=) rs767655504
NM_000244.3(MEN1):c.1594C>T (p.Arg532Ter) rs104894261
NM_000244.3(MEN1):c.1598G>A (p.Gly533Asp) rs1555163392
NM_000244.3(MEN1):c.15C>A (p.Ala5=) rs757821521
NM_000244.3(MEN1):c.1609G>T (p.Gly537Cys) rs587780843
NM_000244.3(MEN1):c.1623G>A (p.Gln541=) rs1055457298
NM_000244.3(MEN1):c.1625T>G (p.Val542Gly)
NM_000244.3(MEN1):c.162C>T (p.Ile54=) rs1555166662
NM_000244.3(MEN1):c.1633C>T (p.Pro545Ser) rs745404679
NM_000244.3(MEN1):c.1636G>A (p.Ala546Thr) rs2959656
NM_000244.3(MEN1):c.1636G>C (p.Ala546Pro)
NM_000244.3(MEN1):c.1643C>T (p.Ser548Leu)
NM_000244.3(MEN1):c.1648_1650CCG[3] (p.Pro551dup) rs774350463
NM_000244.3(MEN1):c.1650G>A (p.Pro550=) rs1349729840
NM_000244.3(MEN1):c.1652C>T (p.Pro551Leu) rs779413959
NM_000244.3(MEN1):c.1653G>A (p.Pro551=) rs368783097
NM_000244.3(MEN1):c.1655A>G (p.Glu552Gly) rs914488914
NM_000244.3(MEN1):c.1656G>A (p.Glu552=) rs1555163295
NM_000244.3(MEN1):c.165T>A (p.Pro55=) rs1060503790
NM_000244.3(MEN1):c.1663G>C (p.Val555Leu)
NM_000244.3(MEN1):c.1669A>T (p.Thr557Ser) rs121913035
NM_000244.3(MEN1):c.1671T>C (p.Thr557=) rs143423552
NM_000244.3(MEN1):c.1675C>T (p.Gln559Ter) rs794728631
NM_000244.3(MEN1):c.1679G>A (p.Ser560Asn) rs863224527
NM_000244.3(MEN1):c.1685del (p.Lys562fs)
NM_000244.3(MEN1):c.1689dup (p.Lys564fs) rs1565635941
NM_000244.3(MEN1):c.168del (p.Asn57fs) rs1060499990
NM_000244.3(MEN1):c.16G>T (p.Ala6Ser) rs966793401
NM_000244.3(MEN1):c.1707G>T (p.Leu569=) rs367581776
NM_000244.3(MEN1):c.1710G>T (p.Leu570=) rs767677287
NM_000244.3(MEN1):c.1716C>T (p.Ala572=) rs757417271
NM_000244.3(MEN1):c.1754del (p.Thr585fs) rs864622617
NM_000244.3(MEN1):c.1755G>C (p.Thr585=) rs1114167530
NM_000244.3(MEN1):c.175C>G (p.Pro59Ala) rs1352823623
NM_000244.3(MEN1):c.1764G>C (p.Ser588=) rs765105348
NM_000244.3(MEN1):c.1769T>G (p.Val590Gly)
NM_000244.3(MEN1):c.176C>G (p.Pro59Arg)
NM_000244.3(MEN1):c.1773G>A (p.Gln591=) rs759563305
NM_000244.3(MEN1):c.1776G>A (p.Met592Ile) rs1555163058
NM_000244.3(MEN1):c.1777_1779AAG[1] (p.Lys594del) rs1303070443
NM_000244.3(MEN1):c.1779G>A (p.Lys593=) rs373669288
NM_000244.3(MEN1):c.177C>T (p.Pro59=) rs749001511
NM_000244.3(MEN1):c.1792T>C (p.Ser598Pro) rs1411766225
NM_000244.3(MEN1):c.1794C>T (p.Ser598=) rs1157546350
NM_000244.3(MEN1):c.1811_1812CT[1] (p.Leu605fs) rs1555163017
NM_000244.3(MEN1):c.1815G>T (p.Leu605=) rs148825200
NM_000244.3(MEN1):c.1821C>T (p.Phe607=) rs1060503794
NM_000244.3(MEN1):c.183C>A (p.Leu61=) rs1555166622
NM_000244.3(MEN1):c.1841G>T (p.Gly614Val) rs1186858249
NM_000244.3(MEN1):c.184A>C (p.Thr62Pro) rs1555166619
NM_000244.3(MEN1):c.188T>A (p.Phe63Tyr)
NM_000244.3(MEN1):c.189C>G (p.Phe63Leu) rs137880635
NM_000244.3(MEN1):c.18C>T (p.Ala6=) rs369348210
NM_000244.3(MEN1):c.191_195AGCCC[3] (p.Asp70fs) rs1555166609
NM_000244.3(MEN1):c.193C>A (p.Pro65Thr) rs1235900915
NM_000244.3(MEN1):c.195C>A (p.Pro65=) rs1438097332
NM_000244.3(MEN1):c.197_201GCCCC[3] (p.Asp70fs) rs730882136
NM_000244.3(MEN1):c.1A>G (p.Met1Val) rs386134250
NM_000244.3(MEN1):c.1A>T (p.Met1Leu) rs386134250
NM_000244.3(MEN1):c.201C>T (p.Pro67=) rs1060503791
NM_000244.3(MEN1):c.202G>A (p.Ala68Thr) rs1343345477
NM_000244.3(MEN1):c.203C>T (p.Ala68Val) rs1319371332
NM_000244.3(MEN1):c.205C>T (p.Pro69Ser) rs1060499995
NM_000244.3(MEN1):c.208G>T (p.Asp70Tyr)
NM_000244.3(MEN1):c.210C>A (p.Asp70Glu) rs150308912
NM_000244.3(MEN1):c.211C>T (p.Pro71Ser)
NM_000244.3(MEN1):c.211_212del (p.Pro71fs) rs386134251
NM_000244.3(MEN1):c.215C>A (p.Pro72His)
NM_000244.3(MEN1):c.231C>G (p.Tyr77Ter) rs1555166567
NM_000244.3(MEN1):c.236C>G (p.Pro79Arg) rs1555166557
NM_000244.3(MEN1):c.236C>T (p.Pro79Leu)
NM_000244.3(MEN1):c.237del (p.Val80fs) rs1114167486
NM_000244.3(MEN1):c.240G>T (p.Val80=) rs1555166545
NM_000244.3(MEN1):c.244G>C (p.Asp82His) rs1419086083
NM_000244.3(MEN1):c.246C>G (p.Asp82Glu) rs1238113583
NM_000244.3(MEN1):c.249G>A (p.Leu83=) rs386134252
NM_000244.3(MEN1):c.249_252del (p.Ile85fs) rs587776841
NM_000244.3(MEN1):c.252_253insTT (p.Ile85fs) rs386134253
NM_000244.3(MEN1):c.252dup (p.Ile85fs) rs386134253
NM_000244.3(MEN1):c.266_286del (p.Leu89_Ala95del) rs1064792906
NM_000244.3(MEN1):c.267C>G (p.Leu89=) rs1060499972
NM_000244.3(MEN1):c.269A>G (p.Tyr90Cys) rs1565651873
NM_000244.3(MEN1):c.280_284dup (p.Gln96fs) rs1555166494
NM_000244.3(MEN1):c.281C>T (p.Thr94Ile) rs1565651820
NM_000244.3(MEN1):c.282C>T (p.Thr94=) rs760442763
NM_000244.3(MEN1):c.283G>T (p.Ala95Ser)
NM_000244.3(MEN1):c.293G>A (p.Arg98Gln)
NM_000244.3(MEN1):c.298G>T (p.Ala100Ser)
NM_000244.3(MEN1):c.299C>T (p.Ala100Val) rs998337367
NM_000244.3(MEN1):c.300C>G (p.Ala100=) rs773136972
NM_000244.3(MEN1):c.303C>T (p.Val101=) rs1463347315
NM_000244.3(MEN1):c.307C>T (p.Leu103=) rs1313314117
NM_000244.3(MEN1):c.307del (p.Leu103fs) rs794728639
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000244.3(MEN1):c.317A>G (p.Tyr106Cys) rs1555166469
NM_000244.3(MEN1):c.317_318del (p.Tyr106fs) rs1555166466
NM_000244.3(MEN1):c.318T>A (p.Tyr106Ter) rs1060499987
NM_000244.3(MEN1):c.322C>G (p.Arg108Gly)
NM_000244.3(MEN1):c.322C>T (p.Arg108Ter) rs794728647
NM_000244.3(MEN1):c.322_323insT (p.Arg108fs) rs1565651568
NM_000244.3(MEN1):c.323del (p.Arg108fs) rs878855191
NM_000244.3(MEN1):c.326A>G (p.Glu109Gly) rs1555166447
NM_000244.3(MEN1):c.327A>C (p.Glu109Asp) rs773976527
NM_000244.3(MEN1):c.330G>C (p.Gly110=) rs1060503792
NM_000244.3(MEN1):c.333T>C (p.Gly111=) rs1555166432
NM_000244.3(MEN1):c.339C>T (p.Ser113=) rs559635859
NM_000244.3(MEN1):c.343C>G (p.Arg115Gly) rs1565651402
NM_000244.3(MEN1):c.344G>A (p.Arg115His) rs1114167507
NM_000244.3(MEN1):c.345T>C (p.Arg115=) rs748948131
NM_000244.3(MEN1):c.346G>T (p.Glu116Ter) rs1060499992
NM_000244.3(MEN1):c.352G>A (p.Val118Met) rs1060499975
NM_000244.3(MEN1):c.355_357AAG[1] (p.Lys120del) rs794728657
NM_000244.3(MEN1):c.358A>T (p.Lys120Ter) rs878855192
NM_000244.3(MEN1):c.35C>T (p.Pro12Leu) rs794728614
NM_000244.3(MEN1):c.361G>A (p.Val121Ile) rs863224812
NM_000244.3(MEN1):c.361G>T (p.Val121Phe)
NM_000244.3(MEN1):c.366C>T (p.Ser122=)
NM_000244.3(MEN1):c.369T>C (p.Asp123=) rs1555166369
NM_000244.3(MEN1):c.375A>C (p.Ile125=) rs184896922
NM_000244.3(MEN1):c.375A>T (p.Ile125=) rs184896922
NM_000244.3(MEN1):c.378G>A (p.Trp126Ter) rs1555166365
NM_000244.3(MEN1):c.386del (p.Leu129fs) rs1565651223
NM_000244.3(MEN1):c.38T>C (p.Leu13Pro)
NM_000244.3(MEN1):c.38T>G (p.Leu13Arg) rs1262285748
NM_000244.3(MEN1):c.398A>G (p.Tyr133Cys) rs1555166357
NM_000244.3(MEN1):c.3G>A (p.Met1Ile) rs786204242
NM_000244.3(MEN1):c.402del (p.Phe134fs) rs397515385
NM_000244.3(MEN1):c.403A>C (p.Lys135Gln) rs121913034
NM_000244.3(MEN1):c.406_415delinsTCCCT (p.Asp136fs)
NM_000244.3(MEN1):c.409C>T (p.Arg137Trp) rs1208267598
NM_000244.3(MEN1):c.40C>T (p.Arg14Cys)
NM_000244.3(MEN1):c.415C>G (p.His139Asp) rs104894263
NM_000244.3(MEN1):c.417C>G (p.His139Gln) rs386134254
NM_000244.3(MEN1):c.418A>T (p.Ile140Phe) rs376510601
NM_000244.3(MEN1):c.421C>T (p.Gln141Ter) rs886039553
NM_000244.3(MEN1):c.426C>T (p.Ser142=) rs753252650
NM_000244.3(MEN1):c.435C>T (p.Ser145=) rs61736636
NM_000244.3(MEN1):c.441C>T (p.Ile147=) rs878855193
NM_000244.3(MEN1):c.461-1G>C
NM_000244.3(MEN1):c.461-2A>G rs886042035
NM_000244.3(MEN1):c.461-3C>A rs377461506
NM_000244.3(MEN1):c.461-9C>A rs1371109251
NM_000244.3(MEN1):c.473A>T (p.Asp158Val) rs1565648789
NM_000244.3(MEN1):c.480C>T (p.Ser160=) rs936786553
NM_000244.3(MEN1):c.480_481insAATT (p.Gly161fs) rs386134255
NM_000244.3(MEN1):c.481G>A (p.Gly161Ser)
NM_000244.3(MEN1):c.482G>A (p.Gly161Asp) rs794728648
NM_000244.3(MEN1):c.484G>A (p.Val162Met) rs1555165872
NM_000244.3(MEN1):c.486G>A (p.Val162=) rs878855194
NM_000244.3(MEN1):c.488C>A (p.Ala163Asp) rs794728617
NM_000244.3(MEN1):c.488C>T (p.Ala163Val)
NM_000244.3(MEN1):c.489C>T (p.Ala163=) rs772526802
NM_000244.3(MEN1):c.48C>T (p.Ile16=) rs1060503797
NM_000244.3(MEN1):c.493G>C (p.Ala165Pro) rs1565648656
NM_000244.3(MEN1):c.49G>A (p.Asp17Asn) rs1399824473
NM_000244.3(MEN1):c.500T>C (p.Val167Ala) rs748648909
NM_000244.3(MEN1):c.505G>T (p.Ala169Ser)
NM_000244.3(MEN1):c.506C>T (p.Ala169Val) rs1565648547
NM_000244.3(MEN1):c.507C>T (p.Ala169=) rs146759807
NM_000244.3(MEN1):c.509G>A (p.Cys170Tyr) rs1057521111
NM_000244.3(MEN1):c.510C>A (p.Cys170Ter)
NM_000244.3(MEN1):c.517C>G (p.Leu173Val) rs1555165846
NM_000244.3(MEN1):c.518T>C (p.Leu173Pro) rs386134256
NM_000244.3(MEN1):c.526C>T (p.Arg176Trp) rs143329068
NM_000244.3(MEN1):c.527G>A (p.Arg176Gln) rs607969
NM_000244.3(MEN1):c.528G>C (p.Arg176=) rs560870111
NM_000244.3(MEN1):c.540C>T (p.Leu180=) rs200155578
NM_000244.3(MEN1):c.541G>C (p.Ala181Pro) rs376872829
NM_000244.3(MEN1):c.541G>T (p.Ala181Ser) rs376872829
NM_000244.3(MEN1):c.544C>G (p.Leu182Val)
NM_000244.3(MEN1):c.546G>A (p.Leu182=) rs146568011
NM_000244.3(MEN1):c.54C>T (p.Asp18=) rs1316973259
NM_000244.3(MEN1):c.552_553delinsTT (p.Glu184_Asp185delinsAspTyr) rs1555165809
NM_000244.3(MEN1):c.563G>A (p.Trp188Ter) rs794728650
NM_000244.3(MEN1):c.566T>A (p.Val189Glu) rs104894262
NM_000244.3(MEN1):c.569T>C (p.Val190Ala) rs764847812
NM_000244.3(MEN1):c.578C>T (p.Pro193Leu) rs199706698
NM_000244.3(MEN1):c.578_579del (p.Pro193fs) rs1555165756
NM_000244.3(MEN1):c.581A>G (p.Asn194Ser) rs587780844
NM_000244.3(MEN1):c.583G>A (p.Gly195Arg) rs1555165742
NM_000244.3(MEN1):c.584G>A (p.Gly195Glu) rs878855195
NM_000244.3(MEN1):c.585G>A (p.Gly195=) rs547249181
NM_000244.3(MEN1):c.593C>G (p.Thr198Arg)
NM_000244.3(MEN1):c.5G>A (p.Gly2Glu)
NM_000244.3(MEN1):c.600G>A (p.Glu200=) rs864622177
NM_000244.3(MEN1):c.605C>T (p.Thr202Ile)
NM_000244.3(MEN1):c.606C>G (p.Thr202=) rs527294715
NM_000244.3(MEN1):c.608G>A (p.Trp203Ter) rs104894258
NM_000244.3(MEN1):c.609G>A (p.Trp203Ter) rs104894257
NM_000244.3(MEN1):c.60G>C (p.Val20=) rs776432516
NM_000244.3(MEN1):c.612C>A (p.His204Gln) rs150512958
NM_000244.3(MEN1):c.612C>T (p.His204=) rs150512958
NM_000244.3(MEN1):c.613G>A (p.Gly205Ser)
NM_000244.3(MEN1):c.61C>G (p.Arg21Gly) rs541476418
NM_000244.3(MEN1):c.624C>T (p.Asn208=) rs749844029
NM_000244.3(MEN1):c.632G>A (p.Arg211His) rs1565647825
NM_000244.3(MEN1):c.633C>T (p.Arg211=) rs1555165717
NM_000244.3(MEN1):c.636G>A (p.Arg212=) rs779966911
NM_000244.3(MEN1):c.638_1065-143del
NM_000244.3(MEN1):c.640C>T (p.Gln214Ter) rs1565647767
NM_000244.3(MEN1):c.642G>C (p.Gln214His) rs1565647751
NM_000244.3(MEN1):c.643_646del (p.Thr215fs) rs794728640
NM_000244.3(MEN1):c.644C>G (p.Thr215Arg) rs756287855
NM_000244.3(MEN1):c.647T>G (p.Val216Gly) rs1565647698
NM_000244.3(MEN1):c.648del (p.Asn217fs) rs878855196
NM_000244.3(MEN1):c.649A>G (p.Asn217Asp) rs1060499980
NM_000244.3(MEN1):c.650A>G (p.Asn217Ser) rs1438685841
NM_000244.3(MEN1):c.654C>T (p.Ala218=) rs746067825
NM_000244.3(MEN1):c.655G>A (p.Gly219Ser) rs781493730
NM_000244.3(MEN1):c.658G>A (p.Val220Met) rs794728621
NM_000244.3(MEN1):c.659_667delinsGCCCCT (p.Val220_Arg223delinsGlyProTrp) rs386134257
NM_000244.3(MEN1):c.65T>G (p.Leu22Arg) rs104894256
NM_000244.3(MEN1):c.661G>C (p.Ala221Pro)
NM_000244.3(MEN1):c.664_669+2delGAGCGGGT rs386134258
NM_000244.3(MEN1):c.667C>T (p.Arg223Trp) rs794728620
NM_000244.3(MEN1):c.669+10C>T rs921850475
NM_000244.3(MEN1):c.669+18C>T rs180737290
NM_000244.3(MEN1):c.669+1G>A
NM_000244.3(MEN1):c.669+1G>T rs794728622
NM_000244.3(MEN1):c.669+9C>A rs202134234
NM_000244.3(MEN1):c.669+9C>G rs202134234
NM_000244.3(MEN1):c.669+9C>T rs202134234
NM_000244.3(MEN1):c.670-15_673del
NM_000244.3(MEN1):c.670-1G>A
NM_000244.3(MEN1):c.670-4del rs748005956
NM_000244.3(MEN1):c.670-5C>G rs752563214
NM_000244.3(MEN1):c.670-5dupC rs772016629
NM_000244.3(MEN1):c.670-6C>A rs77461664
NM_000244.3(MEN1):c.670-6C>G rs77461664
NM_000244.3(MEN1):c.670-6C>T rs77461664
NM_000244.3(MEN1):c.670-6_670-4del rs1555165623
NM_000244.3(MEN1):c.670-7C>A rs771297371
NM_000244.3(MEN1):c.674G>A (p.Trp225Ter) rs1565647197
NM_000244.3(MEN1):c.675G>T (p.Trp225Cys)
NM_000244.3(MEN1):c.680A>C (p.Tyr227Ser) rs1555165601
NM_000244.3(MEN1):c.696C>A (p.Tyr232Ter) rs778921501
NM_000244.3(MEN1):c.697A>G (p.Met233Val) rs1060499982
NM_000244.3(MEN1):c.700C>T (p.Arg234Cys) rs754378887
NM_000244.3(MEN1):c.701G>A (p.Arg234His) rs878855197
NM_000244.3(MEN1):c.709C>T (p.Arg237Cys) rs1225847249
NM_000244.3(MEN1):c.711C>T (p.Arg237=)
NM_000244.3(MEN1):c.713A>C (p.Lys238Thr)
NM_000244.3(MEN1):c.717G>A (p.Met239Ile) rs1448041546
NM_000244.3(MEN1):c.71C>T (p.Ala24Val) rs1328062930
NM_000244.3(MEN1):c.725C>T (p.Ala242Val) rs760289964
NM_000244.3(MEN1):c.726G>A (p.Ala242=) rs144677807
NM_000244.3(MEN1):c.735G>T (p.Val245=) rs1555165534
NM_000244.3(MEN1):c.736T>C (p.Cys246Arg)
NM_000244.3(MEN1):c.737G>A (p.Cys246Tyr) rs794728624
NM_000244.3(MEN1):c.741C>T (p.Ala247=) rs1198651608
NM_000244.3(MEN1):c.744C>T (p.Ile248=) rs1353237754
NM_000244.3(MEN1):c.749del (p.Pro250fs) rs1565646772
NM_000244.3(MEN1):c.74C>T (p.Ala25Val) rs1462138625
NM_000244.3(MEN1):c.751T>G (p.Ser251Ala) rs1175283759
NM_000244.3(MEN1):c.754A>G (p.Ile252Val) rs1555165508
NM_000244.3(MEN1):c.754_760del (p.Ile252fs) rs1555165503
NM_000244.3(MEN1):c.761_764dup (p.Thr256fs)
NM_000244.3(MEN1):c.768C>T (p.Thr256=) rs763326062
NM_000244.3(MEN1):c.769G>C (p.Asp257His)
NM_000244.3(MEN1):c.769G>T (p.Asp257Tyr) rs770368608
NM_000244.3(MEN1):c.76G>A (p.Glu26Lys) rs28931612
NM_000244.3(MEN1):c.773C>A (p.Ser258Ter) rs386134259
NM_000244.3(MEN1):c.773C>G (p.Ser258Trp) rs386134259
NM_000244.3(MEN1):c.773C>T (p.Ser258Leu) rs386134259
NM_000244.3(MEN1):c.773del (p.Ser258fs)
NM_000244.3(MEN1):c.774G>A (p.Ser258=) rs201829546
NM_000244.3(MEN1):c.774G>T (p.Ser258=) rs201829546
NM_000244.3(MEN1):c.777G>A (p.Leu259=) rs199909967
NM_000244.3(MEN1):c.777_783dup (p.Leu262fs) rs1555165488
NM_000244.3(MEN1):c.778G>A (p.Glu260Lys) rs104894268
NM_000244.3(MEN1):c.778G>C (p.Glu260Gln) rs104894268
NM_000244.3(MEN1):c.781C>T (p.Leu261Phe) rs878855198
NM_000244.3(MEN1):c.785_790TGCAGC[3] (p.262_263LQ[3]) rs1555165485
NM_000244.3(MEN1):c.787C>G (p.Gln263Glu)
NM_000244.3(MEN1):c.787C>T (p.Gln263Ter) rs886039416
NM_000244.3(MEN1):c.789G>C (p.Gln263His) rs374659656
NM_000244.3(MEN1):c.793C>T (p.Gln265Ter) rs104894266
NM_000244.3(MEN1):c.796C>T (p.Gln266Ter) rs1057520733
NM_000244.3(MEN1):c.798+1G>A rs794728652
NM_000244.3(MEN1):c.798+7G>A rs1060503793
NM_000244.3(MEN1):c.799-10C>A rs71526470
NM_000244.3(MEN1):c.799-10C>T rs71526470
NM_000244.3(MEN1):c.799-16C>T rs754257177
NM_000244.3(MEN1):c.799-1G>C rs1555165377
NM_000244.3(MEN1):c.799-9G>A rs794728625
NM_000244.3(MEN1):c.800A>G (p.Lys267Arg) rs1555165373
NM_000244.3(MEN1):c.803T>C (p.Leu268Pro) rs1114167502
NM_000244.3(MEN1):c.810G>A (p.Trp270Ter)
NM_000244.3(MEN1):c.816C>G (p.Leu272=)
NM_000244.3(MEN1):c.818A>G (p.Tyr273Cys) rs773500082
NM_000244.3(MEN1):c.820G>A (p.Asp274Asn) rs878855199
NM_000244.3(MEN1):c.826G>A (p.Gly276Arg) rs1565645918
NM_000244.3(MEN1):c.833T>C (p.Leu278Pro)
NM_000244.3(MEN1):c.834G>T (p.Leu278=) rs748369241
NM_000244.3(MEN1):c.838A>G (p.Arg280Gly)
NM_000244.3(MEN1):c.838del (p.Arg280fs) rs1555165360
NM_000244.3(MEN1):c.839+1G>A
NM_000244.3(MEN1):c.839+1G>T rs1060499976
NM_000244.3(MEN1):c.839G>A (p.Arg280Lys)
NM_000244.3(MEN1):c.840-10C>G rs999121619
NM_000244.3(MEN1):c.840-8T>C rs1555165330
NM_000244.3(MEN1):c.842A>G (p.Tyr281Cys) rs1555165327
NM_000244.3(MEN1):c.843C>A (p.Tyr281Ter) rs1060503789
NM_000244.3(MEN1):c.843C>T (p.Tyr281=) rs1060503789
NM_000244.3(MEN1):c.845C>A (p.Pro282His) rs1060499973
NM_000244.3(MEN1):c.845C>T (p.Pro282Leu) rs1060499973
NM_000244.3(MEN1):c.848T>G (p.Met283Arg)
NM_000244.3(MEN1):c.852C>T (p.Ala284=) rs762092675
NM_000244.3(MEN1):c.854T>C (p.Leu285Ser)
NM_000244.3(MEN1):c.858G>C (p.Gly286=) rs562620826
NM_000244.3(MEN1):c.85C>T (p.Arg29Ter) rs794728615
NM_000244.3(MEN1):c.866C>A (p.Ala289Glu) rs1565645563
NM_000244.3(MEN1):c.871C>T (p.Leu291=) rs542321016
NM_000244.3(MEN1):c.87A>C (p.Arg29=) rs1198070818
NM_000244.3(MEN1):c.883G>A (p.Glu295Lys)
NM_000244.3(MEN1):c.884A>C (p.Glu295Ala) rs1213891703
NM_000244.3(MEN1):c.884A>T (p.Glu295Val)
NM_000244.3(MEN1):c.895G>A (p.Gly299Ser) rs1565645429
NM_000244.3(MEN1):c.898C>T (p.Arg300Trp) rs1046929915
NM_000244.3(MEN1):c.899G>A (p.Arg300Gln) rs1397110438
NM_000244.3(MEN1):c.907C>G (p.Pro303Ala) rs1555165268
NM_000244.3(MEN1):c.923A>G (p.His308Arg)
NM_000244.3(MEN1):c.924C>T (p.His308=) rs878855200
NM_000244.3(MEN1):c.927+1G>C rs398124437
NM_000244.3(MEN1):c.927+5G>A
NM_000244.3(MEN1):c.928-2A>G rs1114167498
NM_000244.3(MEN1):c.928-42G>C rs529037188
NM_000244.3(MEN1):c.928-4C>T rs770413697
NM_000244.3(MEN1):c.928G>A (p.Gly310Ser) rs1555165146
NM_000244.3(MEN1):c.92A>G (p.Glu31Gly) rs1060499977
NM_000244.3(MEN1):c.92A>T (p.Glu31Val) rs1060499977
NM_000244.3(MEN1):c.936C>T (p.Ala312=) rs1060503788
NM_000244.3(MEN1):c.947C>T (p.Thr316Ile) rs1565644342
NM_000244.3(MEN1):c.94C>T (p.Pro32Ser) rs773089218
NM_000244.3(MEN1):c.950A>T (p.Tyr317Phe)
NM_000244.3(MEN1):c.951C>G (p.Tyr317Ter) rs386134260
NM_000244.3(MEN1):c.955_1065-227del rs1555164870
NM_000244.3(MEN1):c.956G>A (p.Arg319Gln) rs771645621
NM_000244.3(MEN1):c.967A>G (p.Ile323Val) rs1565644220
NM_000244.3(MEN1):c.970T>G (p.Tyr324Asp) rs1555165101
NM_000244.3(MEN1):c.970dup (p.Tyr324fs) rs386134261
NM_000244.3(MEN1):c.978C>T (p.Tyr326=) rs1555165094
NM_000244.3(MEN1):c.979A>G (p.Met327Val) rs1555165089
NM_000244.3(MEN1):c.979A>T (p.Met327Leu) rs1555165089
NM_000244.3(MEN1):c.981G>A (p.Met327Ile)
NM_000244.3(MEN1):c.984C>A (p.Tyr328Ter) rs750904332
NM_000244.3(MEN1):c.984C>G (p.Tyr328Ter) rs750904332
NM_000244.3(MEN1):c.987G>A (p.Leu329=)
NM_000244.3(MEN1):c.989C>A (p.Ala330Asp) rs370840265
NM_000244.3(MEN1):c.993C>T (p.Gly331=) rs1555165071
NM_000244.3(MEN1):c.995A>G (p.Tyr332Cys)
NM_000244.3(MEN1):c.997C>A (p.His333Asn)
NM_000244.3(MEN1):c.997C>G (p.His333Asp) rs794727882
NM_000286.3(PEX12):c.-26G>A rs727504080
NM_000286.3(PEX12):c.1009C>T (p.Gln337Ter) rs760739894
NM_000286.3(PEX12):c.1023del (p.Thr342fs) rs1555549723
NM_000286.3(PEX12):c.1044_1046ACA[1] (p.Gln349del) rs267608184
NM_000286.3(PEX12):c.1070_1071del (p.Pro357fs) rs1555549722
NM_000286.3(PEX12):c.126+1G>T rs144259891
NM_000286.3(PEX12):c.126+2T>A rs1555549902
NM_000286.3(PEX12):c.182_184dup (p.Ile62_Phe63insLys) rs1412916235
NM_000286.3(PEX12):c.18_41del (p.His7_Ala14del) rs1555549917
NM_000286.3(PEX12):c.190_194del (p.Thr64fs) rs1214971073
NM_000286.3(PEX12):c.1_2del (p.Met1fs) rs1555549923
NM_000286.3(PEX12):c.201_203TCT[1] (p.Leu70del) rs61752098
NM_000286.3(PEX12):c.211C>T (p.Gln71Ter) rs767447750
NM_000286.3(PEX12):c.222T>A (p.Tyr74Ter) rs765404768
NM_000286.3(PEX12):c.223_224del (p.Leu75fs) rs1555549876
NM_000286.3(PEX12):c.268_271del (p.Lys90fs) rs61752100
NM_000286.3(PEX12):c.334C>T (p.Gln112Ter) rs776731688
NM_000286.3(PEX12):c.349A>G (p.Ile117Val) rs767207001
NM_000286.3(PEX12):c.353T>C (p.Met118Thr) rs879075660
NM_000286.3(PEX12):c.362_364TTC[2] (p.Leu123del) rs751058068
NM_000286.3(PEX12):c.392_400del (p.Glu131_Leu133del) rs1458853023
NM_000286.3(PEX12):c.429_431inv (p.Tyr143_Ser144delinsTer) rs1555549862
NM_000286.3(PEX12):c.460C>T (p.Arg154Ter) rs1555549855
NM_000286.3(PEX12):c.49C>T (p.Gln17Ter) rs888633730
NM_000286.3(PEX12):c.530_532AAC[1] (p.Gln178del) rs61752102
NM_000286.3(PEX12):c.538C>T (p.Arg180Ter) rs61752103
NM_000286.3(PEX12):c.604C>T (p.Arg202Ter) rs61752105
NM_000286.3(PEX12):c.625C>T (p.Gln209Ter) rs61752106
NM_000286.3(PEX12):c.644del (p.Pro215fs) rs1199283977
NM_000286.3(PEX12):c.664C>T (p.Gln222Ter) rs1555549841
NM_000286.3(PEX12):c.680+1G>A rs904972651
NM_000286.3(PEX12):c.681-2A>C rs187526749
NM_000286.3(PEX12):c.684_687del (p.Ser229fs) rs62642859
NM_000286.3(PEX12):c.687_690del (p.Ser229fs) rs1555549769
NM_000286.3(PEX12):c.69_76dup (p.Gln26delinsArgTer) rs1238451790
NM_000286.3(PEX12):c.730_733dup (p.Leu245fs) rs61752107
NM_000286.3(PEX12):c.737C>A (p.Ser246Tyr) rs200413804
NM_000286.3(PEX12):c.744dup (p.Thr249fs) rs61752108
NM_000286.3(PEX12):c.771del (p.Leu258fs) rs1555549754
NM_000286.3(PEX12):c.781del (p.Asp262fs) rs754193088
NM_000286.3(PEX12):c.785_787del (p.Asp262_Trp263delinsGly) rs759584047
NM_000286.3(PEX12):c.789G>A (p.Trp263Ter) rs747099919
NM_000286.3(PEX12):c.865_870del (p.Asp289_Tyr290del) rs1366848752
NM_000286.3(PEX12):c.886_887CT[1] (p.Leu297fs) rs398123301
NM_000286.3(PEX12):c.88_89del (p.Met30fs) rs1555549909
NM_000286.3(PEX12):c.894del (p.Lys299_Met300insTer) rs398123302
NM_000286.3(PEX12):c.949C>T (p.Leu317Phe) rs61752112
NM_000286.3(PEX12):c.961_964del (p.Gly321fs) rs749650201
NM_000286.3(PEX12):c.978C>A (p.Tyr326Ter) rs941358133
NM_000286.3(PEX12):c.983_984GT[2] (p.Phe330fs) rs764657253
NM_000287.4(PEX6):c.1046+1G>A rs1554127968
NM_000287.4(PEX6):c.1130+2T>C rs1416001981
NM_000287.4(PEX6):c.1234-1G>T rs1554127533
NM_000287.4(PEX6):c.1238G>T (p.Gly413Val) rs1554127531
NM_000287.4(PEX6):c.1314_1321del (p.Glu439fs) rs267608216
NM_000287.4(PEX6):c.133G>T (p.Glu45Ter) rs1356280167
NM_000287.4(PEX6):c.133_147dup (p.Glu45_Gly49dup) rs1421584986
NM_000287.4(PEX6):c.1368-2del rs1554127415
NM_000287.4(PEX6):c.1440_1442TGC[2] (p.Ala483del) rs1554127389
NM_000287.4(PEX6):c.1479+2del rs1554127383
NM_000287.4(PEX6):c.1601T>C (p.Leu534Pro) rs387906809
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.4(PEX6):c.1841del (p.Leu614fs) rs863225083
NM_000287.4(PEX6):c.1947del (p.Ile650fs) rs267608227
NM_000287.4(PEX6):c.1962-1G>A rs267608229
NM_000287.4(PEX6):c.202_219del (p.Gly68_Gln73del) rs1162020526
NM_000287.4(PEX6):c.2082del (p.Gly695fs) rs766483138
NM_000287.4(PEX6):c.2225T>C (p.Leu742Pro) rs267608235
NM_000287.4(PEX6):c.2356C>T (p.Arg786Trp) rs267608239
NM_000287.4(PEX6):c.2362+1G>A rs1443107232
NM_000287.4(PEX6):c.2362G>A (p.Val788Met) rs267608240
NM_000287.4(PEX6):c.2435G>A (p.Arg812Gln) rs61753229
NM_000287.4(PEX6):c.2439dup (p.Arg814fs) rs1554126955
NM_000287.4(PEX6):c.2440C>T (p.Arg814Ter) rs267608241
NM_000287.4(PEX6):c.2472-2A>G rs267608242
NM_000287.4(PEX6):c.254_259dup (p.Ala85_Leu86dup) rs1554128546
NM_000287.4(PEX6):c.2578C>T (p.Arg860Trp) rs61753230
NM_000287.4(PEX6):c.2626C>T (p.Arg876Trp) rs267608246
NM_000287.4(PEX6):c.2692del (p.Leu898fs) rs1554126798
NM_000287.4(PEX6):c.2730G>A (p.Thr910=) rs774721609
NM_000287.4(PEX6):c.273G>A (p.Trp91Ter) rs1010184002
NM_000287.4(PEX6):c.275_280dup (p.Val92_Arg93dup) rs61752142
NM_000287.4(PEX6):c.2764_2765del (p.Met922fs) rs1554126781
NM_000287.4(PEX6):c.2806+1G>A rs751900826
NM_000287.4(PEX6):c.295C>T (p.Arg99Trp) rs772383329
NM_000287.4(PEX6):c.2T>G (p.Met1Arg) rs1554128597
NM_000287.4(PEX6):c.311del (p.Gly104fs) rs61753209
NM_000287.4(PEX6):c.35T>C (p.Phe12Ser) rs61752139
NM_000287.4(PEX6):c.383_384GA[1] (p.Glu129fs) rs1554128501
NM_000287.4(PEX6):c.406delinsAT (p.Pro136fs) rs1554128488
NM_000287.4(PEX6):c.42_43dup (p.Glu15fs) rs1554128586
NM_000287.4(PEX6):c.462del (p.Leu155fs) rs1554128476
NM_000287.4(PEX6):c.488G>C (p.Arg163Pro) rs778791031
NM_000287.4(PEX6):c.504_505AG[1] (p.Glu169fs) rs1554128461
NM_000287.4(PEX6):c.510dup (p.Gly171fs) rs1491384052
NM_000287.4(PEX6):c.517del (p.Ser173fs) rs61753212
NM_000287.4(PEX6):c.541_543GTG[1] (p.Val182del) rs1554128449
NM_000287.4(PEX6):c.548_550CCT[1] (p.Ser184del) rs1554128446
NM_000287.4(PEX6):c.621_882+2del rs1554128347
NM_000287.4(PEX6):c.654C>G (p.Phe218Leu) rs886037779
NM_000287.4(PEX6):c.659G>T (p.Gly220Val) rs267608203
NM_000287.4(PEX6):c.718G>A (p.Ala240Thr) rs886061412
NM_000287.4(PEX6):c.719C>G (p.Ala240Gly) rs372269200
NM_000287.4(PEX6):c.802_815del (p.Asp268fs) rs63749004
NM_000287.4(PEX6):c.821C>T (p.Pro274Leu) rs61753219
NM_000318.3(PEX2):c.-17-2A>G rs1289852067
NM_000318.3(PEX2):c.163G>A (p.Glu55Lys) rs61752119
NM_000318.3(PEX2):c.304C>T (p.Gln102Ter) rs200065382
NM_000318.3(PEX2):c.339_345del (p.Gly113_Arg114insTer) rs764771123
NM_000318.3(PEX2):c.349_351GAA[1] (p.Glu118del) rs1554584507
NM_000318.3(PEX2):c.354_355del (p.Arg119fs) rs1554584505
NM_000318.3(PEX2):c.355C>T (p.Arg119Ter) rs61752123
NM_000318.3(PEX2):c.373C>T (p.Arg125Ter) rs61752124
NM_000318.3(PEX2):c.472del (p.Leu158fs) rs1554584487
NM_000318.3(PEX2):c.502_503del (p.Glu168fs) rs1554584474
NM_000318.3(PEX2):c.701_706del (p.Asp234_Thr236delinsAla) rs1554584423
NM_000318.3(PEX2):c.769A>G (p.Ile257Val) rs199874465
NM_000318.3(PEX2):c.782A>G (p.His261Arg) rs749956542
NM_000318.3(PEX2):c.829_833TACTT[1] (p.Phe278fs) rs267608188
NM_000318.3(PEX2):c.857_859del (p.Glu286del) rs1460738027
NM_000318.3(PEX2):c.865dup (p.Ser289fs) rs724160029
NM_000318.3(PEX2):c.884C>G (p.Ser295Ter) rs1554584377
NM_000318.3(PEX2):c.916T>C (p.Ter306Gln) rs1554584372
NM_000318.3(PEX2):c.91C>G (p.Gln31Glu) rs149287302
NM_000319.4(PEX5):c.1554T>G (p.Asn518Lys) rs61752138
NM_000319.4(PEX5):c.1612C>T (p.Arg538Cys)
NM_000319.4(PEX5):c.164G>T (p.Gly55Val)
NM_000319.4(PEX5):c.1790G>A (p.Ser597Asn) rs146567534
NM_000319.4(PEX5):c.361G>T (p.Glu121Ter) rs1565673352
NM_000319.4(PEX5):c.815T>C (p.Met272Thr) rs76708142
NM_000349.2(STAR):c.-249C>A rs886062906
NM_000349.2(STAR):c.-255G>T rs567801443
NM_000349.3(STAR):c.*1122T>A rs72556520
NM_000349.3(STAR):c.*116T>G rs35462433
NM_000349.3(STAR):c.*1384del rs886062898
NM_000349.3(STAR):c.*1524A>G rs3990403
NM_000349.3(STAR):c.*1543C>A rs748527738
NM_000349.3(STAR):c.*230A>G rs34575008
NM_000349.3(STAR):c.*348C>T rs886062904
NM_000349.3(STAR):c.*556A>G rs886062903
NM_000349.3(STAR):c.*796A>G rs886062902
NM_000349.3(STAR):c.*817C>T rs886062901
NM_000349.3(STAR):c.*818G>A rs558498679
NM_000349.3(STAR):c.*88G>C rs112828857
NM_000349.3(STAR):c.*913C>T rs551135472
NM_000349.3(STAR):c.*93C>T rs776003335
NM_000349.3(STAR):c.*948del rs886062900
NM_000349.3(STAR):c.*965_*967dup rs11326306
NM_000349.3(STAR):c.*967del rs11326306
NM_000349.3(STAR):c.*981A>G rs188232971
NM_000349.3(STAR):c.*987A>G rs28361934
NM_000349.3(STAR):c.-70G>T rs370257148
NM_000349.3(STAR):c.120G>A (p.Leu40=) rs138786388
NM_000349.3(STAR):c.125dup (p.Thr44fs) rs750549499
NM_000349.3(STAR):c.135del (p.Ser46fs) rs193922393
NM_000349.3(STAR):c.149_157del (p.Asn50_Val52del) rs1554503018
NM_000349.3(STAR):c.153G>A (p.Gln51=) rs72552290
NM_000349.3(STAR):c.178+1G>C rs1554503011
NM_000349.3(STAR):c.178+2dup rs1563268785
NM_000349.3(STAR):c.178+9T>C rs777624416
NM_000349.3(STAR):c.179-2A>G rs1554502986
NM_000349.3(STAR):c.197_198CT[2] (p.Tyr68fs) rs1563268652
NM_000349.3(STAR):c.229C>T (p.Gln77Ter) rs781281145
NM_000349.3(STAR):c.289_291AAG[1] (p.Lys98del) rs146872295
NM_000349.3(STAR):c.296_297AG[1] (p.Gln101fs) rs765904696
NM_000349.3(STAR):c.361C>T (p.Arg121Trp) rs34908868
NM_000349.3(STAR):c.466-11T>A rs1053284504
NM_000349.3(STAR):c.466-5G>A rs375678713
NM_000349.3(STAR):c.484A>C (p.Lys162Gln) rs886062905
NM_000349.3(STAR):c.504C>T (p.His168=) rs147138315
NM_000349.3(STAR):c.505G>A (p.Glu169Lys) rs747169620
NM_000349.3(STAR):c.544C>T (p.Arg182Cys) rs369232492
NM_000349.3(STAR):c.545G>A (p.Arg182His) rs104894086
NM_000349.3(STAR):c.545G>T (p.Arg182Leu) rs104894086
NM_000349.3(STAR):c.559G>A (p.Val187Met) rs104894089
NM_000349.3(STAR):c.562C>T (p.Arg188Cys) rs104894090
NM_000349.3(STAR):c.563G>A (p.Arg188His) rs61736315
NM_000349.3(STAR):c.574C>T (p.Arg192Cys) rs752311616
NM_000349.3(STAR):c.577C>T (p.Arg193Ter) rs387907235
NM_000349.3(STAR):c.629_630del (p.Pro210fs) rs771895449
NM_000349.3(STAR):c.64+1G>T rs765968701
NM_000349.3(STAR):c.64+2T>C rs1298369560
NM_000349.3(STAR):c.650G>C (p.Arg217Thr) rs137852689
NM_000349.3(STAR):c.651-1G>C rs749626865
NM_000349.3(STAR):c.653C>T (p.Ala218Val) rs137852690
NM_000349.3(STAR):c.677del (p.Val226fs) rs1554502732
NM_000349.3(STAR):c.695del (p.Gly232fs) rs757367795
NM_000349.3(STAR):c.714del (p.Lys238fs) rs1417088430
NM_000349.3(STAR):c.716_732del (p.Leu239fs) rs1554502725
NM_000349.3(STAR):c.745-1_757del rs1554502668
NM_000349.3(STAR):c.749G>A (p.Trp250Ter) rs104894087
NM_000349.3(STAR):c.772C>T (p.Gln258Ter) rs104894085
NM_000349.3(STAR):c.779T>C (p.Leu260Pro) rs551783234
NM_000349.3(STAR):c.801dup (p.Ala268fs) rs1554502663
NM_000349.3(STAR):c.811del (p.Leu271fs) rs1350908961
NM_000349.3(STAR):c.814C>T (p.Arg272Cys) rs751759820
NM_000383.3(AIRE):c.-653_-649dup rs1555871683
NM_000383.3(AIRE):c.-656_-655insCCC rs1016179869
NM_000383.3(AIRE):c.1278+1delG rs996389327
NM_000383.4(AIRE):c.-24_1del (p.Met1fs) rs1555871766
NM_000383.4(AIRE):c.1002del (p.Trp335fs) rs769305771
NM_000383.4(AIRE):c.1054_1068del (p.Ala352_Arg356del) rs1481102287
NM_000383.4(AIRE):c.1054_1068dup (p.Ala352_Arg356dup) rs1481102287
NM_000383.4(AIRE):c.1063C>A (p.Pro355Thr) rs1405678537
NM_000383.4(AIRE):c.1065C>T (p.Pro355=) rs201551372
NM_000383.4(AIRE):c.1065_1079del (p.Arg356_Pro360del) rs1555872876
NM_000383.4(AIRE):c.1066dup (p.Arg356fs) rs1555872879
NM_000383.4(AIRE):c.1067G>A (p.Arg356Gln)
NM_000383.4(AIRE):c.1078_1089del (p.Pro360_Glu363del) rs1555872881
NM_000383.4(AIRE):c.1083C>G (p.Pro361=) rs201010030
NM_000383.4(AIRE):c.1083C>T (p.Pro361=) rs201010030
NM_000383.4(AIRE):c.1084G>T (p.Val362Leu) rs763954225
NM_000383.4(AIRE):c.1084del (p.Val362fs) rs1057517254
NM_000383.4(AIRE):c.1095+1G>A rs1022025101
NM_000383.4(AIRE):c.1095+23_1095+64del rs1037154559
NM_000383.4(AIRE):c.1095+2T>C
NM_000383.4(AIRE):c.1096-1G>A rs780906602
NM_000383.4(AIRE):c.1096-9G>C rs113512196
NM_000383.4(AIRE):c.10G>A (p.Asp4Asn)
NM_000383.4(AIRE):c.1103dup (p.Leu370fs) rs387906293
NM_000383.4(AIRE):c.1116_1117del (p.Ala373fs) rs1057516411
NM_000383.4(AIRE):c.1163_1164insA (p.Met388fs) rs386833672
NM_000383.4(AIRE):c.1168A>G (p.Thr390Ala)
NM_000383.4(AIRE):c.1169C>T (p.Thr390Met)
NM_000383.4(AIRE):c.1193del (p.Pro398fs) rs1555872988
NM_000383.4(AIRE):c.1203T>C (p.Pro401=) rs61737072
NM_000383.4(AIRE):c.1207G>A (p.Ala403Thr) rs543891914
NM_000383.4(AIRE):c.1209_1213dup (p.Pro405fs) rs1555872997
NM_000383.4(AIRE):c.1215G>A (p.Pro405=) rs72650676
NM_000383.4(AIRE):c.1243C>T (p.His415Tyr)
NM_000383.4(AIRE):c.1244A>G (p.His415Arg)
NM_000383.4(AIRE):c.1249dup (p.Leu417fs) rs786204567
NM_000383.4(AIRE):c.1265del (p.Pro422fs) rs764878471
NM_000383.4(AIRE):c.1273C>T (p.Gln425Ter)
NM_000383.4(AIRE):c.1279-18C>T rs72650678
NM_000383.4(AIRE):c.1279-2A>G rs1555873087
NM_000383.4(AIRE):c.1296G>A (p.Ala432=) rs144359012
NM_000383.4(AIRE):c.1303G>A (p.Gly435Arg) rs373993732
NM_000383.4(AIRE):c.132+1_132+3delinsCT rs886041293
NM_000383.4(AIRE):c.1327G>A (p.Val443Met)
NM_000383.4(AIRE):c.1334G>A (p.Arg445Gln)
NM_000383.4(AIRE):c.1336T>G (p.Cys446Gly) rs1555873106
NM_000383.4(AIRE):c.1344C>T (p.His448=) rs201131119
NM_000383.4(AIRE):c.1373A>G (p.His458Arg)
NM_000383.4(AIRE):c.137C>T (p.Thr46Met) rs758870962
NM_000383.4(AIRE):c.1399G>A (p.Gly467Arg)
NM_000383.4(AIRE):c.1403C>T (p.Thr468Met)
NM_000383.4(AIRE):c.1404G>A (p.Thr468=) rs7281600
NM_000383.4(AIRE):c.1404G>C (p.Thr468=) rs7281600
NM_000383.4(AIRE):c.1411C>T (p.Arg471Cys) rs74203920
NM_000383.4(AIRE):c.143_145del (p.His48del)
NM_000383.4(AIRE):c.1450G>A (p.Val484Met) rs367966318
NM_000383.4(AIRE):c.1454A>T (p.Glu485Val)
NM_000383.4(AIRE):c.1470dup (p.Ser491fs) rs1555873248
NM_000383.4(AIRE):c.1476C>T (p.Pro492=) rs72650679
NM_000383.4(AIRE):c.1476_1479CGCC[1] (p.Arg494fs) rs1057517072
NM_000383.4(AIRE):c.1477G>A (p.Ala493Thr) rs561652010
NM_000383.4(AIRE):c.1480C>T (p.Arg494Cys) rs1465595959
NM_000383.4(AIRE):c.1483C>T (p.Leu495=) rs376909088
NM_000383.4(AIRE):c.1490del (p.Pro497fs) rs750764323
NM_000383.4(AIRE):c.1505A>T (p.Asp502Val)
NM_000383.4(AIRE):c.1513del (p.Ala505fs) rs387906294
NM_000383.4(AIRE):c.1563C>T (p.Ser521=)
NM_000383.4(AIRE):c.1566+2T>A rs1057516985
NM_000383.4(AIRE):c.1566+2dup rs1057516811
NM_000383.4(AIRE):c.1566+8C>T rs72650680
NM_000383.4(AIRE):c.1567-18C>T rs372108131
NM_000383.4(AIRE):c.1567-1G>A
NM_000383.4(AIRE):c.1567-2A>G rs1555873650
NM_000383.4(AIRE):c.1567-5C>T rs192215705
NM_000383.4(AIRE):c.157G>T (p.Glu53Ter) rs1057516272
NM_000383.4(AIRE):c.1588C>T (p.Gln530Ter) rs1472708073
NM_000383.4(AIRE):c.1612del (p.Arg538fs) rs1555873662
NM_000383.4(AIRE):c.1616C>T (p.Pro539Leu) rs179363889
NM_000383.4(AIRE):c.1637G>C (p.Ter546Ser) rs1568932096
NM_000383.4(AIRE):c.1638A>T (p.Ter546Cys) rs386833673
NM_000383.4(AIRE):c.166C>T (p.Pro56Ser)
NM_000383.4(AIRE):c.173C>A (p.Ala58Asp) rs747941115
NM_000383.4(AIRE):c.1A>G (p.Met1Val) rs121434258
NM_000383.4(AIRE):c.1A>T (p.Met1Leu) rs121434258
NM_000383.4(AIRE):c.205_208dup (p.Asp70fs) rs886041124
NM_000383.4(AIRE):c.20_24del (p.Leu7fs) rs1555871777
NM_000383.4(AIRE):c.21_43dup (p.Arg15delinsHisAlaGlyPheTer)
NM_000383.4(AIRE):c.226G>A (p.Asp76Asn) rs146810389
NM_000383.4(AIRE):c.22C>T (p.Arg8Cys) rs1231469574
NM_000383.4(AIRE):c.232T>C (p.Trp78Arg) rs179363880
NM_000383.4(AIRE):c.233G>A (p.Trp78Ter) rs1057516499
NM_000383.4(AIRE):c.239T>G (p.Val80Gly) rs267606642
NM_000383.4(AIRE):c.247A>G (p.Lys83Glu) rs121434255
NM_000383.4(AIRE):c.254A>G (p.Tyr85Cys) rs179363882
NM_000383.4(AIRE):c.255C>A (p.Tyr85Ter) rs1057516225
NM_000383.4(AIRE):c.260del (p.Leu87fs) rs1057517428
NM_000383.4(AIRE):c.268T>C (p.Tyr90His) rs1555871902
NM_000383.4(AIRE):c.274C>T (p.Arg92Trp) rs140630532
NM_000383.4(AIRE):c.319_321delinsTG (p.Ser107fs) rs1555871928
NM_000383.4(AIRE):c.328del (p.Arg110fs) rs1162316051
NM_000383.4(AIRE):c.342G>T (p.Lys114Asn) rs142788946
NM_000383.4(AIRE):c.347C>T (p.Pro116Leu)
NM_000383.4(AIRE):c.348G>A (p.Pro116=) rs74162060
NM_000383.4(AIRE):c.352G>A (p.Val118Ile)
NM_000383.4(AIRE):c.353T>A (p.Val118Asp)
NM_000383.4(AIRE):c.371C>T (p.Pro124Leu) rs193922417
NM_000383.4(AIRE):c.415C>T (p.Arg139Ter) rs121434256
NM_000383.4(AIRE):c.426G>A (p.Ala142=) rs748305262
NM_000383.4(AIRE):c.43C>T (p.Arg15Cys) rs179363875
NM_000383.4(AIRE):c.457_458delinsC (p.Ser153fs) rs1057516314
NM_000383.4(AIRE):c.463+2T>C rs786204478
NM_000383.4(AIRE):c.463G>A (p.Gly155Ser) rs193922418
NM_000383.4(AIRE):c.464-2A>T rs1032171597
NM_000383.4(AIRE):c.469C>T (p.Gln157Ter) rs1488613451
NM_000383.4(AIRE):c.478G>A (p.Ala160Thr) rs1568926733
NM_000383.4(AIRE):c.485C>T (p.Pro162Leu)
NM_000383.4(AIRE):c.489dup (p.Lys164fs)
NM_000383.4(AIRE):c.497C>T (p.Pro166Leu) rs11910214
NM_000383.4(AIRE):c.512_516dup (p.Gln173fs) rs1555872060
NM_000383.4(AIRE):c.517C>T (p.Gln173Ter) rs1057517241
NM_000383.4(AIRE):c.520C>T (p.Arg174Cys)
NM_000383.4(AIRE):c.538+3G>A
NM_000383.4(AIRE):c.538+42del rs3214074
NM_000383.4(AIRE):c.538G>A (p.Gly180Arg)
NM_000383.4(AIRE):c.548C>A (p.Thr183Asn) rs34219046
NM_000383.4(AIRE):c.55G>A (p.Ala19Thr) rs1555871798
NM_000383.4(AIRE):c.560C>T (p.Ser187Leu)
NM_000383.4(AIRE):c.581T>C (p.Met194Thr) rs1351412367
NM_000383.4(AIRE):c.590G>C (p.Gly197Ala) rs1185406745
NM_000383.4(AIRE):c.595G>A (p.Val199Ile) rs74162061
NM_000383.4(AIRE):c.599C>T (p.Pro200Leu)
NM_000383.4(AIRE):c.600G>A (p.Pro200=) rs754331960
NM_000383.4(AIRE):c.62C>T (p.Ala21Val) rs179363886
NM_000383.4(AIRE):c.63C>T (p.Ala21=) rs371796437
NM_000383.4(AIRE):c.652+14C>T rs41277546
NM_000383.4(AIRE):c.652+1G>T rs199612115
NM_000383.4(AIRE):c.652+2T>C rs1555872272
NM_000383.4(AIRE):c.653-5C>T rs771182213
NM_000383.4(AIRE):c.653-9T>A
NM_000383.4(AIRE):c.655G>A (p.Gly219Ser) rs139620961
NM_000383.4(AIRE):c.659C>T (p.Ser220Phe)
NM_000383.4(AIRE):c.682G>T (p.Gly228Trp) rs121434257
NM_000383.4(AIRE):c.717C>T (p.Ser239=) rs149130190
NM_000383.4(AIRE):c.755C>T (p.Pro252Leu) rs34397615
NM_000383.4(AIRE):c.766G>A (p.Val256Ile)
NM_000383.4(AIRE):c.769C>T (p.Arg257Ter) rs121434254
NM_000383.4(AIRE):c.794C>T (p.Ala265Val)
NM_000383.4(AIRE):c.798+1G>A rs138489664
NM_000383.4(AIRE):c.798+1G>C rs138489664
NM_000383.4(AIRE):c.798+1G>T rs138489664
NM_000383.4(AIRE):c.798+5G>A rs1490186498
NM_000383.4(AIRE):c.798C>T (p.Pro266=) rs41277550
NM_000383.4(AIRE):c.809_810del (p.Glu270fs) rs1057517268
NM_000383.4(AIRE):c.816G>T (p.Arg272Ser) rs1568927979
NM_000383.4(AIRE):c.83T>C (p.Leu28Pro) rs179363878
NM_000383.4(AIRE):c.860G>A (p.Ser287Asn)
NM_000383.4(AIRE):c.880-451G>A rs267606153
NM_000383.4(AIRE):c.892G>A (p.Glu298Lys) rs763636007
NM_000383.4(AIRE):c.925A>G (p.Ile309Val) rs936714310
NM_000383.4(AIRE):c.931del (p.Cys311fs) rs1555872755
NM_000383.4(AIRE):c.932G>A (p.Cys311Tyr) rs386833674
NM_000383.4(AIRE):c.947G>A (p.Arg316Gln)
NM_000383.4(AIRE):c.958del (p.Leu320fs) rs1568928525
NM_000383.4(AIRE):c.967_979del (p.Leu323fs) rs386833675
NM_000383.4(AIRE):c.977del (p.Pro326fs) rs1057517011
NM_000383.4(AIRE):c.983G>A (p.Arg328Gln)
NM_000383.4(AIRE):c.99T>C (p.Ala33=) rs3746964
NM_000466.3(PEX1):c.1072_1073GA[1] (p.Lys359fs) rs1057517488
NM_000466.3(PEX1):c.1076del (p.Lys359fs) rs1057517465
NM_000466.3(PEX1):c.1108del (p.Ile370fs) rs61750406
NM_000466.3(PEX1):c.1155del (p.Gln385_Val386insTer) rs1057517520
NM_000466.3(PEX1):c.1249G>A (p.Asp417Asn) rs143273433
NM_000466.3(PEX1):c.130-1G>C rs1028247729
NM_000466.3(PEX1):c.1522dup (p.Glu508fs) rs1057517463
NM_000466.3(PEX1):c.1527del (p.Glu510fs) rs1057517497
NM_000466.3(PEX1):c.1528G>T (p.Glu510Ter) rs754983126
NM_000466.3(PEX1):c.1579A>G (p.Thr527Ala) rs144942544
NM_000466.3(PEX1):c.1587+1G>A rs1057517469
NM_000466.3(PEX1):c.1670+1G>A rs1057517490
NM_000466.3(PEX1):c.1670+1G>T rs1057517490
NM_000466.3(PEX1):c.1765G>T (p.Gly589Ter) rs1057517489
NM_000466.3(PEX1):c.1842del (p.Glu615fs) rs267608176
NM_000466.3(PEX1):c.1908del (p.Arg636fs) rs1057517478
NM_000466.3(PEX1):c.1921C>T (p.Gln641Ter) rs1057517464
NM_000466.3(PEX1):c.1926_1927delinsC (p.Lys642fs) rs1057517529
NM_000466.3(PEX1):c.1964_1970dup (p.Val658fs) rs1057517486
NM_000466.3(PEX1):c.1991T>C (p.Leu664Pro) rs121434455
NM_000466.3(PEX1):c.1A>T (p.Met1Leu) rs1057517501
NM_000466.3(PEX1):c.2032_2033CA[1] (p.His678fs) rs61750412
NM_000466.3(PEX1):c.2137C>T (p.Gln713Ter) rs1057517468
NM_000466.3(PEX1):c.2162_2166del (p.Leu721fs) rs1057517499
NM_000466.3(PEX1):c.2528G>A (p.Gly843Asp) rs61750420
NM_000466.3(PEX1):c.254G>A (p.Gly85Glu) rs771224088
NM_000466.3(PEX1):c.2617C>T (p.Gln873Ter) rs1057517470
NM_000466.3(PEX1):c.2686C>T (p.Arg896Ter) rs1057517485
NM_000466.3(PEX1):c.2723del (p.Pro908fs) rs1057517503
NM_000466.3(PEX1):c.2750C>T (p.Ala917Val) rs371327573
NM_000466.3(PEX1):c.2783+6T>C
NM_000466.3(PEX1):c.2798dup (p.Pro934fs) rs1057517484
NM_000466.3(PEX1):c.2843G>A (p.Arg948Gln) rs535271603
NM_000466.3(PEX1):c.2859dup (p.Thr954fs) rs1057517472
NM_000466.3(PEX1):c.2875C>T (p.Arg959Ter) rs1057517481
NM_000466.3(PEX1):c.2876G>C (p.Arg959Pro)
NM_000466.3(PEX1):c.2922del (p.Leu974fs) rs762324548
NM_000466.3(PEX1):c.2927-2A>G rs1057517531
NM_000466.3(PEX1):c.2T>C (p.Met1Thr) rs766020928
NM_000466.3(PEX1):c.2T>G (p.Met1Arg) rs766020928
NM_000466.3(PEX1):c.3208-1G>A rs1057517518
NM_000466.3(PEX1):c.3237_3238del (p.Leu1081fs) rs1057517509
NM_000466.3(PEX1):c.3379dup (p.Arg1127fs) rs794729652
NM_000466.3(PEX1):c.3451_3452CT[2] (p.Ser1152fs) rs759183382
NM_000466.3(PEX1):c.348G>A (p.Trp116Ter) rs1057517487
NM_000466.3(PEX1):c.3503A>G (p.Asp1168Gly) rs182452430
NM_000466.3(PEX1):c.3547G>T (p.Glu1183Ter) rs1057517480
NM_000466.3(PEX1):c.3574C>T (p.Gln1192Ter) rs1057517467
NM_000466.3(PEX1):c.358-1G>T rs1057517479
NM_000466.3(PEX1):c.358-2A>G rs1057517500
NM_000466.3(PEX1):c.3756T>A (p.Asn1252Lys) rs553001596
NM_000466.3(PEX1):c.431dup (p.Val145fs) rs1057517506
NM_000466.3(PEX1):c.547C>T (p.Arg183Ter) rs149806989
NM_000466.3(PEX1):c.665C>T (p.Thr222Ile) rs773922257
NM_000466.3(PEX1):c.734del (p.Leu245fs) rs1057517522
NM_000466.3(PEX1):c.888_889TA[6] (p.Asn299delinsIleTer) rs1057517505
NM_000475.5(NR0B1):c.0_1168+260del
NM_000475.5(NR0B1):c.1094T>C (p.Leu365Pro) rs386134262
NM_000475.5(NR0B1):c.109C>T (p.Gln37Ter) rs104894908
NM_000475.5(NR0B1):c.1107G>A (p.Trp369Ter) rs104894886
NM_000475.5(NR0B1):c.1123_1124insT (p.Thr375fs) rs1555972957
NM_000475.5(NR0B1):c.1138T>G (p.Tyr380Asp) rs104894900
NM_000475.5(NR0B1):c.1141C>T (p.Leu381Phe) rs386134263
NM_000475.5(NR0B1):c.1142T>A (p.Leu381His) rs104894899
NM_000475.5(NR0B1):c.1142T>C (p.Leu381Pro) rs104894899
NM_000475.5(NR0B1):c.1146G>T (p.Lys382Asn) rs104894896
NM_000475.5(NR0B1):c.1168+1_1168+20del rs1555972943
NM_000475.5(NR0B1):c.1169-112_*17delinsTG rs1555972632
NM_000475.5(NR0B1):c.1169-1G>A rs1555972666
NM_000475.5(NR0B1):c.116G>A (p.Trp39Ter) rs1569269179
NM_000475.5(NR0B1):c.1183C>T (p.Gln395Ter) rs104894894
NM_000475.5(NR0B1):c.1197C>A (p.Tyr399Ter) rs104894906
NM_000475.5(NR0B1):c.1231_1234del (p.Leu411fs) rs1569268070
NM_000475.5(NR0B1):c.1234_1235del (p.Leu411_Ser412insTer) rs1555972655
NM_000475.5(NR0B1):c.1267del (p.His423fs) rs1569268048
NM_000475.5(NR0B1):c.1274G>T (p.Arg425Ile) rs387907373
NM_000475.5(NR0B1):c.1316T>G (p.Ile439Ser) rs104894897
NM_000475.5(NR0B1):c.1319A>T (p.Asn440Ile) rs28935481
NM_000475.5(NR0B1):c.1340T>C (p.Leu447Pro) rs1555972641
NM_000475.5(NR0B1):c.1362_1363CA[1] (p.Thr455fs) rs1555972640
NM_000475.5(NR0B1):c.273C>A (p.Tyr91Ter) rs104894892
NM_000475.5(NR0B1):c.277del (p.Ala93fs) rs1555973189
NM_000475.5(NR0B1):c.315G>A (p.Trp105Ter) rs132630327
NM_000475.5(NR0B1):c.327C>A (p.Cys109Ter) rs1555973172
NM_000475.5(NR0B1):c.376G>A (p.Val126Met) rs193205940
NM_000475.5(NR0B1):c.501del (p.Gly169fs) rs1569268976
NM_000475.5(NR0B1):c.513G>A (p.Trp171Ter) rs104894891
NM_000475.5(NR0B1):c.515G>A (p.Trp172Ter) rs1555973132
NM_000475.5(NR0B1):c.516G>A (p.Trp172Ter) rs1555973131
NM_000475.5(NR0B1):c.528C>G (p.Tyr176Ter)
NM_000475.5(NR0B1):c.543del (p.Gly183fs) rs1555973120
NM_000475.5(NR0B1):c.545_546insCCCA (p.Gly183fs) rs1555973119
NM_000475.5(NR0B1):c.548dup (p.Gly183_Lys184insTer) rs1555973117
NM_000475.5(NR0B1):c.551_552del (p.Lys184fs) rs1555973115
NM_000475.5(NR0B1):c.552del (p.Glu185fs) rs1555973115
NM_000475.5(NR0B1):c.591C>A (p.Tyr197Ter) rs104894898
NM_000475.5(NR0B1):c.638_654delinsCATC (p.Leu213fs) rs1555973091
NM_000475.5(NR0B1):c.652dup (p.Thr218fs) rs1555973092
NM_000475.5(NR0B1):c.704G>A (p.Trp235Ter) rs104894889
NM_000475.5(NR0B1):c.708G>A (p.Trp236Ter) rs1131691564
NM_000475.5(NR0B1):c.754del (p.Gln252fs) rs1555973063
NM_000475.5(NR0B1):c.765C>A (p.Cys255Ter) rs1311271225
NM_000475.5(NR0B1):c.773C>A (p.Ala258Asp) rs1555973058
NM_000475.5(NR0B1):c.788T>A (p.Leu263Ter) rs104894887
NM_000475.5(NR0B1):c.800G>C (p.Arg267Pro) rs104894888
NM_000475.5(NR0B1):c.806T>A (p.Val269Asp) rs1555973045
NM_000475.5(NR0B1):c.813C>G (p.Tyr271Ter) rs104894895
NM_000475.5(NR0B1):c.822C>A (p.Cys274Ter) rs753734546
NM_000475.5(NR0B1):c.844C>T (p.Gln282Ter) rs1555973031
NM_000475.5(NR0B1):c.847C>T (p.Gln283Ter) rs104894890
NM_000475.5(NR0B1):c.848A>C (p.Gln283Pro) rs1060499835
NM_000475.5(NR0B1):c.851_856TGGTGC[1] (p.284_285LV[1])
NM_000475.5(NR0B1):c.871T>C (p.Trp291Arg) rs1555973021
NM_000475.5(NR0B1):c.872G>C (p.Trp291Ser) rs1489209061
NM_000475.5(NR0B1):c.873G>C (p.Trp291Cys) rs28935482
NM_000475.5(NR0B1):c.890T>C (p.Leu297Pro) rs104894907
NM_000475.5(NR0B1):c.901C>T (p.Gln301Ter) rs1555973010
NM_000475.5(NR0B1):c.919G>T (p.Glu307Ter) rs1324519932
NM_000475.5(NR0B1):c.952C>T (p.Gln318Ter) rs1555972994
NM_000497.3(CYP11B1):c.*1020C>T rs5017238
NM_000497.3(CYP11B1):c.*1042A>G rs7003319
NM_000497.3(CYP11B1):c.*1076C>T rs61752806
NM_000497.3(CYP11B1):c.*1138delA rs148110533
NM_000497.3(CYP11B1):c.*1164G>A rs886062735
NM_000497.3(CYP11B1):c.*1209C>T rs757505651
NM_000497.3(CYP11B1):c.*1258G>A rs61752808
NM_000497.3(CYP11B1):c.*1288A>G rs61752809
NM_000497.3(CYP11B1):c.*132T>C rs5297
NM_000497.3(CYP11B1):c.*1358T>C rs886062734
NM_000497.3(CYP11B1):c.*1417G>A rs61752812
NM_000497.3(CYP11B1):c.*1435T>C rs551125657
NM_000497.3(CYP11B1):c.*1499C>T rs1134095
NM_000497.3(CYP11B1):c.*1512G>A rs61752814
NM_000497.3(CYP11B1):c.*1555del rs548944247
NM_000497.3(CYP11B1):c.*1566G>T rs1134096
NM_000497.3(CYP11B1):c.*1590G>C rs886062733
NM_000497.3(CYP11B1):c.*1622C>T rs543935807
NM_000497.3(CYP11B1):c.*1770A>T rs369448045
NM_000497.3(CYP11B1):c.*1852T>G rs4736312
NM_000497.3(CYP11B1):c.*1871T>A rs61752818
NM_000497.3(CYP11B1):c.*193A>T rs61752798
NM_000497.3(CYP11B1):c.*245C>G rs538608688
NM_000497.3(CYP11B1):c.*318A>G rs5299
NM_000497.3(CYP11B1):c.*400C>T rs61752801
NM_000497.3(CYP11B1):c.*468C>T rs114832894
NM_000497.3(CYP11B1):c.*471A>C rs12543598
NM_000497.3(CYP11B1):c.*485C>G rs886062737
NM_000497.3(CYP11B1):c.*495C>T rs886062736
NM_000497.3(CYP11B1):c.*516A>G rs5301
NM_000497.3(CYP11B1):c.*613A>G rs1137480
NM_000497.3(CYP11B1):c.*634G>A rs1137481
NM_000497.3(CYP11B1):c.*670A>C rs879537131
NM_000497.3(CYP11B1):c.*694T>C rs5303
NM_000497.3(CYP11B1):c.*718T>G rs189479208
NM_000497.3(CYP11B1):c.*737C>T rs748684062
NM_000497.3(CYP11B1):c.*738G>A rs5304
NM_000497.3(CYP11B1):c.*848C>T rs149520110
NM_000497.3(CYP11B1):c.*857T>C rs370725779
NM_000497.3(CYP11B1):c.*901G>A rs748103274
NM_000497.3(CYP11B1):c.*923G>C rs61752805
NM_000497.3(CYP11B1):c.1003A>G (p.Asn335Asp) rs61752766
NM_000497.3(CYP11B1):c.1014G>A (p.Gln338=) rs151335623
NM_000497.3(CYP11B1):c.1015G>A (p.Ala339Thr) rs193922534
NM_000497.3(CYP11B1):c.1015_1016delinsAT (p.Ala339Ile) rs193922535
NM_000497.3(CYP11B1):c.1016C>T (p.Ala339Val) rs193922536
NM_000497.3(CYP11B1):c.1021C>A (p.Arg341Ser) rs372115638
NM_000497.3(CYP11B1):c.1027G>A (p.Glu343Lys) rs1554652796
NM_000497.3(CYP11B1):c.1042G>A (p.Ala348Thr) rs6407
NM_000497.3(CYP11B1):c.104T>C (p.Val35Ala) rs201951316
NM_000497.3(CYP11B1):c.1066C>T (p.Gln356Ter) rs146124466
NM_000497.3(CYP11B1):c.1086G>C (p.Leu362=) rs6403
NM_000497.3(CYP11B1):c.1090T>C (p.Leu364=) rs754660381
NM_000497.3(CYP11B1):c.1098T>G (p.Arg366=) rs61752769
NM_000497.3(CYP11B1):c.1103C>A (p.Ala368Asp) rs104894071
NM_000497.3(CYP11B1):c.1112A>G (p.Glu371Gly) rs368944209
NM_000497.3(CYP11B1):c.1120C>A (p.Arg374=) rs61752786
NM_000497.3(CYP11B1):c.1120C>T (p.Arg374Trp) rs61752786
NM_000497.3(CYP11B1):c.1121G>A (p.Arg374Gln) rs104894062
NM_000497.3(CYP11B1):c.1122-12C>T rs193922537
NM_000497.3(CYP11B1):c.1122-20A>G rs61752794
NM_000497.3(CYP11B1):c.1128C>A (p.Tyr376Ter) rs760880418
NM_000497.3(CYP11B1):c.1144C>T (p.Leu382=) rs5293
NM_000497.3(CYP11B1):c.1145T>G (p.Leu382Arg) rs1412048304
NM_000497.3(CYP11B1):c.1151G>A (p.Arg384Gln) rs764598023
NM_000497.3(CYP11B1):c.1157C>A (p.Ala386Glu) rs4541
NM_000497.3(CYP11B1):c.1157C>T (p.Ala386Val) rs4541
NM_000497.3(CYP11B1):c.1159dup (p.Ser387fs) rs1379392398
NM_000497.3(CYP11B1):c.1181del (p.Asn394fs) rs1256580853
NM_000497.3(CYP11B1):c.1205T>C (p.Leu402Ser) rs886062738
NM_000497.3(CYP11B1):c.1205del (p.Leu402fs) rs1554652650
NM_000497.3(CYP11B1):c.124C>T (p.Pro42Ser) rs104894069
NM_000497.3(CYP11B1):c.125C>T (p.Pro42Leu) rs193922538
NM_000497.3(CYP11B1):c.1269T>G (p.Tyr423Ter) rs267606755
NM_000497.3(CYP11B1):c.1280G>A (p.Arg427His) rs754432887
NM_000497.3(CYP11B1):c.128G>A (p.Arg43Gln) rs4534
NM_000497.3(CYP11B1):c.1331G>A (p.Gly444Asp) rs779103938
NM_000497.3(CYP11B1):c.1343G>A (p.Arg448His) rs28934586
NM_000497.3(CYP11B1):c.1353T>C (p.Leu451=) rs5316
NM_000497.3(CYP11B1):c.1361G>A (p.Arg454His) rs367634557
NM_000497.3(CYP11B1):c.1398+2T>C rs577022490
NM_000497.3(CYP11B1):c.1399-14G>C rs5295
NM_000497.3(CYP11B1):c.1451T>A (p.Val484Asp) rs374517238
NM_000497.3(CYP11B1):c.147del (p.Trp49fs) rs748867146
NM_000497.3(CYP11B1):c.1486del (p.Leu496fs) rs1554652528
NM_000497.3(CYP11B1):c.1488C>T (p.Leu496=) rs776766470
NM_000497.3(CYP11B1):c.168G>A (p.Trp56Ter) rs1383321200
NM_000497.3(CYP11B1):c.187G>C (p.Asp63His) rs5282
NM_000497.3(CYP11B1):c.217C>T (p.Gln73Ter) rs1554653675
NM_000497.3(CYP11B1):c.225A>G (p.Leu75=) rs6410
NM_000497.3(CYP11B1):c.235T>A (p.Phe79Ile) rs1489638195
NM_000497.3(CYP11B1):c.239+13C>A rs6402
NM_000497.3(CYP11B1):c.243C>T (p.Tyr81=) rs9657022
NM_000497.3(CYP11B1):c.246C>T (p.Asp82=) rs5283
NM_000497.3(CYP11B1):c.264G>A (p.Met88Ile) rs193922539
NM_000497.3(CYP11B1):c.281C>T (p.Pro94Leu) rs104894070
NM_000497.3(CYP11B1):c.304C>T (p.Gln102Ter) rs1554653551
NM_000497.3(CYP11B1):c.317_344del (p.Leu106fs) rs764418169
NM_000497.3(CYP11B1):c.346T>G (p.Trp116Gly) rs772733691
NM_000497.3(CYP11B1):c.347G>A (p.Trp116Ter) rs104894066
NM_000497.3(CYP11B1):c.372del (p.His125fs) rs1554653520
NM_000497.3(CYP11B1):c.374A>G (p.His125Arg) rs757389720
NM_000497.3(CYP11B1):c.375C>G (p.His125Gln) rs201137503
NM_000497.3(CYP11B1):c.385G>A (p.Val129Met) rs377423817
NM_000497.3(CYP11B1):c.395+1G>C rs1554653514
NM_000497.3(CYP11B1):c.397A>C (p.Asn133His) rs104894067
NM_000497.3(CYP11B1):c.412C>T (p.Arg138Cys) rs764251434
NM_000497.3(CYP11B1):c.413G>A (p.Arg138His) rs193922540
NM_000497.3(CYP11B1):c.422G>A (p.Arg141Gln) rs267601810
NM_000497.3(CYP11B1):c.427C>T (p.Arg143Trp) rs140336749
NM_000497.3(CYP11B1):c.446T>C (p.Leu149Pro) rs1554653200
NM_000497.3(CYP11B1):c.449C>T (p.Ser150Leu) rs142484434
NM_000497.3(CYP11B1):c.45G>A (p.Trp15Ter) rs1554653714
NM_000497.3(CYP11B1):c.473T>C (p.Leu158Pro) rs1554653191
NM_000497.3(CYP11B1):c.494C>A (p.Ala165Asp) rs1554653185
NM_000497.3(CYP11B1):c.517_519AAG[2] (p.Lys175del) rs535861895
NM_000497.3(CYP11B1):c.554C>G (p.Thr185Ser) rs566921201
NM_000497.3(CYP11B1):c.55C>T (p.Gln19Ter) rs763195324
NM_000497.3(CYP11B1):c.595+12G>A rs6387
NM_000497.3(CYP11B1):c.595+1G>A rs1264073726
NM_000497.3(CYP11B1):c.606G>A (p.Leu202=) rs61751154
NM_000497.3(CYP11B1):c.632_640del (p.Leu211_Gly213del) rs1554653044
NM_000497.3(CYP11B1):c.740G>A (p.Trp247Ter) rs866430018
NM_000497.3(CYP11B1):c.743C>T (p.Thr248Ile) rs34620645
NM_000497.3(CYP11B1):c.748C>T (p.Pro250Ser) rs753471858
NM_000497.3(CYP11B1):c.779G>A (p.Trp260Ter) rs1554652999
NM_000497.3(CYP11B1):c.780G>A (p.Trp260Ter) rs1554652998
NM_000497.3(CYP11B1):c.799+1G>C rs1554652990
NM_000497.3(CYP11B1):c.799+2T>C rs193922541
NM_000497.3(CYP11B1):c.799+5G>C rs193922542
NM_000497.3(CYP11B1):c.800-14C>T rs4535
NM_000497.3(CYP11B1):c.823T>C (p.Tyr275His) rs141368413
NM_000497.3(CYP11B1):c.825T>C (p.Tyr275=) rs5290
NM_000497.3(CYP11B1):c.841_842ins11 (p.?) rs775128501
NM_000497.3(CYP11B1):c.873G>A (p.Ala291=) rs34570566
NM_000497.3(CYP11B1):c.896T>C (p.Leu299Pro) rs387907573
NM_000497.3(CYP11B1):c.917C>T (p.Ala306Val) rs387907572
NM_000497.3(CYP11B1):c.928G>A (p.Glu310Lys) rs387907574
NM_000497.3(CYP11B1):c.930A>G (p.Glu310=) rs148707144
NM_000497.3(CYP11B1):c.953C>G (p.Thr318Arg) rs104894061
NM_000497.3(CYP11B1):c.953C>T (p.Thr318Met) rs104894061
NM_000497.3(CYP11B1):c.954+9G>C rs6411
NM_000497.3(CYP11B1):c.954G>A (p.Thr318=) rs753774484
NM_000497.3(CYP11B1):c.955-15_955-1del rs1554652823
NM_000497.3(CYP11B1):c.955-1G>A rs1456715954
NM_000497.3(CYP11B1):c.956C>T (p.Thr319Met) rs104894068
NM_000497.3(CYP11B1):c.992C>T (p.Ala331Val) rs1326688256
NM_000497.3(CYP11B1):c.995G>A (p.Arg332Gln) rs149881706
NM_000498.3(CYP11B2):c.*1047C>T rs886062739
NM_000498.3(CYP11B2):c.*1178T>C rs3802228
NM_000498.3(CYP11B2):c.*1246_*1248del rs576148290
NM_000498.3(CYP11B2):c.*204C>G rs773811282
NM_000498.3(CYP11B2):c.*239T>C rs9297975
NM_000498.3(CYP11B2):c.*292_*294dup rs3839864
NM_000498.3(CYP11B2):c.*299G>A rs528171695
NM_000498.3(CYP11B2):c.*431A>C rs886062742
NM_000498.3(CYP11B2):c.*504C>T rs201487778
NM_000498.3(CYP11B2):c.*532G>T rs3802230
NM_000498.3(CYP11B2):c.*537C>T rs72499120
NM_000498.3(CYP11B2):c.*566C>T rs375938097
NM_000498.3(CYP11B2):c.*579T>C rs559136479
NM_000498.3(CYP11B2):c.*735G>A rs28491316
NM_000498.3(CYP11B2):c.*743C>T rs886062741
NM_000498.3(CYP11B2):c.*744G>A rs28390200
NM_000498.3(CYP11B2):c.*746G>A rs570202161
NM_000498.3(CYP11B2):c.*789G>A rs61763990
NM_000498.3(CYP11B2):c.*81G>A rs3097
NM_000498.3(CYP11B2):c.*972C>G rs886062740
NM_000498.3(CYP11B2):c.-14G>C rs6440
NM_000498.3(CYP11B2):c.1006G>A (p.Val336Met) rs373369254
NM_000498.3(CYP11B2):c.1016T>A (p.Ile339Asn) rs4544
NM_000498.3(CYP11B2):c.1016T>C (p.Ile339Thr) rs4544
NM_000498.3(CYP11B2):c.1021C>T (p.Arg341Cys) rs562670189
NM_000498.3(CYP11B2):c.1039G>A (p.Ala347Thr) rs746708275
NM_000498.3(CYP11B2):c.1080C>T (p.Thr360=) rs142179598
NM_000498.3(CYP11B2):c.1098G>T (p.Arg366=) rs61757297
NM_000498.3(CYP11B2):c.1101G>A (p.Ala367=) rs371450047
NM_000498.3(CYP11B2):c.111G>A (p.Pro37=) rs5281
NM_000498.3(CYP11B2):c.1120C>A (p.Arg374=) rs4538
NM_000498.3(CYP11B2):c.1144T>C (p.Leu382=) rs61757295
NM_000498.3(CYP11B2):c.1157T>C (p.Val386Ala) rs61757294
NM_000498.3(CYP11B2):c.1170G>A (p.Leu390=) rs5313
NM_000498.3(CYP11B2):c.1303G>A (p.Gly435Ser) rs4545
NM_000498.3(CYP11B2):c.1382T>C (p.Leu461Pro) rs72554627
NM_000498.3(CYP11B2):c.1492A>G (p.Thr498Ala) rs72554626
NM_000498.3(CYP11B2):c.256C>G (p.Pro86Ala) rs200283987
NM_000498.3(CYP11B2):c.352G>A (p.Ala118Thr) rs372556807
NM_000498.3(CYP11B2):c.395+10G>A rs193166276
NM_000498.3(CYP11B2):c.424T>C (p.Leu142=) rs199988205
NM_000498.3(CYP11B2):c.476C>T (p.Pro159Leu) rs563073392
NM_000498.3(CYP11B2):c.477G>A (p.Pro159=) rs375242946
NM_000498.3(CYP11B2):c.504C>T (p.Phe168=) rs4546
NM_000498.3(CYP11B2):c.518A>G (p.Lys173Arg) rs4539
NM_000498.3(CYP11B2):c.529C>T (p.Leu177=) rs577489337
NM_000498.3(CYP11B2):c.554C>T (p.Thr185Ile) rs121912978
NM_000498.3(CYP11B2):c.591A>G (p.Ile197Met) rs886062744
NM_000498.3(CYP11B2):c.595+14G>A rs5307
NM_000498.3(CYP11B2):c.595+15G>T rs886062743
NM_000498.3(CYP11B2):c.606A>G (p.Leu202=) rs113284476
NM_000498.3(CYP11B2):c.640C>G (p.His214Asp) rs551933154
NM_000498.3(CYP11B2):c.674A>G (p.His225Arg) rs144140791
NM_000498.3(CYP11B2):c.752A>G (p.Lys251Arg) rs752962897
NM_000498.3(CYP11B2):c.763G>T (p.Glu255Ter) rs121912977
NM_000498.3(CYP11B2):c.800-14T>C rs563246146
NM_000498.3(CYP11B2):c.814C>T (p.Gln272Ter) rs121912979
NM_000498.3(CYP11B2):c.842A>G (p.Asn281Ser) rs4537
NM_000498.3(CYP11B2):c.844C>T (p.Arg282Cys) rs774989997
NM_000498.3(CYP11B2):c.867C>T (p.Ile289=) rs547347545
NM_000498.3(CYP11B2):c.873G>A (p.Ala291=) rs4536
NM_000498.3(CYP11B2):c.891G>A (p.Ala297=) rs4543
NM_000498.3(CYP11B2):c.89G>A (p.Arg30Gln) rs6441
NM_000498.3(CYP11B2):c.945C>T (p.Ser315=) rs759178574
NM_000498.3(CYP11B2):c.959C>T (p.Ala320Val) rs201830462
NM_000498.3(CYP11B2):c.[541C>T;1157T>C]
NM_000498.3(CYP11B2):c.[594A>C;1157T>C]
NM_000500.5(CYP21A2):c.[701T>A;713T>A;719T>A]
NM_000500.5:c.293-13A>G(659A>G)
NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) rs387906510
NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter) rs7755898
NM_000500.7(CYP21A2):c.[377C>G];[518T>A]
NM_000500.7(CYP21A2):c.[518T>A];[830_841delTCCTGGAAGGGC]
NM_000500.7(CYP21A2):c.[710T>A;713T>A;719T>A]
NM_000500.7(CYP21A2):c.[844G>T;920_921insT;955C>T;1069C>T]
NM_000500.7:c.*28697405C>T
NM_000500.7:c.*28697972C>G
NM_000500.7:c.*28698024_*28698031del8
NM_000500.7:c.*28698317T>A
NM_000500.7:c.*28699001G>T
NM_000500.7:c.*28699080dupT
NM_000500.7:c.*28699312C>T
NM_000500.7:c.*28699426C>T
NM_000500.9(CYP21A2):c.*13G>A
NM_000500.9(CYP21A2):c.1069C>T (p.Arg357Trp) rs7769409
NM_000500.9(CYP21A2):c.1118G>A (p.Ser373Asn) rs1554305880
NM_000500.9(CYP21A2):c.1136T>A (p.Ile379Asn) rs1429901248
NM_000500.9(CYP21A2):c.1174G>A (p.Ala392Thr) rs202242769
NM_000500.9(CYP21A2):c.1217G>A (p.Trp406Ter) rs151344503
NM_000500.9(CYP21A2):c.1287C>T (p.Cys429=) rs193922543
NM_000500.9(CYP21A2):c.1360C>T (p.Pro454Ser) rs6445
NM_000500.9(CYP21A2):c.1447C>T (p.Pro483Ser)
NM_000500.9(CYP21A2):c.1451_1452delinsC (p.Arg484fs) rs397509367
NM_000500.9(CYP21A2):c.1482C>T (p.Ser494=) rs397515529
NM_000500.9(CYP21A2):c.159_160del (p.Gln54fs) rs886038207
NM_000500.9(CYP21A2):c.17_19TGC[6] (p.Leu10dup) rs61338903
NM_000500.9(CYP21A2):c.188A>T (p.His63Leu) rs9378252
NM_000500.9(CYP21A2):c.274A>G (p.Arg92Gly) rs1554304513
NM_000500.9(CYP21A2):c.293-13C>G rs6467
NM_000500.9(CYP21A2):c.293-13C>T rs6467
NM_000500.9(CYP21A2):c.293-7C>G rs193922544
NM_000500.9(CYP21A2):c.308G>A (p.Arg103Lys) rs6474
NM_000500.9(CYP21A2):c.327C>G (p.Ser109=) rs193922545
NM_000500.9(CYP21A2):c.342C>T (p.Ser114=) rs193922546
NM_000500.9(CYP21A2):c.361A>C (p.Lys121Gln) rs267606757
NM_000500.9(CYP21A2):c.518T>A (p.Ile173Asn) rs6475
NM_000500.9(CYP21A2):c.552C>G (p.Asp184Glu) rs397515531
NM_000500.9(CYP21A2):c.710_719delinsACGAGGAGAA (p.Ile237_Met240delinsAsnGluGluLys) rs786204728
NM_000500.9(CYP21A2):c.738+12_738+13inv rs71552100
NM_000500.9(CYP21A2):c.740del (p.Glu247fs) rs750499484
NM_000500.9(CYP21A2):c.747C>G (p.Leu249=) rs6477
NM_000500.9(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000500.9(CYP21A2):c.844G>C (p.Val282Leu) rs6471
NM_000500.9(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000500.9(CYP21A2):c.874G>A (p.Gly292Ser) rs201552310
NM_000500.9(CYP21A2):c.923dup (p.Leu308fs) rs267606756
NM_000500.9(CYP21A2):c.92C>T (p.Pro31Leu) rs9378251
NM_000529.2(MC2R):c.221G>T (p.Ser74Ile) rs104894658
NM_000529.2(MC2R):c.319G>A (p.Asp107Asn) rs104894661
NM_000529.2(MC2R):c.360C>G (p.Ser120Arg) rs104894656
NM_000529.2(MC2R):c.376G>T (p.Ala126Ser) rs267607231
NM_000529.2(MC2R):c.382C>T (p.Arg128Cys) rs104894657
NM_000529.2(MC2R):c.409C>T (p.Arg137Trp) rs104894660
NM_000529.2(MC2R):c.424G>T (p.Val142Leu) rs199950178
NM_000529.2(MC2R):c.437G>A (p.Arg146His) rs758709668
NM_000529.2(MC2R):c.459dup (p.Ile154fs) rs1555619430
NM_000529.2(MC2R):c.601C>T (p.Arg201Ter) rs104894659
NM_000529.2(MC2R):c.674T>G (p.Leu225Arg) rs1555619377
NM_000529.2(MC2R):c.702del (p.Phe235fs) rs1555619372
NM_000529.2(MC2R):c.752G>T (p.Cys251Phe) rs104894662
NM_000529.2(MC2R):c.761A>G (p.Tyr254Cys) rs28940892
NM_000546.5(TP53):c.*1070C>T rs114831472
NM_000546.5(TP53):c.*1160T>G rs886053499
NM_000546.5(TP53):c.*1175A>C rs78378222
NM_000546.5(TP53):c.*205G>A rs16956880
NM_000546.5(TP53):c.*327C>T rs886053512
NM_000546.5(TP53):c.*346G>T rs886053511
NM_000546.5(TP53):c.*347T>C rs886053510
NM_000546.5(TP53):c.*382C>T rs886053509
NM_000546.5(TP53):c.*485G>A rs4968187
NM_000546.5(TP53):c.*548G>T rs886053508
NM_000546.5(TP53):c.*565G>T rs886053507
NM_000546.5(TP53):c.*569_*570delGT rs1555523911
NM_000546.5(TP53):c.*613C>A rs17879353
NM_000546.5(TP53):c.*626C>T rs886053506
NM_000546.5(TP53):c.*735C>A rs886053505
NM_000546.5(TP53):c.*747C>T rs886053504
NM_000546.5(TP53):c.*754C>T rs199729221
NM_000546.5(TP53):c.*772delT rs200757381
NM_000546.5(TP53):c.*773C>T rs200378797
NM_000546.5(TP53):c.*779delC rs886053503
NM_000546.5(TP53):c.*790G>A rs886053502
NM_000546.5(TP53):c.*806C>A rs886053501
NM_000546.5(TP53):c.*826G>A rs17884306
NM_000546.5(TP53):c.*936A>G rs55817367
NM_000546.5(TP53):c.*977G>C rs886053500
NM_000546.5(TP53):c.*99G>A rs886053513
NM_000546.5(TP53):c.-202_*1207del
NM_000546.5(TP53):c.-202_-29+?del
NM_000546.5(TP53):c.-202_-29+?dup174
NM_000546.5(TP53):c.-73C>A rs886053514
NM_000546.5(TP53):c.1000G>C (p.Gly334Arg) rs730882028
NM_000546.5(TP53):c.1003C>T (p.Arg335Cys) rs375444154
NM_000546.5(TP53):c.1004G>A (p.Arg335His) rs771939956
NM_000546.5(TP53):c.1009C>G (p.Arg337Gly) rs587782529
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.100C>A (p.Pro34Thr) rs786201968
NM_000546.5(TP53):c.100C>G (p.Pro34Ala) rs786201968
NM_000546.5(TP53):c.1010G>A (p.Arg337His) rs121912664
NM_000546.5(TP53):c.1010G>C (p.Arg337Pro) rs121912664
NM_000546.5(TP53):c.1014C>T (p.Phe338=) rs150293825
NM_000546.5(TP53):c.1015G>A (p.Glu339Lys) rs17882252
NM_000546.5(TP53):c.1015G>C (p.Glu339Gln) rs17882252
NM_000546.5(TP53):c.1015G>T (p.Glu339Ter) rs17882252
NM_000546.5(TP53):c.1023C>T (p.Phe341=) rs864622369
NM_000546.5(TP53):c.1024C>T (p.Arg342Ter) rs730882029
NM_000546.5(TP53):c.1025G>A (p.Arg342Gln) rs375338359
NM_000546.5(TP53):c.1025G>C (p.Arg342Pro) rs375338359
NM_000546.5(TP53):c.102C>G (p.Pro34=) rs11575998
NM_000546.5(TP53):c.1031T>C (p.Leu344Pro) rs121912662
NM_000546.5(TP53):c.1032G>A (p.Leu344=) rs752189180
NM_000546.5(TP53):c.1032G>C (p.Leu344=) rs752189180
NM_000546.5(TP53):c.1036G>A (p.Glu346Lys)
NM_000546.5(TP53):c.1039G>A (p.Ala347Thr)
NM_000546.5(TP53):c.103T>A (p.Leu35Met) rs1060501211
NM_000546.5(TP53):c.1040C>A (p.Ala347Asp) rs397516434
NM_000546.5(TP53):c.1042T>G (p.Leu348Val) rs1060501193
NM_000546.5(TP53):c.1043_1051delinsG (p.Leu348_Lys351delinsTer) rs1567541951
NM_000546.5(TP53):c.1045G>C (p.Glu349Gln)
NM_000546.5(TP53):c.1052A>G (p.Lys351Arg) rs1555524396
NM_000546.5(TP53):c.105G>C (p.Leu35Phe) rs121912661
NM_000546.5(TP53):c.1060C>A (p.Gln354Lys) rs755394212
NM_000546.5(TP53):c.1060C>T (p.Gln354Ter) rs755394212
NM_000546.5(TP53):c.1064C>T (p.Ala355Val) rs1555524382
NM_000546.5(TP53):c.1066G>C (p.Gly356Arg) rs766786605
NM_000546.5(TP53):c.1069A>G (p.Lys357Glu) rs1567541856
NM_000546.5(TP53):c.1073A>T (p.Glu358Val) rs773553186
NM_000546.5(TP53):c.1079G>A (p.Gly360Glu) rs35993958
NM_000546.5(TP53):c.1079G>C (p.Gly360Ala) rs35993958
NM_000546.5(TP53):c.1079G>T (p.Gly360Val) rs35993958
NM_000546.5(TP53):c.107C>A (p.Pro36Gln) rs587781866
NM_000546.5(TP53):c.1081G>C (p.Gly361Arg) rs1555524361
NM_000546.5(TP53):c.1084A>T (p.Ser362Cys) rs1287887419
NM_000546.5(TP53):c.1085G>A (p.Ser362Asn) rs768803947
NM_000546.5(TP53):c.1087A>G (p.Arg363Gly) rs745751553
NM_000546.5(TP53):c.108G>A (p.Pro36=) rs1800370
NM_000546.5(TP53):c.1091C>T (p.Ala364Val) rs1567541711
NM_000546.5(TP53):c.1093C>T (p.His365Tyr) rs267605075
NM_000546.5(TP53):c.1096T>C (p.Ser366Pro) rs17881470
NM_000546.5(TP53):c.1096T>G (p.Ser366Ala) rs17881470
NM_000546.5(TP53):c.1100+10C>A rs374041625
NM_000546.5(TP53):c.1100+10C>T rs374041625
NM_000546.5(TP53):c.1100+5G>A
NM_000546.5(TP53):c.1100+7G>A rs777374791
NM_000546.5(TP53):c.1100+8A>G rs878854062
NM_000546.5(TP53):c.1101-1G>A rs876658982
NM_000546.5(TP53):c.1101-2A>G rs587781664
NM_000546.5(TP53):c.1102C>T (p.His368Tyr) rs786204227
NM_000546.5(TP53):c.1104C>A (p.His368Gln)
NM_000546.5(TP53):c.1104C>G (p.His368Gln) rs1289241865
NM_000546.5(TP53):c.110C>T (p.Ser37Phe) rs1567557177
NM_000546.5(TP53):c.1118A>G (p.Lys373Arg) rs1567540504
NM_000546.5(TP53):c.111C>T (p.Ser37=) rs1555526798
NM_000546.5(TP53):c.1120G>C (p.Gly374Arg) rs587781858
NM_000546.5(TP53):c.1120G>T (p.Gly374Cys)
NM_000546.5(TP53):c.1121del (p.Gly374fs) rs878854063
NM_000546.5(TP53):c.1123C>T (p.Gln375Ter) rs1555524156
NM_000546.5(TP53):c.1129A>G (p.Thr377Ala)
NM_000546.5(TP53):c.112del (p.Gln38fs) rs1555526795
NM_000546.5(TP53):c.1134C>T (p.Ser378=) rs1060504165
NM_000546.5(TP53):c.1135C>A (p.Arg379Ser) rs749061599
NM_000546.5(TP53):c.1135C>T (p.Arg379Cys) rs749061599
NM_000546.5(TP53):c.1136G>A (p.Arg379His) rs863224682
NM_000546.5(TP53):c.1136G>T (p.Arg379Leu) rs863224682
NM_000546.5(TP53):c.1140del (p.His380fs) rs1555524108
NM_000546.5(TP53):c.1146A>G (p.Lys382=) rs1567540280
NM_000546.5(TP53):c.1149C>T (p.Leu383=) rs373710656
NM_000546.5(TP53):c.1150A>G (p.Met384Val) rs730882009
NM_000546.5(TP53):c.1151T>C (p.Met384Thr) rs1060501196
NM_000546.5(TP53):c.1151T>G (p.Met384Arg) rs1060501196
NM_000546.5(TP53):c.1152G>A (p.Met384Ile)
NM_000546.5(TP53):c.1160del (p.Thr387fs)
NM_000546.5(TP53):c.1163A>C (p.Glu388Ala) rs587781736
NM_000546.5(TP53):c.1165G>A (p.Gly389Arg) rs587783064
NM_000546.5(TP53):c.1165G>T (p.Gly389Trp) rs587783064
NM_000546.5(TP53):c.116C>T (p.Ala39Val) rs1353016807
NM_000546.5(TP53):c.1177del (p.Asp393fs) rs1555524083
NM_000546.5(TP53):c.1180T>A (p.Ter394Arg)
NM_000546.5(TP53):c.1182A>T (p.Ter394Cys) rs1555524074
NM_000546.5(TP53):c.118A>G (p.Met40Val)
NM_000546.5(TP53):c.11C>G (p.Pro4Arg) rs878854064
NM_000546.5(TP53):c.11C>T (p.Pro4Leu) rs878854064
NM_000546.5(TP53):c.121G>A (p.Asp41Asn) rs1555526789
NM_000546.5(TP53):c.123T>C (p.Asp41=) rs369129220
NM_000546.5(TP53):c.127T>A (p.Leu43Met)
NM_000546.5(TP53):c.12G>A (p.Pro4=) rs876658274
NM_000546.5(TP53):c.132G>A (p.Met44Ile) rs1060501190
NM_000546.5(TP53):c.133C>G (p.Leu45Val)
NM_000546.5(TP53):c.135G>A (p.Leu45=) rs1060504164
NM_000546.5(TP53):c.137C>A (p.Ser46Tyr)
NM_000546.5(TP53):c.139C>A (p.Pro47Thr) rs1800371
NM_000546.5(TP53):c.139C>T (p.Pro47Ser) rs1800371
NM_000546.5(TP53):c.140del (p.Pro47fs) rs1567557016
NM_000546.5(TP53):c.141G>A (p.Pro47=) rs201741778
NM_000546.5(TP53):c.144C>A (p.Asp48Glu) rs587781460
NM_000546.5(TP53):c.144C>T (p.Asp48=) rs587781460
NM_000546.5(TP53):c.145G>A (p.Asp49Asn) rs587780728
NM_000546.5(TP53):c.145G>C (p.Asp49His) rs587780728
NM_000546.5(TP53):c.146A>G (p.Asp49Gly) rs759728549
NM_000546.5(TP53):c.147T>C (p.Asp49=) rs786201148
NM_000546.5(TP53):c.149T>A (p.Ile50Asn) rs370502517
NM_000546.5(TP53):c.149T>C (p.Ile50Thr) rs370502517
NM_000546.5(TP53):c.14A>G (p.Gln5Arg) rs781595324
NM_000546.5(TP53):c.151G>T (p.Glu51Ter) rs1567556930
NM_000546.5(TP53):c.152A>G (p.Glu51Gly) rs1567556923
NM_000546.5(TP53):c.155A>G (p.Gln52Arg) rs774656101
NM_000546.5(TP53):c.155_156del (p.Gln52fs) rs1555526750
NM_000546.5(TP53):c.156dup (p.Trp53fs) rs1555526748
NM_000546.5(TP53):c.158G>A (p.Trp53Ter) rs876658483
NM_000546.5(TP53):c.168A>G (p.Glu56=) rs574255227
NM_000546.5(TP53):c.171C>A (p.Asp57Glu) rs587782776
NM_000546.5(TP53):c.173C>G (p.Pro58Arg) rs144386518
NM_000546.5(TP53):c.174A>G (p.Pro58=) rs1060504166
NM_000546.5(TP53):c.180A>C (p.Pro60=) rs749289195
NM_000546.5(TP53):c.188C>G (p.Ala63Gly) rs372201428
NM_000546.5(TP53):c.188C>T (p.Ala63Val) rs372201428
NM_000546.5(TP53):c.18A>C (p.Ser6=) rs573130482
NM_000546.5(TP53):c.18A>G (p.Ser6=) rs573130482
NM_000546.5(TP53):c.192C>G (p.Pro64=) rs1555526723
NM_000546.5(TP53):c.194G>C (p.Arg65Thr) rs1060501210
NM_000546.5(TP53):c.196dup (p.Met66fs)
NM_000546.5(TP53):c.200C>A (p.Pro67Gln) rs1555526709
NM_000546.5(TP53):c.205G>A (p.Ala69Thr) rs1567556618
NM_000546.5(TP53):c.206C>T (p.Ala69Val) rs756233241
NM_000546.5(TP53):c.207T>C (p.Ala69=) rs775185978
NM_000546.5(TP53):c.210T>A (p.Ala70=) rs786203513
NM_000546.5(TP53):c.210T>C (p.Ala70=) rs786203513
NM_000546.5(TP53):c.211C>G (p.Pro71Ala) rs1567556576
NM_000546.5(TP53):c.211C>T (p.Pro71Ser) rs1567556576
NM_000546.5(TP53):c.212C>G (p.Pro71Arg) rs878854065
NM_000546.5(TP53):c.214C>G (p.Pro72Ala) rs587782769
NM_000546.5(TP53):c.214_215delinsTG (p.Pro72Cys) rs730882014
NM_000546.5(TP53):c.215C>A (p.Pro72His) rs1042522
NM_000546.5(TP53):c.215C>G (p.Pro72Arg) rs1042522
NM_000546.5(TP53):c.215_216delinsGT (p.Pro72Arg) rs878854066
NM_000546.5(TP53):c.216C>T (p.Pro72=) rs56275308
NM_000546.5(TP53):c.216dup (p.Val73fs) rs730882018
NM_000546.5(TP53):c.217G>A (p.Val73Met) rs587782423
NM_000546.5(TP53):c.219G>A (p.Val73=) rs1567556473
NM_000546.5(TP53):c.21T>A (p.Asp7Glu) rs587781277
NM_000546.5(TP53):c.221C>T (p.Ala74Val) rs587781832
NM_000546.5(TP53):c.222C>T (p.Ala74=) rs786201577
NM_000546.5(TP53):c.229C>A (p.Pro77Thr) rs753085009
NM_000546.5(TP53):c.229C>T (p.Pro77Ser) rs753085009
NM_000546.5(TP53):c.22C>A (p.Pro8Thr)
NM_000546.5(TP53):c.233C>G (p.Ala78Gly) rs876658527
NM_000546.5(TP53):c.234A>G (p.Ala78=) rs375099397
NM_000546.5(TP53):c.234_263del (p.Ala79_Ala88del) rs754312472
NM_000546.5(TP53):c.236C>G (p.Ala79Gly)
NM_000546.5(TP53):c.238C>T (p.Pro80Ser) rs1060501204
NM_000546.5(TP53):c.242C>T (p.Thr81Ile) rs1567556386
NM_000546.5(TP53):c.245C>G (p.Pro82Arg) rs534447939
NM_000546.5(TP53):c.245C>T (p.Pro82Leu) rs534447939
NM_000546.5(TP53):c.246G>A (p.Pro82=) rs372397095
NM_000546.5(TP53):c.248C>T (p.Ala83Val) rs201717599
NM_000546.5(TP53):c.249G>A (p.Ala83=) rs55754907
NM_000546.5(TP53):c.250G>A (p.Ala84Thr) rs587781307
NM_000546.5(TP53):c.250del (p.Ala84fs)
NM_000546.5(TP53):c.255T>C (p.Pro85=) rs775515332
NM_000546.5(TP53):c.256G>A (p.Ala86Thr) rs587782148
NM_000546.5(TP53):c.257C>T (p.Ala86Val)
NM_000546.5(TP53):c.257_279del (p.Ala86fs) rs886041861
NM_000546.5(TP53):c.2588dup rs1555523630
NM_000546.5(TP53):c.25A>C (p.Ser9Arg) rs1555527017
NM_000546.5(TP53):c.264C>T (p.Ala88=) rs876660951
NM_000546.5(TP53):c.266C>T (p.Pro89Leu) rs730881994
NM_000546.5(TP53):c.267C>A (p.Pro89=) rs786201443
NM_000546.5(TP53):c.267C>T (p.Pro89=) rs786201443
NM_000546.5(TP53):c.267del (p.Ser90fs) rs587783062
NM_000546.5(TP53):c.269C>T (p.Ser90Phe) rs1555526625
NM_000546.5(TP53):c.26G>A (p.Ser9Asn) rs1555527015
NM_000546.5(TP53):c.270C>T (p.Ser90=) rs863224370
NM_000546.5(TP53):c.273G>A (p.Trp91Ter) rs876660548
NM_000546.5(TP53):c.275C>T (p.Pro92Leu) rs1210700121
NM_000546.5(TP53):c.279G>T (p.Leu93=) rs878854067
NM_000546.5(TP53):c.27C>T (p.Ser9=) rs757282628
NM_000546.5(TP53):c.282A>G (p.Ser94=) rs771721337
NM_000546.5(TP53):c.283_285TCT[1] (p.Ser96del) rs878854068
NM_000546.5(TP53):c.283_375+21del114 rs1555526462
NM_000546.5(TP53):c.285T>G (p.Ser95=) rs876658696
NM_000546.5(TP53):c.289G>T (p.Val97Phe) rs730882023
NM_000546.5(TP53):c.28G>A (p.Val10Ile) rs535274413
NM_000546.5(TP53):c.28G>C (p.Val10Leu) rs535274413
NM_000546.5(TP53):c.293C>T (p.Pro98Leu) rs1245723119
NM_000546.5(TP53):c.295del (p.Ser99fs) rs1555526593
NM_000546.5(TP53):c.296C>G (p.Ser99Cys) rs1567556019
NM_000546.5(TP53):c.296C>T (p.Ser99Phe) rs1567556019
NM_000546.5(TP53):c.297C>T (p.Ser99=) rs751494750
NM_000546.5(TP53):c.301A>C (p.Lys101Gln)
NM_000546.5(TP53):c.303A>T (p.Lys101Asn) rs878854069
NM_000546.5(TP53):c.304A>T (p.Thr102Ser) rs1567555968
NM_000546.5(TP53):c.305C>T (p.Thr102Ile) rs786202717
NM_000546.5(TP53):c.307T>C (p.Tyr103His) rs1555526589
NM_000546.5(TP53):c.30C>G (p.Val10=) rs568171603
NM_000546.5(TP53):c.30C>T (p.Val10=) rs568171603
NM_000546.5(TP53):c.310C>T (p.Gln104Ter) rs1567555934
NM_000546.5(TP53):c.313G>C (p.Gly105Arg) rs1060501195
NM_000546.5(TP53):c.314G>A (p.Gly105Asp) rs587781504
NM_000546.5(TP53):c.319T>A (p.Tyr107Asn) rs368771578
NM_000546.5(TP53):c.319T>C (p.Tyr107His) rs368771578
NM_000546.5(TP53):c.319T>G (p.Tyr107Asp)
NM_000546.5(TP53):c.31G>A (p.Glu11Lys) rs201382018
NM_000546.5(TP53):c.31G>C (p.Glu11Gln) rs201382018
NM_000546.5(TP53):c.320A>G (p.Tyr107Cys) rs587782447
NM_000546.5(TP53):c.321C>A (p.Tyr107Ter) rs770776262
NM_000546.5(TP53):c.322G>A (p.Gly108Ser) rs587782461
NM_000546.5(TP53):c.322G>C (p.Gly108Arg) rs587782461
NM_000546.5(TP53):c.322_324del (p.Gly108del) rs587783063
NM_000546.5(TP53):c.323_329dup (p.Leu111fs) rs1131691004
NM_000546.5(TP53):c.324_326del (p.Phe109del) rs1567555808
NM_000546.5(TP53):c.328C>A (p.Arg110Ser) rs587781371
NM_000546.5(TP53):c.328C>T (p.Arg110Cys) rs587781371
NM_000546.5(TP53):c.329G>A (p.Arg110His) rs11540654
NM_000546.5(TP53):c.329G>C (p.Arg110Pro) rs11540654
NM_000546.5(TP53):c.329G>T (p.Arg110Leu) rs11540654
NM_000546.5(TP53):c.329_330delinsCC (p.Arg110Pro)
NM_000546.5(TP53):c.330T>C (p.Arg110=) rs1060504167
NM_000546.5(TP53):c.332T>C (p.Leu111Pro) rs1057519997
NM_000546.5(TP53):c.334_364dup (p.Val122fs) rs1555526495
NM_000546.5(TP53):c.337T>G (p.Phe113Val) rs587781642
NM_000546.5(TP53):c.341T>C (p.Leu114Ser) rs781724995
NM_000546.5(TP53):c.342dup (p.His115fs)
NM_000546.5(TP53):c.343C>A (p.His115Asn) rs1555526532
NM_000546.5(TP53):c.344A>G (p.His115Arg) rs730881996
NM_000546.5(TP53):c.346T>G (p.Ser116Ala)
NM_000546.5(TP53):c.351G>A (p.Gly117=) rs876658998
NM_000546.5(TP53):c.353C>T (p.Thr118Ile) rs1064794141
NM_000546.5(TP53):c.354A>T (p.Thr118=) rs751978853
NM_000546.5(TP53):c.358A>G (p.Lys120Glu) rs121912658
NM_000546.5(TP53):c.358A>T (p.Lys120Ter) rs121912658
NM_000546.5(TP53):c.35C>A (p.Pro12His) rs1482497533
NM_000546.5(TP53):c.35C>G (p.Pro12Arg)
NM_000546.5(TP53):c.35C>T (p.Pro12Leu) rs1482497533
NM_000546.5(TP53):c.363_364TG[1] (p.Val122fs) rs587780067
NM_000546.5(TP53):c.364G>A (p.Val122Met) rs587781495
NM_000546.5(TP53):c.372C>A (p.Cys124Ter) rs1555526478
NM_000546.5(TP53):c.373A>C (p.Thr125Pro) rs1057520003
NM_000546.5(TP53):c.374C>A (p.Thr125Lys) rs786201057
NM_000546.5(TP53):c.374C>G (p.Thr125Arg) rs786201057
NM_000546.5(TP53):c.374C>T (p.Thr125Met) rs786201057
NM_000546.5(TP53):c.375+17G>A rs765179201
NM_000546.5(TP53):c.375+1G>C
NM_000546.5(TP53):c.375+1G>T
NM_000546.5(TP53):c.375+1_375+5dup rs1555526468
NM_000546.5(TP53):c.375+2T>A rs1555526469
NM_000546.5(TP53):c.375+2T>C rs1555526469
NM_000546.5(TP53):c.375+4A>G rs1060501192
NM_000546.5(TP53):c.375+4_375+5dup rs1555526467
NM_000546.5(TP53):c.375+5G>C rs1555526466
NM_000546.5(TP53):c.375+6T>C rs730881998
NM_000546.5(TP53):c.375G>A (p.Thr125=) rs55863639
NM_000546.5(TP53):c.375G>T (p.Thr125=) rs55863639
NM_000546.5(TP53):c.376-18dupT rs756417643
NM_000546.5(TP53):c.376-1G>A rs868137297
NM_000546.5(TP53):c.376-2A>G rs786202799
NM_000546.5(TP53):c.376-2A>T rs786202799
NM_000546.5(TP53):c.376-2dupA rs751253294
NM_000546.5(TP53):c.376T>A (p.Tyr126Asn) rs886039483
NM_000546.5(TP53):c.376T>G (p.Tyr126Asp) rs886039483
NM_000546.5(TP53):c.377A>G (p.Tyr126Cys) rs1555526335
NM_000546.5(TP53):c.378C>G (p.Tyr126Ter) rs1567554500
NM_000546.5(TP53):c.37C>T (p.Pro13Ser) rs1060501208
NM_000546.5(TP53):c.380C>A (p.Ser127Tyr)
NM_000546.5(TP53):c.380C>G (p.Ser127Cys) rs730881999
NM_000546.5(TP53):c.380C>T (p.Ser127Phe) rs730881999
NM_000546.5(TP53):c.382C>A (p.Pro128Thr) rs1555526327
NM_000546.5(TP53):c.383del (p.Pro128fs)
NM_000546.5(TP53):c.386C>G (p.Ala129Gly) rs137852792
NM_000546.5(TP53):c.388C>G (p.Leu130Val) rs863224683
NM_000546.5(TP53):c.388C>T (p.Leu130Phe) rs863224683
NM_000546.5(TP53):c.38C>T (p.Pro13Leu) rs878854070
NM_000546.5(TP53):c.38dup (p.Leu14fs) rs1555527002
NM_000546.5(TP53):c.392A>T (p.Asn131Ile) rs1131691037
NM_000546.5(TP53):c.393C>A (p.Asn131Lys) rs769270327
NM_000546.5(TP53):c.394A>C (p.Lys132Gln) rs747342068
NM_000546.5(TP53):c.394A>G (p.Lys132Glu) rs747342068
NM_000546.5(TP53):c.395A>C (p.Lys132Thr) rs1057519996
NM_000546.5(TP53):c.395A>G (p.Lys132Arg) rs1057519996
NM_000546.5(TP53):c.395A>T (p.Lys132Met) rs1057519996
NM_000546.5(TP53):c.396G>C (p.Lys132Asn) rs866775781
NM_000546.5(TP53):c.396G>T (p.Lys132Asn) rs866775781
NM_000546.5(TP53):c.397A>G (p.Met133Val) rs1057280220
NM_000546.5(TP53):c.398T>C (p.Met133Thr) rs28934873
NM_000546.5(TP53):c.399G>A (p.Met133Ile) rs1064795139
NM_000546.5(TP53):c.400T>C (p.Phe134Leu)
NM_000546.5(TP53):c.403T>A (p.Cys135Ser) rs1057519975
NM_000546.5(TP53):c.403T>C (p.Cys135Arg) rs1057519975
NM_000546.5(TP53):c.403T>G (p.Cys135Gly) rs1057519975
NM_000546.5(TP53):c.404G>A (p.Cys135Tyr) rs587781991
NM_000546.5(TP53):c.404G>T (p.Cys135Phe) rs587781991
NM_000546.5(TP53):c.405C>G (p.Cys135Trp) rs1057519976
NM_000546.5(TP53):c.407A>C (p.Gln136Pro) rs1567554216
NM_000546.5(TP53):c.408A>C (p.Gln136His) rs758781593
NM_000546.5(TP53):c.408A>G (p.Gln136=) rs758781593
NM_000546.5(TP53):c.40C>G (p.Leu14Val) rs1567558112
NM_000546.5(TP53):c.412G>C (p.Ala138Pro) rs28934875
NM_000546.5(TP53):c.413C>A (p.Ala138Asp) rs750600586
NM_000546.5(TP53):c.413C>T (p.Ala138Val) rs750600586
NM_000546.5(TP53):c.415A>G (p.Lys139Glu)
NM_000546.5(TP53):c.417G>T (p.Lys139Asn) rs1567554121
NM_000546.5(TP53):c.418A>G (p.Thr140Ala)
NM_000546.5(TP53):c.422G>A (p.Cys141Tyr) rs587781288
NM_000546.5(TP53):c.423C>G (p.Cys141Trp) rs1057519977
NM_000546.5(TP53):c.427G>A (p.Val143Met) rs587782620
NM_000546.5(TP53):c.438G>A (p.Trp146Ter) rs1131691026
NM_000546.5(TP53):c.439G>A (p.Val147Ile) rs1555526226
NM_000546.5(TP53):c.442G>A (p.Asp148Asn)
NM_000546.5(TP53):c.442G>T (p.Asp148Tyr) rs1131691007
NM_000546.5(TP53):c.448_460del (p.Thr150fs) rs1064792930
NM_000546.5(TP53):c.450A>G (p.Thr150=) rs754020850
NM_000546.5(TP53):c.451C>A (p.Pro151Thr) rs28934874
NM_000546.5(TP53):c.451C>G (p.Pro151Ala) rs28934874
NM_000546.5(TP53):c.451C>T (p.Pro151Ser) rs28934874
NM_000546.5(TP53):c.452C>A (p.Pro151His) rs1057520000
NM_000546.5(TP53):c.452C>G (p.Pro151Arg) rs1057520000
NM_000546.5(TP53):c.455C>T (p.Pro152Leu) rs587782705
NM_000546.5(TP53):c.455dup (p.Pro153fs) rs730882019
NM_000546.5(TP53):c.457C>T (p.Pro153Ser) rs1064795860
NM_000546.5(TP53):c.458C>T (p.Pro153Leu)
NM_000546.5(TP53):c.459C>T (p.Pro153=) rs72661116
NM_000546.5(TP53):c.45T>C (p.Ser15=) rs766765429
NM_000546.5(TP53):c.45del (p.Gln16fs) rs1555526997
NM_000546.5(TP53):c.460G>A (p.Gly154Ser) rs137852789
NM_000546.5(TP53):c.460G>C (p.Gly154Arg) rs137852789
NM_000546.5(TP53):c.461G>A (p.Gly154Asp) rs762846821
NM_000546.5(TP53):c.461G>T (p.Gly154Val)
NM_000546.5(TP53):c.463A>G (p.Thr155Ala) rs772683278
NM_000546.5(TP53):c.463_468del (p.Thr155_Arg156del) rs1555526166
NM_000546.5(TP53):c.464C>A (p.Thr155Asn) rs786202752
NM_000546.5(TP53):c.464C>G (p.Thr155Ser) rs786202752
NM_000546.5(TP53):c.465C>A (p.Thr155=) rs786202992
NM_000546.5(TP53):c.466C>T (p.Arg156Cys) rs563378859
NM_000546.5(TP53):c.467G>A (p.Arg156His) rs371524413
NM_000546.5(TP53):c.468C>T (p.Arg156=) rs761222871
NM_000546.5(TP53):c.469G>A (p.Val157Ile) rs121912654
NM_000546.5(TP53):c.469G>T (p.Val157Phe) rs121912654
NM_000546.5(TP53):c.470T>A (p.Val157Asp) rs1131691023
NM_000546.5(TP53):c.470T>C (p.Val157Ala) rs1131691023
NM_000546.5(TP53):c.470_475dup (p.Val157_Arg158dup) rs1555526140
NM_000546.5(TP53):c.472C>T (p.Arg158Cys) rs587780068
NM_000546.5(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.5(TP53):c.473G>C (p.Arg158Pro) rs587782144
NM_000546.5(TP53):c.473G>T (p.Arg158Leu) rs587782144
NM_000546.5(TP53):c.473_474delinsTT (p.Arg158Leu) rs1567553501
NM_000546.5(TP53):c.474C>T (p.Arg158=) rs139200646
NM_000546.5(TP53):c.476C>T (p.Ala159Val) rs1555526131
NM_000546.5(TP53):c.480G>A (p.Met160Ile) rs772354334
NM_000546.5(TP53):c.481G>A (p.Ala161Thr) rs193920817
NM_000546.5(TP53):c.482C>A (p.Ala161Asp) rs1064795691
NM_000546.5(TP53):c.483C>A (p.Ala161=) rs1057523101
NM_000546.5(TP53):c.487T>A (p.Tyr163Asn) rs786203436
NM_000546.5(TP53):c.488A>G (p.Tyr163Cys) rs148924904
NM_000546.5(TP53):c.48G>C (p.Gln16His)
NM_000546.5(TP53):c.490A>G (p.Lys164Glu) rs879254249
NM_000546.5(TP53):c.492_493delinsCT (p.Lys164_Gln165delinsAsnTer) rs1567553215
NM_000546.5(TP53):c.493C>T (p.Gln165Ter) rs730882001
NM_000546.5(TP53):c.495_497del (p.Ser166del)
NM_000546.5(TP53):c.497C>T (p.Ser166Leu) rs1555526101
NM_000546.5(TP53):c.498A>G (p.Ser166=) rs1555526098
NM_000546.5(TP53):c.499C>T (p.Gln167Ter) rs1555526097
NM_000546.5(TP53):c.4G>A (p.Glu2Lys) rs769884991
NM_000546.5(TP53):c.500A>G (p.Gln167Arg)
NM_000546.5(TP53):c.501del (p.Gln167fs) rs1567553148
NM_000546.5(TP53):c.503A>G (p.His168Arg) rs867114783
NM_000546.5(TP53):c.504C>T (p.His168=) rs746293837
NM_000546.5(TP53):c.506T>G (p.Met169Arg) rs1567553114
NM_000546.5(TP53):c.508A>G (p.Thr170Ala) rs587780729
NM_000546.5(TP53):c.509C>T (p.Thr170Met) rs779000871
NM_000546.5(TP53):c.509_510dup (p.Glu171fs)
NM_000546.5(TP53):c.510G>A (p.Thr170=) rs757544615
NM_000546.5(TP53):c.511G>A (p.Glu171Lys) rs587781845
NM_000546.5(TP53):c.511G>T (p.Glu171Ter) rs587781845
NM_000546.5(TP53):c.515T>C (p.Val172Ala) rs1131691021
NM_000546.5(TP53):c.516T>G (p.Val172=) rs749309577
NM_000546.5(TP53):c.517G>A (p.Val173Met) rs876660754
NM_000546.5(TP53):c.517G>T (p.Val173Leu) rs876660754
NM_000546.5(TP53):c.517_535dup (p.His179fs) rs1567552753
NM_000546.5(TP53):c.518T>A (p.Val173Glu) rs1057519747
NM_000546.5(TP53):c.518T>C (p.Val173Ala) rs1057519747
NM_000546.5(TP53):c.518T>G (p.Val173Gly) rs1057519747
NM_000546.5(TP53):c.519G>A (p.Val173=) rs1292303980
NM_000546.5(TP53):c.520A>G (p.Arg174Gly) rs864622115
NM_000546.5(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG rs1555525957
NM_000546.5(TP53):c.523C>G (p.Arg175Gly) rs138729528
NM_000546.5(TP53):c.523C>T (p.Arg175Cys) rs138729528
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.524G>T (p.Arg175Leu) rs28934578
NM_000546.5(TP53):c.527G>A (p.Cys176Tyr) rs786202962
NM_000546.5(TP53):c.528C>G (p.Cys176Trp) rs1057519980
NM_000546.5(TP53):c.529C>A (p.Pro177Thr) rs147002414
NM_000546.5(TP53):c.529C>T (p.Pro177Ser)
NM_000546.5(TP53):c.530C>G (p.Pro177Arg) rs751477326
NM_000546.5(TP53):c.530C>T (p.Pro177Leu) rs751477326
NM_000546.5(TP53):c.532C>G (p.His178Asp) rs1064795203
NM_000546.5(TP53):c.532del (p.His178fs) rs786202525
NM_000546.5(TP53):c.534C>A (p.His178Gln) rs1555526001
NM_000546.5(TP53):c.535C>A (p.His179Asn) rs587780070
NM_000546.5(TP53):c.535C>T (p.His179Tyr) rs587780070
NM_000546.5(TP53):c.536A>G (p.His179Arg) rs1057519991
NM_000546.5(TP53):c.536A>T (p.His179Leu) rs1057519991
NM_000546.5(TP53):c.537T>A (p.His179Gln) rs876660821
NM_000546.5(TP53):c.537T>C (p.His179=) rs876660821
NM_000546.5(TP53):c.537T>G (p.His179Gln) rs876660821
NM_000546.5(TP53):c.538G>A (p.Glu180Lys) rs879253911
NM_000546.5(TP53):c.541C>A (p.Arg181Ser) rs587782596
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.542G>A (p.Arg181His) rs397514495
NM_000546.5(TP53):c.542G>T (p.Arg181Leu) rs397514495
NM_000546.5(TP53):c.54A>G (p.Thr18=) rs876659984
NM_000546.5(TP53):c.551A>G (p.Asp184Gly) rs1060501209
NM_000546.5(TP53):c.551_554del (p.Asp184fs)
NM_000546.5(TP53):c.554G>A (p.Ser185Asn) rs150607408
NM_000546.5(TP53):c.555C>T (p.Ser185=) rs367560109
NM_000546.5(TP53):c.556G>A (p.Asp186Asn) rs1060501206
NM_000546.5(TP53):c.558T>A (p.Asp186Glu) rs375275361
NM_000546.5(TP53):c.558T>C (p.Asp186=) rs375275361
NM_000546.5(TP53):c.559+1G>A rs1131691042
NM_000546.5(TP53):c.559+1G>T
NM_000546.5(TP53):c.559+4A>G rs1357840734
NM_000546.5(TP53):c.559+5G>A rs1555525956
NM_000546.5(TP53):c.559+5G>C
NM_000546.5(TP53):c.559+6C>A
NM_000546.5(TP53):c.559+8G>A rs775915220
NM_000546.5(TP53):c.559+9C>G rs1224204682
NM_000546.5(TP53):c.560-4_560-2delTTA rs1060501212
NM_000546.5(TP53):c.560-6T>C rs1555525929
NM_000546.5(TP53):c.560-8G>C rs373797299
NM_000546.5(TP53):c.560-9T>G rs794727781
NM_000546.5(TP53):c.565G>T (p.Ala189Ser) rs1555525921
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.568C>T (p.Pro190Ser)
NM_000546.5(TP53):c.569C>T (p.Pro190Leu) rs876660825
NM_000546.5(TP53):c.569_571CTC[1] (p.Pro191del) rs1555525902
NM_000546.5(TP53):c.572C>G (p.Pro191Arg) rs587778718
NM_000546.5(TP53):c.574C>T (p.Gln192Ter) rs866380588
NM_000546.5(TP53):c.577C>T (p.His193Tyr) rs876658468
NM_000546.5(TP53):c.578A>G (p.His193Arg) rs786201838
NM_000546.5(TP53):c.578A>T (p.His193Leu) rs786201838
NM_000546.5(TP53):c.581T>C (p.Leu194Pro) rs1057519998
NM_000546.5(TP53):c.581T>G (p.Leu194Arg) rs1057519998
NM_000546.5(TP53):c.582T>C (p.Leu194=) rs370216745
NM_000546.5(TP53):c.584T>A (p.Ile195Asn) rs760043106
NM_000546.5(TP53):c.584T>C (p.Ile195Thr) rs760043106
NM_000546.5(TP53):c.585C>G (p.Ile195Met) rs1057519994
NM_000546.5(TP53):c.586C>G (p.Arg196Gly) rs397516435
NM_000546.5(TP53):c.586C>T (p.Arg196Ter) rs397516435
NM_000546.5(TP53):c.587G>A (p.Arg196Gln) rs483352697
NM_000546.5(TP53):c.589G>A (p.Val197Met) rs786204041
NM_000546.5(TP53):c.589G>T (p.Val197Leu) rs786204041
NM_000546.5(TP53):c.590T>A (p.Val197Glu) rs1567551903
NM_000546.5(TP53):c.591G>A (p.Val197=) rs1567551885
NM_000546.5(TP53):c.596G>A (p.Gly199Glu) rs1555525857
NM_000546.5(TP53):c.604C>T (p.Arg202Cys) rs587780072
NM_000546.5(TP53):c.605G>A (p.Arg202His) rs587778719
NM_000546.5(TP53):c.606T>C (p.Arg202=) rs1392931620
NM_000546.5(TP53):c.607G>A (p.Val203Met) rs730882003
NM_000546.5(TP53):c.607G>C (p.Val203Leu) rs730882003
NM_000546.5(TP53):c.607G>T (p.Val203Leu) rs730882003
NM_000546.5(TP53):c.608T>A (p.Val203Glu)
NM_000546.5(TP53):c.608_610del (p.Val203del) rs1567551730
NM_000546.5(TP53):c.612G>A (p.Glu204=) rs749629973
NM_000546.5(TP53):c.613T>A (p.Tyr205Asn) rs1057520008
NM_000546.5(TP53):c.613T>C (p.Tyr205His) rs1057520008
NM_000546.5(TP53):c.613T>G (p.Tyr205Asp) rs1057520008
NM_000546.5(TP53):c.614A>G (p.Tyr205Cys) rs1057520007
NM_000546.5(TP53):c.615T>C (p.Tyr205=) rs786202222
NM_000546.5(TP53):c.618G>A (p.Leu206=) rs142813240
NM_000546.5(TP53):c.623A>G (p.Asp208Gly) rs1464727668
NM_000546.5(TP53):c.626_627del (p.Arg209fs) rs1057517840
NM_000546.5(TP53):c.628A>T (p.Asn210Tyr) rs1060501200
NM_000546.5(TP53):c.628_629del (p.Asn210fs) rs587776768
NM_000546.5(TP53):c.631A>C (p.Thr211Pro) rs1060501198
NM_000546.5(TP53):c.631A>G (p.Thr211Ala) rs1060501198
NM_000546.5(TP53):c.634T>A (p.Phe212Ile) rs1064795766
NM_000546.5(TP53):c.637C>G (p.Arg213Gly) rs397516436
NM_000546.5(TP53):c.637C>T (p.Arg213Ter) rs397516436
NM_000546.5(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.5(TP53):c.638G>C (p.Arg213Pro) rs587778720
NM_000546.5(TP53):c.638G>T (p.Arg213Leu) rs587778720
NM_000546.5(TP53):c.639A>G (p.Arg213=) rs1800372
NM_000546.5(TP53):c.63C>T (p.Asp21=) rs1800369
NM_000546.5(TP53):c.640C>A (p.His214Asn) rs876658466
NM_000546.5(TP53):c.641A>C (p.His214Pro)
NM_000546.5(TP53):c.641A>G (p.His214Arg) rs1057519992
NM_000546.5(TP53):c.642T>C (p.His214=) rs587781386
NM_000546.5(TP53):c.642T>G (p.His214Gln) rs587781386
NM_000546.5(TP53):c.643A>G (p.Ser215Gly) rs886039484
NM_000546.5(TP53):c.644G>A (p.Ser215Asn) rs587782177
NM_000546.5(TP53):c.645T>G (p.Ser215Arg) rs1057520001
NM_000546.5(TP53):c.646G>A (p.Val216Met) rs730882025
NM_000546.5(TP53):c.646G>C (p.Val216Leu) rs730882025
NM_000546.5(TP53):c.649G>A (p.Val217Met) rs35163653
NM_000546.5(TP53):c.652G>A (p.Val218Met) rs878854072
NM_000546.5(TP53):c.653T>G (p.Val218Gly) rs1555525743
NM_000546.5(TP53):c.655C>T (p.Pro219Ser) rs879253894
NM_000546.5(TP53):c.657C>A (p.Pro219=) rs786201859
NM_000546.5(TP53):c.659A>C (p.Tyr220Ser) rs121912666
NM_000546.5(TP53):c.659A>G (p.Tyr220Cys) rs121912666
NM_000546.5(TP53):c.661G>A (p.Glu221Lys) rs786201592
NM_000546.5(TP53):c.661G>T (p.Glu221Ter) rs786201592
NM_000546.5(TP53):c.662A>C (p.Glu221Ala) rs1567551121
NM_000546.5(TP53):c.662del (p.Glu221fs) rs878854071
NM_000546.5(TP53):c.663G>A (p.Glu221=) rs1060504161
NM_000546.5(TP53):c.664C>T (p.Pro222Ser) rs1060501203
NM_000546.5(TP53):c.665C>T (p.Pro222Leu) rs146340390
NM_000546.5(TP53):c.666G>A (p.Pro222=) rs72661118
NM_000546.5(TP53):c.666G>T (p.Pro222=) rs72661118
NM_000546.5(TP53):c.668C>T (p.Pro223Leu) rs138983188
NM_000546.5(TP53):c.66A>G (p.Leu22=) rs748527030
NM_000546.5(TP53):c.672+15T>C rs140756213
NM_000546.5(TP53):c.672+18G>C rs199578278
NM_000546.5(TP53):c.672+1G>A rs863224499
NM_000546.5(TP53):c.672+2T>A rs1555525703
NM_000546.5(TP53):c.672+4T>C
NM_000546.5(TP53):c.672+8_672+22delTTGCAACTGGGGTCT rs1467799984
NM_000546.5(TP53):c.672G>A (p.Glu224=) rs267605076
NM_000546.5(TP53):c.673-1G>T rs878854073
NM_000546.5(TP53):c.673-2A>G rs1555525585
NM_000546.5(TP53):c.673-36G>C rs17880604
NM_000546.5(TP53):c.673-37C>T rs374907737
NM_000546.5(TP53):c.673-4C>G rs1555525586
NM_000546.5(TP53):c.673-5C>G rs876658684
NM_000546.5(TP53):c.673-9delA rs762540407
NM_000546.5(TP53):c.676G>A (p.Gly226Ser)
NM_000546.5(TP53):c.677G>T (p.Gly226Val) rs970212462
NM_000546.5(TP53):c.685T>C (p.Cys229Arg) rs1064794312
NM_000546.5(TP53):c.686G>C (p.Cys229Ser)
NM_000546.5(TP53):c.692C>T (p.Thr231Ile) rs1555525564
NM_000546.5(TP53):c.6G>A (p.Glu2=) rs143458271
NM_000546.5(TP53):c.700T>A (p.Tyr234Asn) rs864622237
NM_000546.5(TP53):c.700T>C (p.Tyr234His) rs864622237
NM_000546.5(TP53):c.700T>G (p.Tyr234Asp) rs864622237
NM_000546.5(TP53):c.701A>C (p.Tyr234Ser) rs587780073
NM_000546.5(TP53):c.701A>G (p.Tyr234Cys) rs587780073
NM_000546.5(TP53):c.702_714del (p.His233_Tyr234insTer) rs1567549676
NM_000546.5(TP53):c.703A>T (p.Asn235Tyr) rs786204145
NM_000546.5(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_000546.5(TP53):c.706T>A (p.Tyr236Asn) rs587782289
NM_000546.5(TP53):c.706T>C (p.Tyr236His) rs587782289
NM_000546.5(TP53):c.709A>G (p.Met237Val) rs730882004
NM_000546.5(TP53):c.710T>C (p.Met237Thr) rs765848205
NM_000546.5(TP53):c.711G>A (p.Met237Ile) rs587782664
NM_000546.5(TP53):c.711del (p.Met237fs)
NM_000546.5(TP53):c.712T>C (p.Cys238Arg) rs1057519981
NM_000546.5(TP53):c.713G>A (p.Cys238Tyr) rs730882005
NM_000546.5(TP53):c.713G>T (p.Cys238Phe) rs730882005
NM_000546.5(TP53):c.714T>G (p.Cys238Trp) rs193920789
NM_000546.5(TP53):c.715A>G (p.Asn239Asp) rs876660807
NM_000546.5(TP53):c.715_724del (p.Asn239fs) rs1555525518
NM_000546.5(TP53):c.716A>C (p.Asn239Thr) rs1057519999
NM_000546.5(TP53):c.716_721del (p.Asn239_Ser241delinsThr)
NM_000546.5(TP53):c.716del (p.Asn239fs) rs1060501197
NM_000546.5(TP53):c.717C>G (p.Asn239Lys) rs1057522275
NM_000546.5(TP53):c.718A>G (p.Ser240Gly) rs1567549584
NM_000546.5(TP53):c.720T>G (p.Ser240Arg) rs764342812
NM_000546.5(TP53):c.722C>G (p.Ser241Cys) rs28934573
NM_000546.5(TP53):c.722C>T (p.Ser241Phe) rs28934573
NM_000546.5(TP53):c.724T>A (p.Cys242Ser) rs1057519982
NM_000546.5(TP53):c.724T>G (p.Cys242Gly) rs1057519982
NM_000546.5(TP53):c.724_726dup (p.Cys242dup)
NM_000546.5(TP53):c.725G>A (p.Cys242Tyr) rs121912655
NM_000546.5(TP53):c.725G>C (p.Cys242Ser)
NM_000546.5(TP53):c.725G>T (p.Cys242Phe) rs121912655
NM_000546.5(TP53):c.727A>G (p.Met243Val) rs786203117
NM_000546.5(TP53):c.728T>C (p.Met243Thr) rs730882006
NM_000546.5(TP53):c.730G>A (p.Gly244Ser) rs1057519989
NM_000546.5(TP53):c.730G>T (p.Gly244Cys) rs1057519989
NM_000546.5(TP53):c.730_738del (p.Gly244_Met246del)
NM_000546.5(TP53):c.731G>A (p.Gly244Asp) rs985033810
NM_000546.5(TP53):c.731G>C (p.Gly244Ala) rs985033810
NM_000546.5(TP53):c.732C>T (p.Gly244=) rs759625762
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.733G>C (p.Gly245Arg) rs28934575
NM_000546.5(TP53):c.733G>T (p.Gly245Cys) rs28934575
NM_000546.5(TP53):c.734G>A (p.Gly245Asp) rs121912656
NM_000546.5(TP53):c.734G>T (p.Gly245Val) rs121912656
NM_000546.5(TP53):c.736A>G (p.Met246Val) rs483352695
NM_000546.5(TP53):c.736A>T (p.Met246Leu) rs483352695
NM_000546.5(TP53):c.737T>A (p.Met246Lys) rs587780074
NM_000546.5(TP53):c.737T>C (p.Met246Thr) rs587780074
NM_000546.5(TP53):c.738G>A (p.Met246Ile) rs1019340046
NM_000546.5(TP53):c.74+14T>C rs184743157
NM_000546.5(TP53):c.74+8G>A rs776933919
NM_000546.5(TP53):c.74+9A>C rs1057517593
NM_000546.5(TP53):c.740A>G (p.Asn247Ser) rs786201762
NM_000546.5(TP53):c.741C>T (p.Asn247=) rs786202448
NM_000546.5(TP53):c.741_742delinsTT (p.Arg248Trp) rs1555525498
NM_000546.5(TP53):c.742C>G (p.Arg248Gly) rs121912651
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.5(TP53):c.743G>C (p.Arg248Pro) rs11540652
NM_000546.5(TP53):c.745A>G (p.Arg249Gly) rs587782082
NM_000546.5(TP53):c.746G>T (p.Arg249Met) rs587782329
NM_000546.5(TP53):c.747G>C (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.747G>T (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.749C>T (p.Pro250Leu) rs1064794311
NM_000546.5(TP53):c.75-8T>C rs1555526938
NM_000546.5(TP53):c.752T>A (p.Ile251Asn) rs730882027
NM_000546.5(TP53):c.753C>G (p.Ile251Met) rs878854074
NM_000546.5(TP53):c.753C>T (p.Ile251=) rs878854074
NM_000546.5(TP53):c.755T>C (p.Leu252Pro) rs121912653
NM_000546.5(TP53):c.760A>G (p.Ile254Val) rs746601313
NM_000546.5(TP53):c.761T>G (p.Ile254Ser)
NM_000546.5(TP53):c.761_763TCA[1] (p.Ile255del) rs1064794309
NM_000546.5(TP53):c.764T>A (p.Ile255Asn) rs876659675
NM_000546.5(TP53):c.764T>C (p.Ile255Thr) rs876659675
NM_000546.5(TP53):c.766A>C (p.Thr256Pro) rs587781433
NM_000546.5(TP53):c.766A>G (p.Thr256Ala) rs587781433
NM_000546.5(TP53):c.766dup (p.Thr256fs)
NM_000546.5(TP53):c.768A>G (p.Thr256=) rs786203563
NM_000546.5(TP53):c.770T>A (p.Leu257Gln) rs28934577
NM_000546.5(TP53):c.770T>C (p.Leu257Pro) rs28934577
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.773A>C (p.Glu258Ala) rs1060501201
NM_000546.5(TP53):c.773A>G (p.Glu258Gly) rs1060501201
NM_000546.5(TP53):c.776A>G (p.Asp259Gly) rs745425759
NM_000546.5(TP53):c.776A>T (p.Asp259Val) rs745425759
NM_000546.5(TP53):c.779C>A (p.Ser260Tyr) rs876658916
NM_000546.5(TP53):c.77_80delinsAAGAACGT (p.Leu26fs) rs397516438
NM_000546.5(TP53):c.782+12C>T rs17881780
NM_000546.5(TP53):c.782+1G>T rs1555525429
NM_000546.5(TP53):c.782+2_782+6delTCAGG rs1567548832
NM_000546.5(TP53):c.782+3C>A rs1555525425
NM_000546.5(TP53):c.782+3C>T rs1555525425
NM_000546.5(TP53):c.782+6G>A rs1008479744
NM_000546.5(TP53):c.782+6delG rs864622076
NM_000546.5(TP53):c.783-13C>G rs1555525373
NM_000546.5(TP53):c.783-1G>A rs1555525367
NM_000546.5(TP53):c.783-2A>G rs1060501207
NM_000546.5(TP53):c.783-4G>A rs1060504160
NM_000546.5(TP53):c.783-7T>G
NM_000546.5(TP53):c.783-8C>G rs1567548432
NM_000546.5(TP53):c.783T>C (p.Ser261=) rs863224684
NM_000546.5(TP53):c.784G>A (p.Gly262Ser) rs200579969
NM_000546.5(TP53):c.784_786delGGT rs1567548347
NM_000546.5(TP53):c.785G>T (p.Gly262Val) rs1131691025
NM_000546.5(TP53):c.787A>C (p.Asn263His) rs72661119
NM_000546.5(TP53):c.787A>G (p.Asn263Asp) rs72661119
NM_000546.5(TP53):c.788del (p.Asn263fs)
NM_000546.5(TP53):c.790C>A (p.Leu264Ile)
NM_000546.5(TP53):c.790del (p.Leu264fs) rs1060501194
NM_000546.5(TP53):c.791T>C (p.Leu264Pro) rs1555525353
NM_000546.5(TP53):c.792A>G (p.Leu264=) rs1060504162
NM_000546.5(TP53):c.794T>C (p.Leu265Pro) rs879253942
NM_000546.5(TP53):c.796G>A (p.Gly266Arg) rs1057519990
NM_000546.5(TP53):c.796G>C (p.Gly266Arg) rs1057519990
NM_000546.5(TP53):c.797G>A (p.Gly266Glu) rs193920774
NM_000546.5(TP53):c.799C>T (p.Arg267Trp) rs55832599
NM_000546.5(TP53):c.79C>A (p.Pro27Thr) rs922736614
NM_000546.5(TP53):c.79C>T (p.Pro27Ser) rs922736614
NM_000546.5(TP53):c.800G>A (p.Arg267Gln) rs587780075
NM_000546.5(TP53):c.800G>C (p.Arg267Pro) rs587780075
NM_000546.5(TP53):c.801dup (p.Asn268fs)
NM_000546.5(TP53):c.805A>C (p.Ser269Arg)
NM_000546.5(TP53):c.809T>C (p.Phe270Ser) rs1057519986
NM_000546.5(TP53):c.80C>G (p.Pro27Arg)
NM_000546.5(TP53):c.811G>A (p.Glu271Lys) rs1060501191
NM_000546.5(TP53):c.811_812delinsTT (p.Glu271Leu) rs1567548090
NM_000546.5(TP53):c.812_815dup (p.Arg273fs)
NM_000546.5(TP53):c.814G>A (p.Val272Met) rs121912657
NM_000546.5(TP53):c.814G>C (p.Val272Leu)
NM_000546.5(TP53):c.814G>T (p.Val272Leu) rs121912657
NM_000546.5(TP53):c.815T>C (p.Val272Ala)
NM_000546.5(TP53):c.817C>A (p.Arg273Ser) rs121913343
NM_000546.5(TP53):c.817C>G (p.Arg273Gly) rs121913343
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.5(TP53):c.818G>C (p.Arg273Pro) rs28934576
NM_000546.5(TP53):c.818G>T (p.Arg273Leu) rs28934576
NM_000546.5(TP53):c.818_819GT[1] (p.Val274fs) rs1567547933
NM_000546.5(TP53):c.820G>C (p.Val274Leu) rs1057520005
NM_000546.5(TP53):c.821T>G (p.Val274Gly) rs1057520006
NM_000546.5(TP53):c.823T>C (p.Cys275Arg) rs1057519983
NM_000546.5(TP53):c.824G>A (p.Cys275Tyr) rs863224451
NM_000546.5(TP53):c.824G>C (p.Cys275Ser) rs863224451
NM_000546.5(TP53):c.824G>T (p.Cys275Phe) rs863224451
NM_000546.5(TP53):c.826G>C (p.Ala276Pro) rs1131691029
NM_000546.5(TP53):c.829T>C (p.Cys277Arg) rs1064795369
NM_000546.5(TP53):c.830G>A (p.Cys277Tyr) rs763098116
NM_000546.5(TP53):c.830G>C (p.Cys277Ser)
NM_000546.5(TP53):c.830G>T (p.Cys277Phe) rs763098116
NM_000546.5(TP53):c.831T>A (p.Cys277Ter) rs1057523347
NM_000546.5(TP53):c.831_848dup (p.Pro278_Arg283dup) rs786204061
NM_000546.5(TP53):c.832C>G (p.Pro278Ala) rs17849781
NM_000546.5(TP53):c.832C>T (p.Pro278Ser) rs17849781
NM_000546.5(TP53):c.833C>A (p.Pro278His) rs876659802
NM_000546.5(TP53):c.833C>G (p.Pro278Arg) rs876659802
NM_000546.5(TP53):c.835G>A (p.Gly279Arg) rs1555525248
NM_000546.5(TP53):c.837_838GA[2] (p.Asp281fs) rs1567547661
NM_000546.5(TP53):c.838A>G (p.Arg280Gly) rs753660142
NM_000546.5(TP53):c.839G>A (p.Arg280Lys) rs121912660
NM_000546.5(TP53):c.839G>C (p.Arg280Thr) rs121912660
NM_000546.5(TP53):c.839G>T (p.Arg280Ile) rs121912660
NM_000546.5(TP53):c.841G>A (p.Asp281Asn) rs764146326
NM_000546.5(TP53):c.841G>T (p.Asp281Tyr) rs764146326
NM_000546.5(TP53):c.842A>G (p.Asp281Gly) rs587781525
NM_000546.5(TP53):c.842A>T (p.Asp281Val) rs587781525
NM_000546.5(TP53):c.843C>A (p.Asp281Glu) rs1057519984
NM_000546.5(TP53):c.843C>G (p.Asp281Glu) rs1057519984
NM_000546.5(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.5(TP53):c.844_847delinsAG (p.Arg283fs) rs1555525209
NM_000546.5(TP53):c.845G>A (p.Arg282Gln) rs730882008
NM_000546.5(TP53):c.845G>C (p.Arg282Pro) rs730882008
NM_000546.5(TP53):c.845G>T (p.Arg282Leu) rs730882008
NM_000546.5(TP53):c.847C>G (p.Arg283Gly)
NM_000546.5(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_000546.5(TP53):c.848G>A (p.Arg283His) rs371409680
NM_000546.5(TP53):c.848_857del (p.Arg283fs) rs1555525170
NM_000546.5(TP53):c.848_867dup (p.Arg290fs)
NM_000546.5(TP53):c.849C>G (p.Arg283=) rs1555525197
NM_000546.5(TP53):c.850A>T (p.Thr284Ser) rs1204379654
NM_000546.5(TP53):c.851C>T (p.Thr284Ile) rs863224685
NM_000546.5(TP53):c.853G>A (p.Glu285Lys) rs112431538
NM_000546.5(TP53):c.854A>T (p.Glu285Val) rs121912667
NM_000546.5(TP53):c.856G>A (p.Glu286Lys) rs786201059
NM_000546.5(TP53):c.857A>G (p.Glu286Gly) rs1057519985
NM_000546.5(TP53):c.859G>A (p.Glu287Lys) rs587782006
NM_000546.5(TP53):c.85_87AAC[1] (p.Asn30del) rs587782270
NM_000546.5(TP53):c.867C>T (p.Leu289=) rs778138282
NM_000546.5(TP53):c.868C>T (p.Arg290Cys) rs770374782
NM_000546.5(TP53):c.869G>A (p.Arg290His) rs55819519
NM_000546.5(TP53):c.869G>C (p.Arg290Pro) rs55819519
NM_000546.5(TP53):c.86del (p.Asn29fs) rs1555526931
NM_000546.5(TP53):c.870_871delinsAC (p.Lys291Gln) rs1060501205
NM_000546.5(TP53):c.870dup (p.Lys291fs) rs1555525140
NM_000546.5(TP53):c.871A>G (p.Lys291Glu) rs1555525126
NM_000546.5(TP53):c.873G>C (p.Lys291Asn) rs372613518
NM_000546.5(TP53):c.875A>G (p.Lys292Arg) rs121912663
NM_000546.5(TP53):c.875A>T (p.Lys292Ile) rs121912663
NM_000546.5(TP53):c.877G>T (p.Gly293Trp) rs587780076
NM_000546.5(TP53):c.87C>G (p.Asn29Lys)
NM_000546.5(TP53):c.884C>T (p.Pro295Leu) rs751713111
NM_000546.5(TP53):c.885T>C (p.Pro295=) rs200073907
NM_000546.5(TP53):c.886C>T (p.His296Tyr) rs672601296
NM_000546.5(TP53):c.891C>A (p.His297Gln)
NM_000546.5(TP53):c.891C>T (p.His297=) rs750578863
NM_000546.5(TP53):c.892G>A (p.Glu298Lys) rs201744589
NM_000546.5(TP53):c.892G>T (p.Glu298Ter) rs201744589
NM_000546.5(TP53):c.894G>A (p.Glu298=) rs756123992
NM_000546.5(TP53):c.895C>T (p.Leu299=) rs752701561
NM_000546.5(TP53):c.8A>G (p.Glu3Gly) rs786203938
NM_000546.5(TP53):c.901_902dup (p.Gly302fs)
NM_000546.5(TP53):c.903A>G (p.Pro301=) rs72661120
NM_000546.5(TP53):c.904G>C (p.Gly302Arg) rs863224686
NM_000546.5(TP53):c.905G>A (p.Gly302Glu) rs1060501202
NM_000546.5(TP53):c.907A>G (p.Ser303Gly) rs587782391
NM_000546.5(TP53):c.908G>A (p.Ser303Asn) rs876658714
NM_000546.5(TP53):c.90C>T (p.Asn30=) rs370992294
NM_000546.5(TP53):c.916C>A (p.Arg306=) rs121913344
NM_000546.5(TP53):c.916C>T (p.Arg306Ter) rs121913344
NM_000546.5(TP53):c.917G>A (p.Arg306Gln) rs1048095040
NM_000546.5(TP53):c.917_919+10del rs1555525040
NM_000546.5(TP53):c.917_919+15delGAGGTAAGCAAGCAGGAC
NM_000546.5(TP53):c.917_919+6delGAGGTAAGC rs1567546716
NM_000546.5(TP53):c.919+1G>A rs1131691039
NM_000546.5(TP53):c.919+2T>G rs1131691016
NM_000546.5(TP53):c.919+5G>C rs766127339
NM_000546.5(TP53):c.919+7A>C rs199527475
NM_000546.5(TP53):c.919+8A>C rs1555525043
NM_000546.5(TP53):c.919+9G>A rs772829199
NM_000546.5(TP53):c.91G>A (p.Val31Ile) rs201753350
NM_000546.5(TP53):c.920-1G>C rs587781702
NM_000546.5(TP53):c.920-2A>G rs397516439
NM_000546.5(TP53):c.920-4C>G rs1555525022
NM_000546.5(TP53):c.920-5C>A rs34361146
NM_000546.5(TP53):c.920-5C>T rs34361146
NM_000546.5(TP53):c.920-8T>C rs1555525024
NM_000546.5(TP53):c.920C>T (p.Ala307Val)
NM_000546.5(TP53):c.924G>C (p.Leu308=) rs786202546
NM_000546.5(TP53):c.925C>T (p.Pro309Ser) rs1555525012
NM_000546.5(TP53):c.928A>G (p.Asn310Asp)
NM_000546.5(TP53):c.930C>A (p.Asn310Lys) rs876660829
NM_000546.5(TP53):c.931A>C (p.Asn311His) rs1555525007
NM_000546.5(TP53):c.932A>C (p.Asn311Thr) rs56184981
NM_000546.5(TP53):c.932A>G (p.Asn311Ser) rs56184981
NM_000546.5(TP53):c.933C>T (p.Asn311=) rs201601993
NM_000546.5(TP53):c.935C>G (p.Thr312Ser) rs145151284
NM_000546.5(TP53):c.936C>G (p.Thr312=) rs1555524991
NM_000546.5(TP53):c.941C>T (p.Ser314Phe) rs751440465
NM_000546.5(TP53):c.942C>A (p.Ser314=) rs765930028
NM_000546.5(TP53):c.943T>A (p.Ser315Thr) rs762620193
NM_000546.5(TP53):c.945del (p.Gln317fs)
NM_000546.5(TP53):c.946C>A (p.Pro316Thr) rs772773208
NM_000546.5(TP53):c.947C>T (p.Pro316Leu) rs1555524979
NM_000546.5(TP53):c.949C>A (p.Gln317Lys) rs764735889
NM_000546.5(TP53):c.949C>T (p.Gln317Ter) rs764735889
NM_000546.5(TP53):c.949del (p.Gln317fs) rs1567546196
NM_000546.5(TP53):c.950A>G (p.Gln317Arg) rs1159579789
NM_000546.5(TP53):c.951G>T (p.Gln317His) rs1060501199
NM_000546.5(TP53):c.957_959GAA[1] (p.Lys321del) rs1567546114
NM_000546.5(TP53):c.96+1G>T rs1131691003
NM_000546.5(TP53):c.96+5G>A rs1567557622
NM_000546.5(TP53):c.964C>T (p.Pro322Ser) rs863224687
NM_000546.5(TP53):c.96G>A (p.Leu32=)
NM_000546.5(TP53):c.97-11C>G
NM_000546.5(TP53):c.97-15T>C rs1555526843
NM_000546.5(TP53):c.97-1G>A
NM_000546.5(TP53):c.97-1G>T
NM_000546.5(TP53):c.97-28T>A rs200989844
NM_000546.5(TP53):c.97-3C>T rs786203749
NM_000546.5(TP53):c.97-4A>T rs746791390
NM_000546.5(TP53):c.97-6C>T rs35117667
NM_000546.5(TP53):c.97-9C>T rs202217267
NM_000546.5(TP53):c.970G>C (p.Asp324His) rs1064794810
NM_000546.5(TP53):c.973G>T (p.Gly325Ter) rs863224500
NM_000546.5(TP53):c.974G>T (p.Gly325Val) rs121912659
NM_000546.5(TP53):c.975A>G (p.Gly325=) rs1245012034
NM_000546.5(TP53):c.976G>T (p.Glu326Ter) rs876659384
NM_000546.5(TP53):c.983T>C (p.Phe328Ser)
NM_000546.5(TP53):c.986C>T (p.Thr329Ile)
NM_000546.5(TP53):c.989T>C (p.Leu330Pro)
NM_000546.5(TP53):c.98C>A (p.Ser33Tyr) rs1555526832
NM_000546.5(TP53):c.98C>T (p.Ser33Phe)
NM_000546.5(TP53):c.990_993del (p.Gln331fs) rs1555524949
NM_000546.5(TP53):c.993+12T>C rs1800899
NM_000546.5(TP53):c.993+13G>C rs369599972
NM_000546.5(TP53):c.993+1G>A rs11575997
NM_000546.5(TP53):c.993+1G>C rs11575997
NM_000546.5(TP53):c.993+234G>A rs17883348
NM_000546.5(TP53):c.993+244G>A rs576532147
NM_000546.5(TP53):c.993+312_993+314delCGT rs1555524872
NM_000546.5(TP53):c.993+326_993+341del rs730882013
NM_000546.5(TP53):c.993+5T>G
NM_000546.5(TP53):c.993+7A>G rs1023206153
NM_000546.5(TP53):c.993+8G>A rs1060504163
NM_000546.5(TP53):c.993G>A (p.Gln331=) rs11575996
NM_000546.5(TP53):c.994-17C>T rs368691910
NM_000546.5(TP53):c.994-1G>C rs587782272
NM_000546.5(TP53):c.994-5T>C rs375273756
NM_000546.5(TP53):c.994-6C>A rs1555524474
NM_000546.5(TP53):c.996C>G (p.Ile332Met) rs1555524470
NM_000546.5(TP53):c.997C>T (p.Arg333Cys) rs769934890
NM_000546.5(TP53):c.998G>A (p.Arg333His) rs573154688
NM_000551.3(VHL):c.(?_464)_642+?del
NM_000551.3(VHL):c.*1023G>A rs1681669
NM_000551.3(VHL):c.*1060C>T rs1681668
NM_000551.3(VHL):c.*1072C>T rs886057715
NM_000551.3(VHL):c.*1172C>T rs528852958
NM_000551.3(VHL):c.*1207G>A rs139557214
NM_000551.3(VHL):c.*1249G>A rs886057716
NM_000551.3(VHL):c.*1281A>G rs886057717
NM_000551.3(VHL):c.*1328C>A rs78562649
NM_000551.3(VHL):c.*1330A>G rs886057718
NM_000551.3(VHL):c.*1347C>A rs886057719
NM_000551.3(VHL):c.*1371A>G rs771759826
NM_000551.3(VHL):c.*1419A>G rs141916278
NM_000551.3(VHL):c.*1452A>T rs552760935
NM_000551.3(VHL):c.*1465C>A rs183067022
NM_000551.3(VHL):c.*1481G>A rs886057720
NM_000551.3(VHL):c.*1513A>G rs538580892
NM_000551.3(VHL):c.*1617G>T rs886057721
NM_000551.3(VHL):c.*1619T>C rs145608408
NM_000551.3(VHL):c.*1643C>A rs886057722
NM_000551.3(VHL):c.*1677C>T rs886057723
NM_000551.3(VHL):c.*1680T>C rs561087293
NM_000551.3(VHL):c.*1691A>G rs539201437
NM_000551.3(VHL):c.*1721C>G rs574191130
NM_000551.3(VHL):c.*1741G>T rs886057724
NM_000551.3(VHL):c.*1780C>G rs886057725
NM_000551.3(VHL):c.*1782T>G rs886057726
NM_000551.3(VHL):c.*1808A>G rs886057727
NM_000551.3(VHL):c.*1860A>G rs458106
NM_000551.3(VHL):c.*1867A>G rs566885734
NM_000551.3(VHL):c.*1887C>A rs886057728
NM_000551.3(VHL):c.*1922G>A rs886057729
NM_000551.3(VHL):c.*1960G>A rs9822696
NM_000551.3(VHL):c.*1973_*1979delGTAATCC rs149248243
NM_000551.3(VHL):c.*1990G>A rs113678809
NM_000551.3(VHL):c.*2034T>A rs1136249
NM_000551.3(VHL):c.*2034T>G rs1136249
NM_000551.3(VHL):c.*2090delT rs886057730
NM_000551.3(VHL):c.*2093delC rs886057731
NM_000551.3(VHL):c.*2094delT rs886057732
NM_000551.3(VHL):c.*2117delA rs757106274
NM_000551.3(VHL):c.*2118delT rs886057733
NM_000551.3(VHL):c.*2140C>T rs140614750
NM_000551.3(VHL):c.*2224A>G rs886057734
NM_000551.3(VHL):c.*2419dupA rs564788050
NM_000551.3(VHL):c.*2432T>G rs886057736
NM_000551.3(VHL):c.*2468C>T rs138237298
NM_000551.3(VHL):c.*2540_*2545delTTTTTT rs71052299
NM_000551.3(VHL):c.*2541_*2546delTTTTTG rs886057738
NM_000551.3(VHL):c.*2543_*2546delTTTG rs886057739
NM_000551.3(VHL):c.*2545delT rs71052299
NM_000551.3(VHL):c.*2548G>A rs187719061
NM_000551.3(VHL):c.*2548_*2549delGA rs886057740
NM_000551.3(VHL):c.*2562C>T rs747406421
NM_000551.3(VHL):c.*2571A>G rs886057741
NM_000551.3(VHL):c.*2594C>A rs191582744
NM_000551.3(VHL):c.*2600T>A rs142728549
NM_000551.3(VHL):c.*2647C>A rs886057742
NM_000551.3(VHL):c.*2660T>A rs886057743
NM_000551.3(VHL):c.*266_*269delTCAG rs886057704
NM_000551.3(VHL):c.*2670G>C rs886057744
NM_000551.3(VHL):c.*2715C>T rs578053681
NM_000551.3(VHL):c.*2716G>A rs538719970
NM_000551.3(VHL):c.*2738G>A rs886057745
NM_000551.3(VHL):c.*2762T>C rs886057746
NM_000551.3(VHL):c.*2782C>G rs886057747
NM_000551.3(VHL):c.*280A>G rs886057705
NM_000551.3(VHL):c.*2812A>C rs886057748
NM_000551.3(VHL):c.*2854G>T rs546347626
NM_000551.3(VHL):c.*294G>A rs1642742
NM_000551.3(VHL):c.*2960C>A rs886057749
NM_000551.3(VHL):c.*2975G>C rs801913
NM_000551.3(VHL):c.*2988G>A rs886057750
NM_000551.3(VHL):c.*3021T>C rs138933035
NM_000551.3(VHL):c.*303A>T rs573000980
NM_000551.3(VHL):c.*3128G>A rs886057751
NM_000551.3(VHL):c.*3205C>T rs561918442
NM_000551.3(VHL):c.*3222A>G rs886057752
NM_000551.3(VHL):c.*3249C>T rs886057753
NM_000551.3(VHL):c.*3261T>C rs886057754
NM_000551.3(VHL):c.*3330_*3336dupACAAAAA rs886057755
NM_000551.3(VHL):c.*3352G>A rs112130915
NM_000551.3(VHL):c.*3389G>A rs368247150
NM_000551.3(VHL):c.*3395C>T rs184144719
NM_000551.3(VHL):c.*3470G>T rs886057756
NM_000551.3(VHL):c.*3482dupA rs148013887
NM_000551.3(VHL):c.*3492_*3493dupAA rs112494627
NM_000551.3(VHL):c.*349G>T rs886057706
NM_000551.3(VHL):c.*3506G>T rs886057759
NM_000551.3(VHL):c.*3523T>G rs17610448
NM_000551.3(VHL):c.*3545C>A rs886057760
NM_000551.3(VHL):c.*3603C>T rs145137834
NM_000551.3(VHL):c.*3616C>T rs750516726
NM_000551.3(VHL):c.*3625T>A rs552161251
NM_000551.3(VHL):c.*3644_*3645insG rs201632485
NM_000551.3(VHL):c.*3645_*3646insGT rs1553620861
NM_000551.3(VHL):c.*385delT rs886057707
NM_000551.3(VHL):c.*392G>A rs886057708
NM_000551.3(VHL):c.*448G>T rs886057709
NM_000551.3(VHL):c.*523delG rs546118793
NM_000551.3(VHL):c.*574T>C rs143062510
NM_000551.3(VHL):c.*597G>A rs886057711
NM_000551.3(VHL):c.*635G>A rs886057712
NM_000551.3(VHL):c.*687C>A rs886057713
NM_000551.3(VHL):c.*724T>G rs13090104
NM_000551.3(VHL):c.*7C>G rs778005138
NM_000551.3(VHL):c.*816G>C rs142396182
NM_000551.3(VHL):c.*820A>G rs182781943
NM_000551.3(VHL):c.*823G>A rs7629500
NM_000551.3(VHL):c.*938_*942dupGTTTT rs544983652
NM_000551.3(VHL):c.*989C>T rs186084634
NM_000551.3(VHL):c.-125C>A rs886057700
NM_000551.3(VHL):c.-166C>T rs886057699
NM_000551.3(VHL):c.-195G>A rs779805
NM_000551.3(VHL):c.-207C>T rs886057698
NM_000551.3(VHL):c.-30C>T rs886057701
NM_000551.3(VHL):c.-64C>T rs772944298
NM_000551.3(VHL):c.-73C>T
NM_000551.3(VHL):c.-75_-55del rs727503744
NM_000551.3(VHL):c.-77C>T rs3087462
NM_000551.3(VHL):c.-77_-32del46 rs1553619239