ClinVar Miner

List of variants reported as pathogenic for adrenal gland disease by Invitae

Included ClinVar conditions (124):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 555
Download table as spreadsheet
HGVS dbSNP
NC_000001.10:g.(?_161284190)_(161332229_?)del
NC_000001.10:g.(?_161326457)_(161326640_?)del
NC_000001.10:g.(?_161326457)_(161332233_?)del
NC_000001.10:g.(?_161326467)_(161326630_?)del
NC_000001.10:g.(?_17345366)_(17345463_?)del
NC_000001.10:g.(?_17345366)_(17380524_?)del
NC_000001.10:g.(?_17345370)_(17359646_?)del
NC_000001.10:g.(?_17345370)_(17371389_?)del
NC_000001.10:g.(?_17345376)_(17397986_?)del
NC_000001.10:g.(?_17359545)_(17359650_?)del
NC_000001.10:g.(?_17359549)_(17359646_?)del
NC_000001.10:g.(?_17371246)_(17371393_?)del
NC_000001.10:g.(?_17371256)_(17371383_?)del
NC_000001.10:g.(?_17380433)_(17380524_?)del
NC_000001.10:g.(?_17380437)_(17380520_?)del
NC_000002.11:g.(?_96919536)_(96931129_?)del
NC_000003.11:g.(?_10094061)_(10191659_?)del
NC_000003.11:g.(?_10183319)_(10183871_?)del
NC_000003.11:g.(?_10183522)_(10183881_?)del
NC_000003.11:g.(?_10183522)_(10191659_?)del
NC_000003.11:g.(?_10188188)_(10188330_?)del
NC_000003.11:g.(?_10188188)_(10191659_?)del
NC_000003.11:g.(?_10188198)_(10188320_?)del
NC_000003.11:g.(?_10191461)_(10191659_?)del
NC_000011.9:g.(?_111957622)_(111965704_?)del
NC_000011.9:g.(?_111959581)_(111965704_?)del
NC_000011.9:g.(?_111965519)_(111965704_?)del
NC_000011.9:g.(?_111965523)_(111965700_?)del
NC_000011.9:g.(?_64570986)_(64572288_?)del
NC_000011.9:g.(?_64570986)_(64577604_?)del
NC_000011.9:g.(?_64571796)_(64578188_?)del
NC_000011.9:g.(?_64577131)_(64577587_?)del
NC_000014.8:g.(?_65560420)_(65569063_?)del
NC_000014.8:g.(?_65568254)_(65569067_?)del
NC_000014.8:g.(?_65568264)_(65569262_?)del
NC_000017.10:g.(?_66508520)_(66526600_?)del
NC_000017.10:g.(?_66511525)_(66525142_?)del
NC_000017.10:g.(?_66511535)_(66526596_?)del
NC_000017.10:g.(?_7572917)_(7579922_?)del
NC_000017.10:g.(?_7572917)_(7591611_?)del
NC_000017.10:g.(?_7572917)_(8285638_?)del
NC_000017.10:g.(?_7572921)_(7579918_?)del
NC_000017.10:g.(?_7590924)_(7591611_?)del
NC_000021.8:g.(?_45705870)_(45717630_?)del
NC_000023.10:g.(?_152954020)_(154096327_?)del
NC_000023.10:g.(?_152959340)_(153009209_?)del
NC_000023.10:g.(?_153005536)_(153005701_?)del
NC_000023.10:g.(?_153008421)_(153009209_?)del
NC_000023.10:g.(?_153008431)_(153009199_?)del
NC_000023.10:g.(?_153008655)_(153009209_?)del
NM_000033.4(ABCD1):c.-16_10del (p.Met1fs) rs387906497
NM_000033.4(ABCD1):c.1096A>T (p.Lys366Ter) rs1569541000
NM_000033.4(ABCD1):c.1101_1108dup (p.Leu370fs)
NM_000033.4(ABCD1):c.1126G>T (p.Glu376Ter)
NM_000033.4(ABCD1):c.1202G>A (p.Arg401Gln) rs128624219
NM_000033.4(ABCD1):c.1270C>T (p.Gln424Ter) rs1557054210
NM_000033.4(ABCD1):c.1415_1416del (p.Gln472fs) rs387906494
NM_000033.4(ABCD1):c.1454C>G (p.Ser485Ter)
NM_000033.4(ABCD1):c.146_159del (p.Pro49fs) rs1569540676
NM_000033.4(ABCD1):c.1532G>A (p.Cys511Tyr) rs1557054745
NM_000033.4(ABCD1):c.1552C>G (p.Arg518Gly) rs128624224
NM_000033.4(ABCD1):c.1628C>T (p.Pro543Leu) rs1557054776
NM_000033.4(ABCD1):c.1660dup (p.Arg554fs) rs1569541115
NM_000033.4(ABCD1):c.1679C>T (p.Pro560Leu) rs398123105
NM_000033.4(ABCD1):c.16_22delinsCT (p.Arg6fs) rs1557052133
NM_000033.4(ABCD1):c.1771C>T (p.Arg591Trp) rs398123106
NM_000033.4(ABCD1):c.1772G>A (p.Arg591Gln) rs1557054873
NM_000033.4(ABCD1):c.1780+2T>G rs1557054875
NM_000033.4(ABCD1):c.1784G>A (p.Trp595Ter)
NM_000033.4(ABCD1):c.1817C>T (p.Ser606Leu) rs128624225
NM_000033.4(ABCD1):c.1820_1823del (p.Gly607fs) rs1557055253
NM_000033.4(ABCD1):c.1825G>A (p.Glu609Lys) rs150346282
NM_000033.4(ABCD1):c.1849C>T (p.Arg617Cys) rs4010613
NM_000033.4(ABCD1):c.1850G>A (p.Arg617His) rs11146842
NM_000033.4(ABCD1):c.1876G>A (p.Ala626Thr) rs1557055316
NM_000033.4(ABCD1):c.1978C>T (p.Arg660Trp) rs1569541203
NM_000033.4(ABCD1):c.1998C>A (p.Tyr666Ter) rs1170974058
NM_000033.4(ABCD1):c.293C>T (p.Ser98Leu) rs1557052294
NM_000033.4(ABCD1):c.311G>A (p.Arg104His) rs1557052302
NM_000033.4(ABCD1):c.346G>C (p.Gly116Arg)
NM_000033.4(ABCD1):c.36del (p.Asn13fs)
NM_000033.4(ABCD1):c.408del (p.Gln136fs)
NM_000033.4(ABCD1):c.454C>T (p.Arg152Cys) rs1569540693
NM_000033.4(ABCD1):c.521A>G (p.Tyr174Cys) rs1557052390
NM_000033.4(ABCD1):c.537_544dup (p.Arg182fs) rs1557052397
NM_000033.4(ABCD1):c.70del (p.Leu24fs) rs1557052171
NM_000033.4(ABCD1):c.723del (p.Trp242fs)
NM_000033.4(ABCD1):c.761C>T (p.Thr254Met) rs1131691743
NM_000033.4(ABCD1):c.766_769dup (p.Val257fs) rs1557052530
NM_000033.4(ABCD1):c.796G>A (p.Gly266Arg) rs128624218
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000033.4(ABCD1):c.919C>T (p.Gln307Ter)
NM_000244.3(MEN1):c.1037G>A (p.Trp346Ter) rs1114167482
NM_000244.3(MEN1):c.1064+1G>A rs1114167489
NM_000244.3(MEN1):c.1065-2A>G
NM_000244.3(MEN1):c.1065-2A>T rs1565642765
NM_000244.3(MEN1):c.1102_1104del (p.Glu368del) rs869025185
NM_000244.3(MEN1):c.1189G>T (p.Glu397Ter) rs772588551
NM_000244.3(MEN1):c.1208dup (p.Ser404fs) rs1555164430
NM_000244.3(MEN1):c.1228C>T (p.Gln410Ter) rs864622615
NM_000244.3(MEN1):c.1234_1235del (p.Asp411_Pro412insTer)
NM_000244.3(MEN1):c.1235_1236del (p.Pro412fs)
NM_000244.3(MEN1):c.1239_1240insGTCC (p.Cys414fs) rs1114167524
NM_000244.3(MEN1):c.1258C>T (p.Arg420Ter) rs1060499974
NM_000244.3(MEN1):c.1267G>A (p.Asp423Asn) rs104894264
NM_000244.3(MEN1):c.1268_1271del (p.Asp423fs)
NM_000244.3(MEN1):c.1321T>A (p.Trp441Arg) rs104894259
NM_000244.3(MEN1):c.1326del (p.Thr443fs)
NM_000244.3(MEN1):c.1339C>T (p.Gln447Ter) rs794728654
NM_000244.3(MEN1):c.1349del (p.Gly450fs) rs1565640081
NM_000244.3(MEN1):c.1365+1_1365+11del rs764570645
NM_000244.3(MEN1):c.1366-2_*132del rs1565634591
NM_000244.3(MEN1):c.1366_*820del (p.Val456fs)
NM_000244.3(MEN1):c.1390_1397del (p.Ser464fs) rs1555163883
NM_000244.3(MEN1):c.1393C>T (p.Arg465Ter) rs104894267
NM_000244.3(MEN1):c.1397_1404dup (p.Ala469fs) rs1114167531
NM_000244.3(MEN1):c.1397_1419dup (p.Glu474fs) rs1555163780
NM_000244.3(MEN1):c.1415_1428del (p.Ala472fs)
NM_000244.3(MEN1):c.1421_1428dup (p.Gly477fs) rs1114167536
NM_000244.3(MEN1):c.1427G>A (p.Trp476Ter) rs1060499991
NM_000244.3(MEN1):c.142del (p.Leu48fs) rs1555166681
NM_000244.3(MEN1):c.1435del (p.Glu479fs)
NM_000244.3(MEN1):c.1444G>T (p.Glu482Ter) rs863224526
NM_000244.3(MEN1):c.1488del (p.Glu496fs) rs1555163646
NM_000244.3(MEN1):c.1550C>G (p.Ser517Ter) rs141679530
NM_000244.3(MEN1):c.1561del (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1561dup (p.Arg521fs) rs767319284
NM_000244.3(MEN1):c.1594C>T (p.Arg532Ter) rs104894261
NM_000244.3(MEN1):c.1675C>T (p.Gln559Ter) rs794728631
NM_000244.3(MEN1):c.1679G>A (p.Ser560Asn) rs863224527
NM_000244.3(MEN1):c.1685del (p.Lys562fs)
NM_000244.3(MEN1):c.1689dup (p.Lys564fs) rs1565635941
NM_000244.3(MEN1):c.168del (p.Asn57fs) rs1060499990
NM_000244.3(MEN1):c.191_195AGCCC[3] (p.Asp70fs) rs1555166609
NM_000244.3(MEN1):c.197_201GCCCC[3] (p.Asp70fs) rs730882136
NM_000244.3(MEN1):c.211_212del (p.Pro71fs) rs386134251
NM_000244.3(MEN1):c.231C>G (p.Tyr77Ter) rs1555166567
NM_000244.3(MEN1):c.237del (p.Val80fs) rs1114167486
NM_000244.3(MEN1):c.249_252del (p.Ile85fs) rs587776841
NM_000244.3(MEN1):c.252_253insTT (p.Ile85fs) rs386134253
NM_000244.3(MEN1):c.280_284dup (p.Gln96fs) rs1555166494
NM_000244.3(MEN1):c.307del (p.Leu103fs) rs794728639
NM_000244.3(MEN1):c.317_318del (p.Tyr106fs) rs1555166466
NM_000244.3(MEN1):c.318T>A (p.Tyr106Ter) rs1060499987
NM_000244.3(MEN1):c.322C>T (p.Arg108Ter) rs794728647
NM_000244.3(MEN1):c.322_323insT (p.Arg108fs) rs1565651568
NM_000244.3(MEN1):c.323del (p.Arg108fs) rs878855191
NM_000244.3(MEN1):c.346G>T (p.Glu116Ter) rs1060499992
NM_000244.3(MEN1):c.355_357AAG[1] (p.Lys120del) rs794728657
NM_000244.3(MEN1):c.358A>T (p.Lys120Ter) rs878855192
NM_000244.3(MEN1):c.378G>A (p.Trp126Ter) rs1555166365
NM_000244.3(MEN1):c.386del (p.Leu129fs) rs1565651223
NM_000244.3(MEN1):c.3G>A (p.Met1Ile) rs786204242
NM_000244.3(MEN1):c.402del (p.Phe134fs) rs397515385
NM_000244.3(MEN1):c.406_415delinsTCCCT (p.Asp136fs)
NM_000244.3(MEN1):c.421C>T (p.Gln141Ter) rs886039553
NM_000244.3(MEN1):c.461-1G>C
NM_000244.3(MEN1):c.493G>C (p.Ala165Pro) rs1565648656
NM_000244.3(MEN1):c.510C>A (p.Cys170Ter)
NM_000244.3(MEN1):c.563G>A (p.Trp188Ter) rs794728650
NM_000244.3(MEN1):c.578_579del (p.Pro193fs) rs1555165756
NM_000244.3(MEN1):c.609G>A (p.Trp203Ter) rs104894257
NM_000244.3(MEN1):c.638_1065-143del
NM_000244.3(MEN1):c.640C>T (p.Gln214Ter) rs1565647767
NM_000244.3(MEN1):c.643_646del (p.Thr215fs) rs794728640
NM_000244.3(MEN1):c.648del (p.Asn217fs) rs878855196
NM_000244.3(MEN1):c.669+1G>T rs794728622
NM_000244.3(MEN1):c.670-1G>A
NM_000244.3(MEN1):c.674G>A (p.Trp225Ter) rs1565647197
NM_000244.3(MEN1):c.696C>A (p.Tyr232Ter) rs778921501
NM_000244.3(MEN1):c.754_760del (p.Ile252fs) rs1555165503
NM_000244.3(MEN1):c.761_764dup (p.Thr256fs)
NM_000244.3(MEN1):c.773del (p.Ser258fs)
NM_000244.3(MEN1):c.787C>T (p.Gln263Ter) rs886039416
NM_000244.3(MEN1):c.796C>T (p.Gln266Ter) rs1057520733
NM_000244.3(MEN1):c.798+1G>A rs794728652
NM_000244.3(MEN1):c.799-9G>A rs794728625
NM_000244.3(MEN1):c.810G>A (p.Trp270Ter)
NM_000244.3(MEN1):c.838del (p.Arg280fs) rs1555165360
NM_000244.3(MEN1):c.839+1G>T rs1060499976
NM_000244.3(MEN1):c.839G>A (p.Arg280Lys)
NM_000244.3(MEN1):c.843C>A (p.Tyr281Ter) rs1060503789
NM_000244.3(MEN1):c.85C>T (p.Arg29Ter) rs794728615
NM_000244.3(MEN1):c.928-2A>G rs1114167498
NM_000244.3(MEN1):c.955_1065-227del rs1555164870
NM_000244.3(MEN1):c.984C>A (p.Tyr328Ter) rs750904332
NM_000244.3(MEN1):c.984C>G (p.Tyr328Ter) rs750904332
NM_000319.4(PEX5):c.361G>T (p.Glu121Ter) rs1565673352
NM_000383.4(AIRE):c.1249dup (p.Leu417fs) rs786204567
NM_000383.4(AIRE):c.1273C>T (p.Gln425Ter)
NM_000383.4(AIRE):c.132+1_132+3delinsCT rs886041293
NM_000383.4(AIRE):c.21_43dup (p.Arg15delinsHisAlaGlyPheTer)
NM_000383.4(AIRE):c.232T>C (p.Trp78Arg) rs179363880
NM_000383.4(AIRE):c.469C>T (p.Gln157Ter) rs1488613451
NM_000383.4(AIRE):c.489dup (p.Lys164fs)
NM_000383.4(AIRE):c.769C>T (p.Arg257Ter) rs121434254
NM_000383.4(AIRE):c.958del (p.Leu320fs) rs1568928525
NM_000383.4(AIRE):c.967_979del (p.Leu323fs) rs386833675
NM_000475.5(NR0B1):c.516G>A (p.Trp172Ter) rs1555973131
NM_000475.5(NR0B1):c.528C>G (p.Tyr176Ter)
NM_000475.5(NR0B1):c.552del (p.Glu185fs) rs1555973115
NM_000475.5(NR0B1):c.901C>T (p.Gln301Ter) rs1555973010
NM_000475.5(NR0B1):c.919G>T (p.Glu307Ter) rs1324519932
NM_000546.5(TP53):c.-202_*1207del
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.1010G>A (p.Arg337His) rs121912664
NM_000546.5(TP53):c.1015G>T (p.Glu339Ter) rs17882252
NM_000546.5(TP53):c.1024C>T (p.Arg342Ter) rs730882029
NM_000546.5(TP53):c.1025G>C (p.Arg342Pro) rs375338359
NM_000546.5(TP53):c.1043_1051delinsG (p.Leu348_Lys351delinsTer) rs1567541951
NM_000546.5(TP53):c.1101-2A>G rs587781664
NM_000546.5(TP53):c.112del (p.Gln38fs) rs1555526795
NM_000546.5(TP53):c.140del (p.Pro47fs) rs1567557016
NM_000546.5(TP53):c.151G>T (p.Glu51Ter) rs1567556930
NM_000546.5(TP53):c.155_156del (p.Gln52fs) rs1555526750
NM_000546.5(TP53):c.156dup (p.Trp53fs) rs1555526748
NM_000546.5(TP53):c.158G>A (p.Trp53Ter) rs876658483
NM_000546.5(TP53):c.196dup (p.Met66fs)
NM_000546.5(TP53):c.216dup (p.Val73fs) rs730882018
NM_000546.5(TP53):c.250del (p.Ala84fs)
NM_000546.5(TP53):c.273G>A (p.Trp91Ter) rs876660548
NM_000546.5(TP53):c.295del (p.Ser99fs) rs1555526593
NM_000546.5(TP53):c.310C>T (p.Gln104Ter) rs1567555934
NM_000546.5(TP53):c.321C>A (p.Tyr107Ter) rs770776262
NM_000546.5(TP53):c.323_329dup (p.Leu111fs) rs1131691004
NM_000546.5(TP53):c.329G>C (p.Arg110Pro) rs11540654
NM_000546.5(TP53):c.329G>T (p.Arg110Leu) rs11540654
NM_000546.5(TP53):c.329_330delinsCC (p.Arg110Pro)
NM_000546.5(TP53):c.342dup (p.His115fs)
NM_000546.5(TP53):c.363_364TG[1] (p.Val122fs) rs587780067
NM_000546.5(TP53):c.372C>A (p.Cys124Ter) rs1555526478
NM_000546.5(TP53):c.375+1G>T
NM_000546.5(TP53):c.375G>A (p.Thr125=) rs55863639
NM_000546.5(TP53):c.383del (p.Pro128fs)
NM_000546.5(TP53):c.422G>A (p.Cys141Tyr) rs587781288
NM_000546.5(TP53):c.438G>A (p.Trp146Ter) rs1131691026
NM_000546.5(TP53):c.448_460del (p.Thr150fs) rs1064792930
NM_000546.5(TP53):c.451C>T (p.Pro151Ser) rs28934874
NM_000546.5(TP53):c.455C>T (p.Pro152Leu) rs587782705
NM_000546.5(TP53):c.45del (p.Gln16fs) rs1555526997
NM_000546.5(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.5(TP53):c.473G>T (p.Arg158Leu) rs587782144
NM_000546.5(TP53):c.473_474delinsTT (p.Arg158Leu) rs1567553501
NM_000546.5(TP53):c.488A>G (p.Tyr163Cys) rs148924904
NM_000546.5(TP53):c.492_493delinsCT (p.Lys164_Gln165delinsAsnTer) rs1567553215
NM_000546.5(TP53):c.493C>T (p.Gln165Ter) rs730882001
NM_000546.5(TP53):c.499C>T (p.Gln167Ter) rs1555526097
NM_000546.5(TP53):c.501del (p.Gln167fs) rs1567553148
NM_000546.5(TP53):c.509_510dup (p.Glu171fs)
NM_000546.5(TP53):c.511G>T (p.Glu171Ter) rs587781845
NM_000546.5(TP53):c.517G>A (p.Val173Met) rs876660754
NM_000546.5(TP53):c.517G>T (p.Val173Leu) rs876660754
NM_000546.5(TP53):c.517_535dup (p.His179fs) rs1567552753
NM_000546.5(TP53):c.522_559+5delGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAG rs1555525957
NM_000546.5(TP53):c.523C>G (p.Arg175Gly) rs138729528
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.527G>A (p.Cys176Tyr) rs786202962
NM_000546.5(TP53):c.535C>T (p.His179Tyr) rs587780070
NM_000546.5(TP53):c.537T>A (p.His179Gln) rs876660821
NM_000546.5(TP53):c.537T>G (p.His179Gln) rs876660821
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.542G>A (p.Arg181His) rs397514495
NM_000546.5(TP53):c.551_554del (p.Asp184fs)
NM_000546.5(TP53):c.574C>T (p.Gln192Ter) rs866380588
NM_000546.5(TP53):c.584T>C (p.Ile195Thr) rs760043106
NM_000546.5(TP53):c.586C>T (p.Arg196Ter) rs397516435
NM_000546.5(TP53):c.626_627del (p.Arg209fs) rs1057517840
NM_000546.5(TP53):c.637C>T (p.Arg213Ter) rs397516436
NM_000546.5(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.5(TP53):c.652G>A (p.Val218Met) rs878854072
NM_000546.5(TP53):c.659A>C (p.Tyr220Ser) rs121912666
NM_000546.5(TP53):c.659A>G (p.Tyr220Cys) rs121912666
NM_000546.5(TP53):c.661G>T (p.Glu221Ter) rs786201592
NM_000546.5(TP53):c.662del (p.Glu221fs) rs878854071
NM_000546.5(TP53):c.672+1G>A rs863224499
NM_000546.5(TP53):c.672G>A (p.Glu224=) rs267605076
NM_000546.5(TP53):c.673-1G>T rs878854073
NM_000546.5(TP53):c.673-2A>G rs1555525585
NM_000546.5(TP53):c.702_714del (p.His233_Tyr234insTer) rs1567549676
NM_000546.5(TP53):c.711del (p.Met237fs)
NM_000546.5(TP53):c.712T>C (p.Cys238Arg) rs1057519981
NM_000546.5(TP53):c.713G>T (p.Cys238Phe) rs730882005
NM_000546.5(TP53):c.714T>G (p.Cys238Trp) rs193920789
NM_000546.5(TP53):c.715_724del (p.Asn239fs) rs1555525518
NM_000546.5(TP53):c.716del (p.Asn239fs) rs1060501197
NM_000546.5(TP53):c.725G>A (p.Cys242Tyr) rs121912655
NM_000546.5(TP53):c.730G>A (p.Gly244Ser) rs1057519989
NM_000546.5(TP53):c.731G>A (p.Gly244Asp) rs985033810
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.733G>T (p.Gly245Cys) rs28934575
NM_000546.5(TP53):c.734G>A (p.Gly245Asp) rs121912656
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.5(TP53):c.766dup (p.Thr256fs)
NM_000546.5(TP53):c.788del (p.Asn263fs)
NM_000546.5(TP53):c.790del (p.Leu264fs) rs1060501194
NM_000546.5(TP53):c.794T>C (p.Leu265Pro) rs879253942
NM_000546.5(TP53):c.801dup (p.Asn268fs)
NM_000546.5(TP53):c.809T>C (p.Phe270Ser) rs1057519986
NM_000546.5(TP53):c.812_815dup (p.Arg273fs)
NM_000546.5(TP53):c.817C>G (p.Arg273Gly) rs121913343
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.5(TP53):c.818G>C (p.Arg273Pro) rs28934576
NM_000546.5(TP53):c.818G>T (p.Arg273Leu) rs28934576
NM_000546.5(TP53):c.818_819GT[1] (p.Val274fs) rs1567547933
NM_000546.5(TP53):c.831T>A (p.Cys277Ter) rs1057523347
NM_000546.5(TP53):c.837_838GA[2] (p.Asp281fs) rs1567547661
NM_000546.5(TP53):c.841G>A (p.Asp281Asn) rs764146326
NM_000546.5(TP53):c.841G>T (p.Asp281Tyr) rs764146326
NM_000546.5(TP53):c.842A>G (p.Asp281Gly) rs587781525
NM_000546.5(TP53):c.842A>T (p.Asp281Val) rs587781525
NM_000546.5(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.5(TP53):c.844_847delinsAG (p.Arg283fs) rs1555525209
NM_000546.5(TP53):c.845G>C (p.Arg282Pro) rs730882008
NM_000546.5(TP53):c.848_857del (p.Arg283fs) rs1555525170
NM_000546.5(TP53):c.848_867dup (p.Arg290fs)
NM_000546.5(TP53):c.853G>A (p.Glu285Lys) rs112431538
NM_000546.5(TP53):c.854A>T (p.Glu285Val) rs121912667
NM_000546.5(TP53):c.856G>A (p.Glu286Lys) rs786201059
NM_000546.5(TP53):c.86del (p.Asn29fs) rs1555526931
NM_000546.5(TP53):c.870dup (p.Lys291fs) rs1555525140
NM_000546.5(TP53):c.892G>T (p.Glu298Ter) rs201744589
NM_000546.5(TP53):c.901_902dup (p.Gly302fs)
NM_000546.5(TP53):c.916C>T (p.Arg306Ter) rs121913344
NM_000546.5(TP53):c.917_919+10del rs1555525040
NM_000546.5(TP53):c.917_919+15delGAGGTAAGCAAGCAGGAC
NM_000546.5(TP53):c.917_919+6delGAGGTAAGC rs1567546716
NM_000546.5(TP53):c.945del (p.Gln317fs)
NM_000546.5(TP53):c.949del (p.Gln317fs) rs1567546196
NM_000546.5(TP53):c.97-11C>G
NM_000546.5(TP53):c.973G>T (p.Gly325Ter) rs863224500
NM_000546.5(TP53):c.976G>T (p.Glu326Ter) rs876659384
NM_000546.5(TP53):c.990_993del (p.Gln331fs) rs1555524949
NM_000546.5(TP53):c.993+1G>A rs11575997
NM_000546.5(TP53):c.993+1G>C rs11575997
NM_000546.5(TP53):c.994-1G>C rs587782272
NM_000551.3(VHL):c.179_192del (p.Arg60fs) rs1064796408
NM_000551.3(VHL):c.191G>C (p.Arg64Pro) rs104893826
NM_000551.3(VHL):c.194C>T (p.Ser65Leu) rs5030826
NM_000551.3(VHL):c.224_226TCT[1] (p.Phe76del) rs5030648
NM_000551.3(VHL):c.226_227del (p.Phe76fs) rs1060503552
NM_000551.3(VHL):c.233A>G (p.Asn78Ser) rs5030804
NM_000551.3(VHL):c.245G>T (p.Arg82Leu) rs794726890
NM_000551.3(VHL):c.257C>G (p.Pro86Arg) rs730882034
NM_000551.3(VHL):c.258del (p.Val87fs) rs864622545
NM_000551.3(VHL):c.262T>A (p.Trp88Arg) rs1553619431
NM_000551.3(VHL):c.262T>C (p.Trp88Arg) rs1553619431
NM_000551.3(VHL):c.264G>C (p.Trp88Cys)
NM_000551.3(VHL):c.266T>C (p.Leu89Pro) rs5030807
NM_000551.3(VHL):c.277G>A (p.Gly93Ser) rs5030808
NM_000551.3(VHL):c.292T>C (p.Tyr98His) rs5030809
NM_000551.3(VHL):c.331A>T (p.Ser111Cys) rs1559426203
NM_000551.3(VHL):c.334T>C (p.Tyr112His) rs104893824
NM_000551.3(VHL):c.337C>T (p.Arg113Ter) rs5030810
NM_000551.3(VHL):c.339_340+5del
NM_000551.3(VHL):c.340G>A (p.Gly114Ser)
NM_000551.3(VHL):c.341-2A>G rs869025637
NM_000551.3(VHL):c.353T>C (p.Leu118Pro) rs5030830
NM_000551.3(VHL):c.355T>C (p.Phe119Leu) rs1553619948
NM_000551.3(VHL):c.357C>G (p.Phe119Leu) rs1559428077
NM_000551.3(VHL):c.370_371AC[2] (p.His125fs) rs869025644
NM_000551.3(VHL):c.377del (p.Asp126fs) rs1553619952
NM_000551.3(VHL):c.414A>G (p.Pro138=) rs869025648
NM_000551.3(VHL):c.415_416TC[2] (p.Leu140fs) rs869025649
NM_000551.3(VHL):c.422dup (p.Asn141fs) rs1553619976
NM_000551.3(VHL):c.430G>T (p.Gly144Ter) rs869025650
NM_000551.3(VHL):c.435_436del (p.Gln145fs) rs869025652
NM_000551.3(VHL):c.449del (p.Asn150fs) rs794727253
NM_000551.3(VHL):c.452T>C (p.Ile151Thr) rs869025655
NM_000551.3(VHL):c.461C>T (p.Pro154Leu)
NM_000551.3(VHL):c.463+1G>A rs869025657
NM_000551.3(VHL):c.463+2T>C
NM_000551.3(VHL):c.464-2A>G rs5030816
NM_000551.3(VHL):c.464-?_*3705del
NM_000551.3(VHL):c.472C>G (p.Leu158Val) rs1559429613
NM_000551.3(VHL):c.477del (p.Glu160fs) rs730882020
NM_000551.3(VHL):c.481C>T (p.Arg161Ter) rs5030818
NM_000551.3(VHL):c.482G>A (p.Arg161Gln) rs730882035
NM_000551.3(VHL):c.486C>G (p.Cys162Trp) rs5030622
NM_000551.3(VHL):c.490C>T (p.Gln164Ter) rs5030819
NM_000551.3(VHL):c.499C>T (p.Arg167Trp) rs5030820
NM_000551.3(VHL):c.500G>A (p.Arg167Gln) rs5030821
NM_000551.3(VHL):c.500G>T (p.Arg167Leu) rs5030821
NM_000551.3(VHL):c.501_502insTTGTCCGT (p.Ser168fs) rs398123483
NM_000551.3(VHL):c.524A>G (p.Tyr175Cys) rs193922613
NM_000551.3(VHL):c.525C>G (p.Tyr175Ter) rs5030835
NM_000551.3(VHL):c.533T>C (p.Leu178Pro) rs5030822
NM_000551.3(VHL):c.540_543del (p.Val181fs) rs869025664
NM_000551.3(VHL):c.548C>A (p.Ser183Ter) rs5030823
NM_000551.3(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000551.3(VHL):c.598C>T (p.Arg200Trp) rs28940298
NM_000941.3(POR):c.1370G>A (p.Arg457His) rs28931608
NM_000941.3(POR):c.1571_1619dup (p.Ala541fs) rs1563435458
NM_002382.5(MAX):c.120del (p.Asp41fs)
NM_002382.5(MAX):c.211_221del (p.Ile71fs) rs1060500101
NM_002382.5(MAX):c.219T>A (p.Tyr73Ter) rs1193255946
NM_002382.5(MAX):c.223C>T (p.Arg75Ter) rs387906650
NM_002382.5(MAX):c.228del (p.Asn78fs) rs1555340550
NM_002382.5(MAX):c.97C>T (p.Arg33Ter) rs387906651
NM_002734.4(PRKAR1A):c.177+1G>A rs1555811753
NM_002734.4(PRKAR1A):c.286C>T (p.Arg96Ter) rs281864783
NM_002734.4(PRKAR1A):c.289C>T (p.Arg97Ter) rs1555813217
NM_002734.4(PRKAR1A):c.46C>T (p.Arg16Ter) rs886041228
NM_002734.4(PRKAR1A):c.502+1G>A rs1555813578
NM_002734.4(PRKAR1A):c.660_661TG[1] (p.Val221fs) rs1568698487
NM_002734.4(PRKAR1A):c.671G>A (p.Trp224Ter) rs1568698504
NM_002734.4(PRKAR1A):c.764_768del (p.Ile255fs) rs1555814477
NM_002734.4(PRKAR1A):c.812dup (p.Leu271fs) rs1568701362
NM_003000.2(SDHB):c.-151_*159del
NM_003000.2(SDHB):c.112del (p.Arg38fs) rs398123690
NM_003000.2(SDHB):c.126del (p.Phe42fs) rs878854572
NM_003000.2(SDHB):c.136C>G (p.Arg46Gly) rs74315370
NM_003000.2(SDHB):c.136C>T (p.Arg46Ter) rs74315370
NM_003000.2(SDHB):c.137G>A (p.Arg46Gln) rs772551056
NM_003000.2(SDHB):c.141G>A (p.Trp47Ter) rs1060503762
NM_003000.2(SDHB):c.143_144dup (p.Pro49fs)
NM_003000.2(SDHB):c.148_151dup (p.Lys51fs)
NM_003000.2(SDHB):c.166_170del (p.Pro56fs) rs786202100
NM_003000.2(SDHB):c.190del (p.Asp64fs) rs1553178729
NM_003000.2(SDHB):c.200+5G>C rs1553178726
NM_003000.2(SDHB):c.20_21TC[1] (p.Ser8fs) rs1060503767
NM_003000.2(SDHB):c.210dup (p.Met71fs) rs794728947
NM_003000.2(SDHB):c.221A>C (p.Asp74Ala) rs876658713
NM_003000.2(SDHB):c.268C>T (p.Arg90Ter) rs74315366
NM_003000.2(SDHB):c.271A>T (p.Arg91Ter) rs878854575
NM_003000.2(SDHB):c.286+1G>A rs786201063
NM_003000.2(SDHB):c.286+2T>A rs587781270
NM_003000.2(SDHB):c.287-1G>C rs397516833
NM_003000.2(SDHB):c.311delinsGG (p.Asn104fs) rs786201316
NM_003000.2(SDHB):c.329_330CT[1] (p.Leu111fs) rs1060503751
NM_003000.2(SDHB):c.343C>T (p.Arg115Ter) rs751000085
NM_003000.2(SDHB):c.374C>G (p.Ser125Ter) rs786203506
NM_003000.2(SDHB):c.380T>G (p.Ile127Ser) rs786201095
NM_003000.2(SDHB):c.399dup (p.Tyr134fs) rs1557741425
NM_003000.2(SDHB):c.418G>T (p.Val140Phe) rs267607032
NM_003000.2(SDHB):c.423+1G>A rs398122805
NM_003000.2(SDHB):c.441T>G (p.Tyr147Ter) rs1060503763
NM_003000.2(SDHB):c.491del (p.Gln164fs) rs1553177678
NM_003000.2(SDHB):c.499A>T (p.Lys167Ter) rs1060503753
NM_003000.2(SDHB):c.502C>T (p.Gln168Ter) rs1553177677
NM_003000.2(SDHB):c.505C>T (p.Gln169Ter) rs1553177676
NM_003000.2(SDHB):c.541-2A>G rs786201161
NM_003000.2(SDHB):c.574T>C (p.Cys192Arg) rs786202732
NM_003000.2(SDHB):c.587G>A (p.Cys196Tyr) rs876658367
NM_003000.2(SDHB):c.591del (p.Ser198fs) rs1060503757
NM_003000.2(SDHB):c.600G>T (p.Trp200Cys) rs397516836
NM_003000.2(SDHB):c.602G>A (p.Trp201Ter) rs1060503759
NM_003000.2(SDHB):c.607_616del (p.Gly203fs) rs587782617
NM_003000.2(SDHB):c.608del (p.Gly203fs) rs1553177436
NM_003000.2(SDHB):c.609_622dup (p.Gly208fs)
NM_003000.2(SDHB):c.620_621del (p.Leu207fs) rs1060503752
NM_003000.2(SDHB):c.63dup (p.Cys22fs)
NM_003000.2(SDHB):c.640C>T (p.Gln214Ter) rs876658461
NM_003000.2(SDHB):c.653G>A (p.Trp218Ter)
NM_003000.2(SDHB):c.656_707dup (p.Pro237_Phe238insAspTer)
NM_003000.2(SDHB):c.681_682AG[1] (p.Glu228fs) rs762812025
NM_003000.2(SDHB):c.685_686insCGCTTCACAGAGG (p.Glu229fs) rs1209914140
NM_003000.2(SDHB):c.688C>T (p.Arg230Cys) rs138996609
NM_003000.2(SDHB):c.689G>A (p.Arg230His) rs587782604
NM_003000.2(SDHB):c.689G>T (p.Arg230Leu) rs587782604
NM_003000.2(SDHB):c.697A>T (p.Lys233Ter) rs1553177285
NM_003000.2(SDHB):c.70C>T (p.Gln24Ter)
NM_003000.2(SDHB):c.714_715CT[1] (p.Ser239fs) rs587781266
NM_003000.2(SDHB):c.717dup (p.Leu240fs) rs1060503764
NM_003000.2(SDHB):c.72+1G>T rs587782703
NM_003000.2(SDHB):c.724C>T (p.Arg242Cys) rs786203251
NM_003000.2(SDHB):c.725G>A (p.Arg242His) rs74315368
NM_003000.2(SDHB):c.79C>T (p.Arg27Ter) rs74315369
NM_003001.3(SDHC):c.1A>G (p.Met1Val) rs755235380
NM_003001.3(SDHC):c.215del (p.Arg72fs) rs1553264218
NM_003001.3(SDHC):c.397C>T (p.Arg133Ter) rs764575966
NM_003001.3(SDHC):c.3G>A (p.Met1Ile) rs587776652
NM_003001.3(SDHC):c.406-?_*2318+?del
NM_003001.3(SDHC):c.43C>T (p.Arg15Ter) rs201286421
NM_003002.3(SDHD):c.-84_*831del
NM_003002.4(SDHD):c.10dup (p.Leu4fs) rs878854589
NM_003002.4(SDHD):c.112C>T (p.Arg38Ter) rs80338843
NM_003002.4(SDHD):c.129G>A (p.Trp43Ter) rs104894308
NM_003002.4(SDHD):c.13_14del (p.Trp5fs) rs1566690018
NM_003002.4(SDHD):c.155C>A (p.Ser52Ter) rs587782210
NM_003002.4(SDHD):c.170-1G>T rs1306475361
NM_003002.4(SDHD):c.173del (p.Gly58fs) rs878854590
NM_003002.4(SDHD):c.187_188TC[2] (p.Leu64fs) rs387906358
NM_003002.4(SDHD):c.1A>G (p.Met1Val) rs104894307
NM_003002.4(SDHD):c.1A>T (p.Met1Leu) rs104894307
NM_003002.4(SDHD):c.242C>T (p.Pro81Leu) rs80338844
NM_003002.4(SDHD):c.242del (p.Pro81fs) rs878854591
NM_003002.4(SDHD):c.274G>T (p.Asp92Tyr) rs80338845
NM_003002.4(SDHD):c.314G>A (p.Trp105Ter) rs1131691065
NM_003002.4(SDHD):c.315G>A (p.Trp105Ter) rs1060503769
NM_003002.4(SDHD):c.325C>T (p.Gln109Ter) rs1060503770
NM_003002.4(SDHD):c.337_340del (p.Asp113fs) rs587776648
NM_003002.4(SDHD):c.33C>A (p.Cys11Ter) rs104894309
NM_003002.4(SDHD):c.341A>G (p.Tyr114Cys) rs104894304
NM_003002.4(SDHD):c.342T>A (p.Tyr114Ter) rs1050032491
NM_003002.4(SDHD):c.361C>T (p.Gln121Ter) rs878854594
NM_003002.4(SDHD):c.3G>A (p.Met1Ile)
NM_003002.4(SDHD):c.3G>C (p.Met1Ile) rs80338842
NM_003002.4(SDHD):c.57del (p.Leu20fs) rs587776649
NM_003002.4(SDHD):c.64C>T (p.Arg22Ter) rs104894306
NM_003002.4(SDHD):c.92_93TC[1] (p.Ala33fs) rs397514034
NM_003002.4(SDHD):c.95C>A (p.Ser32Ter) rs104894305
NM_004168.3(SDHA):c.762_770+17delTGCCACAGGGTAGGAATCTCATTTCT rs1041809852
NM_004168.4(SDHA):c.1054C>T (p.Arg352Ter) rs746165168
NM_004168.4(SDHA):c.1151C>G (p.Ser384Ter) rs151170408
NM_004168.4(SDHA):c.1258C>T (p.Gln420Ter)
NM_004168.4(SDHA):c.1468G>T (p.Glu490Ter) rs1554000360
NM_004168.4(SDHA):c.1471G>T (p.Glu491Ter) rs778207102
NM_004168.4(SDHA):c.1526_1527delinsGA (p.Ser509Ter) rs1064793567
NM_004168.4(SDHA):c.1534C>T (p.Arg512Ter) rs748089700
NM_004168.4(SDHA):c.1547dup (p.Lys517fs) rs1554000378
NM_004168.4(SDHA):c.1579del (p.Arg527fs)
NM_004168.4(SDHA):c.1615dup (p.Ile539fs) rs1554001843
NM_004168.4(SDHA):c.1629T>G (p.Tyr543Ter) rs747249998
NM_004168.4(SDHA):c.223C>T (p.Arg75Ter) rs781764920
NM_004168.4(SDHA):c.253_256dup (p.Asn86delinsIleTer) rs1560986132
NM_004168.4(SDHA):c.28del (p.Leu10fs)
NM_004168.4(SDHA):c.378del (p.Thr126_Val127insTer) rs1553997617
NM_004168.4(SDHA):c.46_52dup (p.Leu18fs) rs1560980939
NM_004168.4(SDHA):c.508C>T (p.Gln170Ter)
NM_004168.4(SDHA):c.553C>T (p.Gln185Ter) rs775827529
NM_004168.4(SDHA):c.5C>A (p.Ser2Ter)
NM_004168.4(SDHA):c.615T>A (p.Tyr205Ter) rs876658486
NM_004168.4(SDHA):c.619_620delinsC (p.Ser208fs)
NM_004168.4(SDHA):c.628C>T (p.Arg210Ter) rs775143272
NM_004168.4(SDHA):c.644_645del (p.Tyr215fs) rs1560989804
NM_004168.4(SDHA):c.667del (p.Asp223fs) rs587782077
NM_004168.4(SDHA):c.688del (p.Glu230fs) rs1553998199
NM_004168.4(SDHA):c.722_726del (p.Asp241fs) rs1553998229
NM_004168.4(SDHA):c.775del (p.Tyr259fs) rs1553998606
NM_004168.4(SDHA):c.880C>T (p.Gln294Ter) rs1560992565
NM_004168.4(SDHA):c.91C>T (p.Arg31Ter) rs142441643
NM_004168.4(SDHA):c.942_945delinsTCC (p.Glu314fs)
NM_004168.4(SDHA):c.985C>T (p.Arg329Ter) rs771328239
NM_004168.4(SDHA):c.995_996del (p.Pro332fs) rs1560994766
NM_017841.2(SDHAF2):c.165G>A (p.Trp55Ter) rs774508076
NM_017841.2(SDHAF2):c.177dup (p.Asp60Ter) rs1554984631
NM_017841.2(SDHAF2):c.232G>A (p.Gly78Arg) rs113560320
NM_017841.2(SDHAF2):c.305_306insA (p.Asn103fs) rs753554501
NM_017849.3(TMEM127):c.-131-?_*3600del
NM_017849.3(TMEM127):c.117_120del (p.Ile41fs) rs121908816
NM_017849.3(TMEM127):c.124_125del (p.Thr42fs) rs1553437737
NM_017849.3(TMEM127):c.158G>A (p.Trp53Ter) rs121908818
NM_017849.3(TMEM127):c.245-1G>C
NM_017849.3(TMEM127):c.265_268del (p.Thr89fs) rs121908822
NM_017849.3(TMEM127):c.283del (p.Val95fs) rs1553437028
NM_017849.3(TMEM127):c.337del (p.Leu113fs) rs1558752468
NM_017849.3(TMEM127):c.397del (p.His133fs) rs1558752379
NM_017849.3(TMEM127):c.464T>A (p.Leu155Ter) rs886039439
NM_017849.3(TMEM127):c.469C>T (p.Gln157Ter) rs780133289
NM_017849.3(TMEM127):c.7del (p.Ala3fs) rs1558756727
NM_017929.6(PEX26):c.292C>T (p.Arg98Trp) rs62641228
NM_017929.6(PEX26):c.34dup (p.Leu12fs) rs61752129
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.