ClinVar Miner

List of variants in gene MSH2 studied for Lynch syndrome

Included ClinVar conditions (18):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1336
Download table as spreadsheet
HGVS dbSNP
MSH2, 32-KB DEL, EX1-6
MSH2, DEL 50 CODONS
NC_000002.11:g.(?_47630206)_(47630541_?)del
NC_000002.11:g.(?_47630206)_(47635694_?)del
NC_000002.11:g.(?_47630206)_(47710367_?)del
NC_000002.11:g.(?_47639553)_(47710367_?)del
NC_000002.11:g.(?_47698104)_(47710367_?)dup
NC_000002.11:g.(?_47709918)_(47710088_?)del
NM_000251.1(MSH2):c.(?_-68)_(*272_?)del
NM_000251.1(MSH2):c.-11844_1077-6021delins155
NM_000251.1(MSH2):c.-1753_645+922del
NM_000251.1(MSH2):c.-35298_1276+5697del
NM_000251.1(MSH2):c.-47156_1277-4980del
NM_000251.1(MSH2):c.-4729_367-353del
NM_000251.1(MSH2):c.-75398_1759+1708del
NM_000251.1(MSH2):c.-823_1076+5984del
NM_000251.1(MSH2):c.-956_1077-5607del
NM_000251.1(MSH2):c.1276+232_1386+3798del
NM_000251.1(MSH2):c.1387-3976_1662-364del
NM_000251.1(MSH2):c.1662-374_2458+467del
NM_000251.1(MSH2):c.1759+305_2006-34del
NM_000251.1(MSH2):c.1760-361_2634+838del
NM_000251.1(MSH2):c.211+1566_1277-3954del
NM_000251.1(MSH2):c.2210+116_2562del
NM_000251.1(MSH2):c.645+539_1077-3451del
NM_000251.1(MSH2):c.645+791_1076+4894del
NM_000251.1(MSH2):c.645+967_1076+5075del
NM_000251.1(MSH2):c.943-926_1077-1449del
NM_000251.1(MSH2):c.972_973insNM_002133.2:c.737-1292_737-1109
NM_000251.2(MSH2):c.(?_-1)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?dup
NM_000251.2(MSH2):c.(?_-68)_1276+?del
NM_000251.2(MSH2):c.(?_-68)_1386+?del
NM_000251.2(MSH2):c.(?_-68)_1661+?del
NM_000251.2(MSH2):c.(?_-68)_1759+?del
NM_000251.2(MSH2):c.(?_-68)_211+?del
NM_000251.2(MSH2):c.(?_-68)_2634+?del
NM_000251.2(MSH2):c.(?_-68)_366+?del
NM_000251.2(MSH2):c.(?_-68)_645+?del
NM_000251.2(MSH2):c.(?_-68)_645+?dup
NM_000251.2(MSH2):c.(?_-68)_792+?del
NM_000251.2(MSH2):c.(?_-68)_942+?del
NM_000251.2(MSH2):c.*129T>C rs587779059
NM_000251.2(MSH2):c.*141T>G rs17225053
NM_000251.2(MSH2):c.*221G>T rs587779060
NM_000251.2(MSH2):c.*226A>G rs17225060
NM_000251.2(MSH2):c.*251+2441A>C rs6544991
NM_000251.2(MSH2):c.*272+4059G>A rs6720549
NM_000251.2(MSH2):c.*52A>T rs886056138
NM_000251.2(MSH2):c.*7C>G rs886056137
NM_000251.2(MSH2):c.*95C>T rs587779062
NM_000251.2(MSH2):c.-118T>C rs2303425
NM_000251.2(MSH2):c.-125_1076+?del
NM_000251.2(MSH2):c.-125_1076+?dup1201
NM_000251.2(MSH2):c.-125_645+?del
NM_000251.2(MSH2):c.-12G>A rs1558450937
NM_000251.2(MSH2):c.-179C>T rs17224094
NM_000251.2(MSH2):c.-181G>A rs786201698
NM_000251.2(MSH2):c.-182C>T rs876658327
NM_000251.2(MSH2):c.-225G>C rs138068023
NM_000251.2(MSH2):c.-29C>T rs199841800
NM_000251.2(MSH2):c.-3G>C rs587779960
NM_000251.2(MSH2):c.-43G>C rs781492698
NM_000251.2(MSH2):c.-68-122C>T rs587779115
NM_000251.2(MSH2):c.-68-365T>G rs1863332
NM_000251.2(MSH2):c.-78_-77del rs587779182
NM_000251.2(MSH2):c.-81dupA rs587779187
NM_000251.2(MSH2):c.-94C>G rs786202841
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1000A>T (p.Lys334Ter) rs587779063
NM_000251.2(MSH2):c.1004C>T (p.Thr335Ile) rs63750602
NM_000251.2(MSH2):c.1006C>A (p.Pro336Thr) rs63751062
NM_000251.2(MSH2):c.1006C>T (p.Pro336Ser) rs63751062
NM_000251.2(MSH2):c.1007del (p.Pro336fs) rs587779064
NM_000251.2(MSH2):c.1008del (p.Gln337fs) rs879253899
NM_000251.2(MSH2):c.1009C>T (p.Gln337Ter) rs63750778
NM_000251.2(MSH2):c.1012G>A (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1013G>A (p.Gly338Glu) rs587779065
NM_000251.2(MSH2):c.1013G>C (p.Gly338Ala) rs587779065
NM_000251.2(MSH2):c.1015C>T (p.Gln339Ter) rs1558466577
NM_000251.2(MSH2):c.1016A>C (p.Gln339Pro) rs1060502006
NM_000251.2(MSH2):c.1017_1018del (p.Arg340fs) rs63750703
NM_000251.2(MSH2):c.1018dup (p.Arg340fs) rs63750703
NM_000251.2(MSH2):c.1021C>G (p.Leu341Val) rs748115066
NM_000251.2(MSH2):c.1022T>C (p.Leu341Pro) rs63751147
NM_000251.2(MSH2):c.1024G>A (p.Val342Ile) rs63749879
NM_000251.2(MSH2):c.1029C>A (p.Asn343Lys) rs1060501995
NM_000251.2(MSH2):c.1030C>A (p.Gln344Lys) rs63750245
NM_000251.2(MSH2):c.1030C>T (p.Gln344Ter) rs63750245
NM_000251.2(MSH2):c.1033T>G (p.Trp345Gly) rs1558466616
NM_000251.2(MSH2):c.1034G>A (p.Trp345Ter) rs63751027
NM_000251.2(MSH2):c.1035G>A (p.Trp345Ter) rs63750396
NM_000251.2(MSH2):c.1037_1038dup (p.Lys347fs) rs63751483
NM_000251.2(MSH2):c.103C>T (p.Arg35Cys) rs1060502034
NM_000251.2(MSH2):c.1043A>G (p.Gln348Arg) rs773177076
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1046C>G (p.Pro349Arg) rs587779067
NM_000251.2(MSH2):c.1046C>T (p.Pro349Leu) rs587779067
NM_000251.2(MSH2):c.1046_1047delinsGC (p.Pro349Arg) rs1558466685
NM_000251.2(MSH2):c.104G>A (p.Arg35His) rs1060502012
NM_000251.2(MSH2):c.1059del (p.Asn354fs) rs587779068
NM_000251.2(MSH2):c.1067T>G (p.Ile356Arg) rs753075410
NM_000251.2(MSH2):c.1069G>C (p.Glu357Gln) rs587779069
NM_000251.2(MSH2):c.1070A>C (p.Glu357Ala) rs150503781
NM_000251.2(MSH2):c.1071G>A (p.Glu357=) rs587781617
NM_000251.2(MSH2):c.1075A>T (p.Arg359Ter) rs587779070
NM_000251.2(MSH2):c.1076+17T>G rs587779071
NM_000251.2(MSH2):c.1076+1G>A rs267607940
NM_000251.2(MSH2):c.1076+1G>T rs267607940
NM_000251.2(MSH2):c.1076+23C>G rs377417056
NM_000251.2(MSH2):c.1076+3400C>T rs4952887
NM_000251.2(MSH2):c.1076+3A>T rs267607941
NM_000251.2(MSH2):c.1076+4T>A rs764606343
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-135_1276+119dup rs1553356484
NM_000251.2(MSH2):c.1077-15G>T rs753277524
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1077-1G>T rs267607944
NM_000251.2(MSH2):c.1077-2037G>T rs13425206
NM_000251.2(MSH2):c.1077-220_1276+6245del
NM_000251.2(MSH2):c.1077-2A>C rs267607943
NM_000251.2(MSH2):c.1077-2A>G rs267607943
NM_000251.2(MSH2):c.1077-2A>T rs267607943
NM_000251.2(MSH2):c.1077-35A>G rs267607942
NM_000251.2(MSH2):c.1077-66_1146del rs193922372
NM_000251.2(MSH2):c.1077-80G>A rs2347794
NM_000251.2(MSH2):c.1077-?_*(272_?)del
NM_000251.2(MSH2):c.1077-?_*279+?del
NM_000251.2(MSH2):c.1077-?_1276+?del
NM_000251.2(MSH2):c.1077-?_1276+?dup
NM_000251.2(MSH2):c.1077-?_1276+?dup200 rs1553356518
NM_000251.2(MSH2):c.1077-?_1386+?del
NM_000251.2(MSH2):c.1077-?_1386+?dup310
NM_000251.2(MSH2):c.1077-?_1661+?del
NM_000251.2(MSH2):c.1077-?_2005+?del
NM_000251.2(MSH2):c.1077A>T (p.Arg359Ser) rs63751617
NM_000251.2(MSH2):c.1077_1078ins173 (p.?)
NM_000251.2(MSH2):c.1077_1276del200 (p.Leu360Lysfs) rs1553356518
NM_000251.2(MSH2):c.1082A>G (p.Asn361Ser) rs587779072
NM_000251.2(MSH2):c.1083T>C (p.Asn361=) rs864622544
NM_000251.2(MSH2):c.1086A>T (p.Leu362Phe) rs63751699
NM_000251.2(MSH2):c.108T>C (p.Leu36=) rs876659034
NM_000251.2(MSH2):c.1097_1098insA (p.Phe366fs) rs267607693
NM_000251.2(MSH2):c.1099del (p.Phe366_Val367insTer) rs587779073
NM_000251.2(MSH2):c.10C>T (p.Gln4Ter)
NM_000251.2(MSH2):c.1108del (p.Ala370fs) rs63749814
NM_000251.2(MSH2):c.110del (p.Phe37fs) rs63751056
NM_000251.2(MSH2):c.1111G>C (p.Glu371Gln) rs1060501994
NM_000251.2(MSH2):c.1114T>C (p.Leu372=) rs770201760
NM_000251.2(MSH2):c.1118G>A (p.Arg373Lys) rs864622254
NM_000251.2(MSH2):c.1119del (p.Arg373fs) rs63750516
NM_000251.2(MSH2):c.1120C>T (p.Gln374Ter) rs63750558
NM_000251.2(MSH2):c.1124C>G (p.Thr375Ser) rs774539871
NM_000251.2(MSH2):c.1127_1128dup (p.Gln377fs) rs63751219
NM_000251.2(MSH2):c.1129C>T (p.Gln377Ter) rs63750267
NM_000251.2(MSH2):c.112G>T (p.Asp38Tyr) rs730881761
NM_000251.2(MSH2):c.1130A>G (p.Gln377Arg) rs776174711
NM_000251.2(MSH2):c.1139del (p.Leu380fs) rs63750039
NM_000251.2(MSH2):c.1144C>T (p.Arg382Cys) rs752373431
NM_000251.2(MSH2):c.1144dup (p.Arg382fs) rs63750496
NM_000251.2(MSH2):c.1145G>A (p.Arg382His) rs267607947
NM_000251.2(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.2(MSH2):c.114C>G (p.Asp38Glu) rs587779074
NM_000251.2(MSH2):c.1154C>T (p.Pro385Leu) rs564736113
NM_000251.2(MSH2):c.1158T>C (p.Asp386=) rs1060504421
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.115_123del (p.Arg39_Asp41del) rs863224831
NM_000251.2(MSH2):c.1165C>T (p.Arg389Ter) rs587779075
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.1171G>A (p.Ala391Thr) rs878853798
NM_000251.2(MSH2):c.1172C>T (p.Ala391Val) rs864622674
NM_000251.2(MSH2):c.1182T>G (p.Phe394Leu) rs374135434
NM_000251.2(MSH2):c.1183C>T (p.Gln395Ter) rs63750302
NM_000251.2(MSH2):c.1189C>T (p.Gln397Ter) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1191A>T (p.Gln397His) rs768694189
NM_000251.2(MSH2):c.1192dup (p.Ala398fs) rs63751169
NM_000251.2(MSH2):c.1193C>T (p.Ala398Val) rs1060502019
NM_000251.2(MSH2):c.1194A>G (p.Ala398=) rs1060504412
NM_000251.2(MSH2):c.1196_1197dup (p.Asn400fs) rs63749850
NM_000251.2(MSH2):c.119del (p.Gly40fs) rs63750984
NM_000251.2(MSH2):c.11A>T (p.Gln4Leu) rs754562075
NM_000251.2(MSH2):c.1201_1202dup (p.Leu401fs) rs869312768
NM_000251.2(MSH2):c.1203dup (p.Gln402fs) rs63750586
NM_000251.2(MSH2):c.1204C>A (p.Gln402Lys) rs63751412
NM_000251.2(MSH2):c.1204C>T (p.Gln402Ter) rs63751412
NM_000251.2(MSH2):c.1204del (p.Gln402fs) rs63751413
NM_000251.2(MSH2):c.1209T>C (p.Asp403=) rs1060504420
NM_000251.2(MSH2):c.1215C>A (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1215C>G (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1216C>T (p.Arg406Ter) rs63751108
NM_000251.2(MSH2):c.1216_1219dup (p.Leu407fs) rs63751192
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1219_1220CT[1] (p.Tyr408fs) rs587779076
NM_000251.2(MSH2):c.1221C>G (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1221C>T (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1222dup (p.Tyr408fs) rs63751142
NM_000251.2(MSH2):c.1223A>G (p.Tyr408Cys) rs63750379
NM_000251.2(MSH2):c.1223A>T (p.Tyr408Phe) rs63750379
NM_000251.2(MSH2):c.1224T>C (p.Tyr408=) rs63750132
NM_000251.2(MSH2):c.1224T>G (p.Tyr408Ter) rs63750132
NM_000251.2(MSH2):c.1225C>A (p.Gln409Lys) rs151244108
NM_000251.2(MSH2):c.1225C>G (p.Gln409Glu) rs151244108
NM_000251.2(MSH2):c.1226_1227del (p.Gln409fs) rs63750086
NM_000251.2(MSH2):c.1236_1268del (p.Asn412_Glu422del) rs587779077
NM_000251.2(MSH2):c.1238A>C (p.Gln413Pro) rs587779962
NM_000251.2(MSH2):c.123C>G (p.Asp41Glu) rs761960690
NM_000251.2(MSH2):c.1241T>C (p.Leu414Pro) rs587779078
NM_000251.2(MSH2):c.1243_1246del (p.Pro415fs) rs63751206
NM_000251.2(MSH2):c.1249_1253del (p.Val417fs) rs587779079
NM_000251.2(MSH2):c.1249del (p.Val417fs) rs63751059
NM_000251.2(MSH2):c.1251_1268delinsAGTT (p.Ile418fs) rs863225388
NM_000251.2(MSH2):c.1254A>G (p.Ile418Met) rs751431238
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1255C>T (p.Gln419Ter) rs63750006
NM_000251.2(MSH2):c.1261C>A (p.Leu421Met) rs63750228
NM_000251.2(MSH2):c.1262T>C (p.Leu421Pro) rs587779080
NM_000251.2(MSH2):c.1264G>A (p.Glu422Lys) rs63751712
NM_000251.2(MSH2):c.1264G>T (p.Glu422Ter) rs63751712
NM_000251.2(MSH2):c.1269dup (p.His424fs) rs63751667
NM_000251.2(MSH2):c.1271A>G (p.His424Arg) rs200429136
NM_000251.2(MSH2):c.1271dup (p.His424fs) rs587783055
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+10G>A rs374061707
NM_000251.2(MSH2):c.1276+11A>G rs189015988
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+1G>C rs267607950
NM_000251.2(MSH2):c.1276+1G>T rs267607950
NM_000251.2(MSH2):c.1276+23dup rs587779081
NM_000251.2(MSH2):c.1276+2T>A rs267607953
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1276+47T>A rs148018406
NM_000251.2(MSH2):c.1276+51C>A rs17217961
NM_000251.2(MSH2):c.1276+6765G>A rs3771274
NM_000251.2(MSH2):c.1277-118G>A rs1981929
NM_000251.2(MSH2):c.1277-14C>G rs267607951
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1277-1G>A rs267607948
NM_000251.2(MSH2):c.1277-1G>C rs267607948
NM_000251.2(MSH2):c.1277-212T>A rs1981928
NM_000251.2(MSH2):c.1277-2A>C rs267607949
NM_000251.2(MSH2):c.1277-2A>G rs267607949
NM_000251.2(MSH2):c.1277-2A>T rs267607949
NM_000251.2(MSH2):c.1277-4076_1386+1819del
NM_000251.2(MSH2):c.1277-571_1386+2327del
NM_000251.2(MSH2):c.1277-5849T>C rs17036577
NM_000251.2(MSH2):c.1277-6224_1386+4836del
NM_000251.2(MSH2):c.1277-6284_1386+4776del
NM_000251.2(MSH2):c.1277-6990T>G rs13408008
NM_000251.2(MSH2):c.1277-945A>C rs7607312
NM_000251.2(MSH2):c.1277-?_*(272_?)del
NM_000251.2(MSH2):c.1277-?_*(272_?)inv
NM_000251.2(MSH2):c.1277-?_1386+?del
NM_000251.2(MSH2):c.1277-?_1661+?del
NM_000251.2(MSH2):c.1277-?_1759+?del
NM_000251.2(MSH2):c.1277-?_2634+?del
NM_000251.2(MSH2):c.1278_1386+1del110 (p.Lys427Glyfs) rs1553361141
NM_000251.2(MSH2):c.1285C>T (p.Gln429Ter) rs63751693
NM_000251.2(MSH2):c.1286A>C (p.Gln429Pro) rs1558493372
NM_000251.2(MSH2):c.1287dup (p.Lys430fs) rs63751626
NM_000251.2(MSH2):c.1288A>T (p.Lys430Ter) rs63751646
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.1292T>A (p.Leu431Ter) rs63751315
NM_000251.2(MSH2):c.1293dup (p.Leu432fs) rs1553361162
NM_000251.2(MSH2):c.129T>G (p.Tyr43Ter) rs63750894
NM_000251.2(MSH2):c.12G>T (p.Gln4His) rs878853800
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1311_1334del24insNM_000251.1:c.1338_1361inv24 (p.Thr438_Ser445delinsPheSerLysPheGlnGluMetIle)
NM_000251.2(MSH2):c.1313C>T (p.Thr438Ile) rs1553361185
NM_000251.2(MSH2):c.1313_1315CTC[1] (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1316_1317CT[1] (p.Leu440fs) rs587779083
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1319_1326delinsCC (p.Leu440_Asp442delinsPro) rs63749931
NM_000251.2(MSH2):c.131C>T (p.Thr44Met) rs587779085
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1321dup (p.Thr441fs) rs63750807
NM_000251.2(MSH2):c.1331G>T (p.Arg444Leu) rs557339938
NM_000251.2(MSH2):c.1339T>G (p.Phe447Val) rs63751217
NM_000251.2(MSH2):c.1340_1341insGG (p.Phe447fs) rs267607696
NM_000251.2(MSH2):c.1344C>T (p.Ser448=) rs1010360604
NM_000251.2(MSH2):c.1345A>T (p.Lys449Ter) rs63749920
NM_000251.2(MSH2):c.1345_1348del (p.Lys449fs) rs267607955
NM_000251.2(MSH2):c.1347G>C (p.Lys449Asn) rs587781331
NM_000251.2(MSH2):c.134C>T (p.Ala45Val) rs63750285
NM_000251.2(MSH2):c.1352_1353del (p.Gln451fs) rs63750957
NM_000251.2(MSH2):c.1353G>A (p.Gln451=) rs1060504415
NM_000251.2(MSH2):c.1354G>T (p.Glu452Ter) rs267607954
NM_000251.2(MSH2):c.1356A>G (p.Glu452=) rs63751212
NM_000251.2(MSH2):c.1357A>C (p.Met453Leu) rs1558493602
NM_000251.2(MSH2):c.1358T>A (p.Met453Lys) rs63750697
NM_000251.2(MSH2):c.135G>A (p.Ala45=) rs890172773
NM_000251.2(MSH2):c.136_164del (p.His46fs) rs63751482
NM_000251.2(MSH2):c.1373T>G (p.Leu458Ter) rs63750521
NM_000251.2(MSH2):c.1382A>C (p.Asp461Ala) rs730881756
NM_000251.2(MSH2):c.1384C>T (p.Gln462Ter) rs876657701
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1386+1G>C rs267607957
NM_000251.2(MSH2):c.1386+1G>T rs267607957
NM_000251.2(MSH2):c.1386+73G>A rs267607958
NM_000251.2(MSH2):c.1387-1G>T rs267607956
NM_000251.2(MSH2):c.1387-250G>A rs6741393
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1387-9T>A rs587779087
NM_000251.2(MSH2):c.1387-9T>C rs587779087
NM_000251.2(MSH2):c.1387-?_*(272_?)del
NM_000251.2(MSH2):c.1387-?_1510+?del
NM_000251.2(MSH2):c.1387-?_1661+?del
NM_000251.2(MSH2):c.1387-?_1661+?dup275
NM_000251.2(MSH2):c.1387-?_2458+?del
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.1390del (p.Glu464fs) rs587779088
NM_000251.2(MSH2):c.1397A>G (p.His466Arg) rs544265737
NM_000251.2(MSH2):c.1399G>T (p.Glu467Ter) rs587779089
NM_000251.2(MSH2):c.1401del (p.Glu467fs) rs1553365711
NM_000251.2(MSH2):c.1404_1410del (p.Phe468fs) rs878853802
NM_000251.2(MSH2):c.1405del (p.Leu469_Val470insTer) rs1060502027
NM_000251.2(MSH2):c.1408del (p.Leu469_Val470insTer) rs63750384
NM_000251.2(MSH2):c.1409T>A (p.Val470Glu) rs267607959
NM_000251.2(MSH2):c.1418C>G (p.Ser473Ter) rs63751403
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.141C>A (p.Gly47=) rs587779090
NM_000251.2(MSH2):c.141_154del (p.Glu48fs) rs863224481
NM_000251.2(MSH2):c.1429A>C (p.Asn477His) rs587781346
NM_000251.2(MSH2):c.142G>T (p.Glu48Ter) rs63750615
NM_000251.2(MSH2):c.1431_1432TC[3] (p.Glu480fs) rs587779091
NM_000251.2(MSH2):c.1442T>A (p.Leu481Ter) rs786203036
NM_000251.2(MSH2):c.1444A>T (p.Arg482Ter) rs587779092
NM_000251.2(MSH2):c.1444del (p.Arg482fs) rs63750068
NM_000251.2(MSH2):c.1444dup (p.Arg482fs) rs63750068
NM_000251.2(MSH2):c.1445_1446GA[1] (p.Glu483fs) rs63750161
NM_000251.2(MSH2):c.1445_1449del (p.Arg482fs) rs267607961
NM_000251.2(MSH2):c.1447G>T (p.Glu483Ter) rs63749947
NM_000251.2(MSH2):c.1453_1456ATGA[1] (p.Asn486fs) rs1114167806
NM_000251.2(MSH2):c.1457del (p.Asn486fs) rs63750986
NM_000251.2(MSH2):c.145_146del (p.Asp49fs) rs63750334
NM_000251.2(MSH2):c.145del (p.Asp49fs) rs63750644
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1465G>A (p.Glu489Lys) rs876658187
NM_000251.2(MSH2):c.1469A>G (p.Lys490Arg) rs1060502008
NM_000251.2(MSH2):c.146A>T (p.Asp49Val) rs63750335
NM_000251.2(MSH2):c.1470_1473delinsAAA (p.Met492fs) rs1060502029
NM_000251.2(MSH2):c.1476_1477delinsCT (p.Met492_Gln493delinsIleTer) rs63750583
NM_000251.2(MSH2):c.1477C>T (p.Gln493Ter) rs63750936
NM_000251.2(MSH2):c.1487T>A (p.Leu496Ter) rs587779093
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1494dup (p.Ala499fs) rs63750362
NM_000251.2(MSH2):c.1497del (p.Ala500fs) rs63749963
NM_000251.2(MSH2):c.149C>G (p.Ala50Gly) rs876658582
NM_000251.2(MSH2):c.14C>A (p.Pro5Gln) rs56170584
NM_000251.2(MSH2):c.1500dup (p.Arg501fs) rs587779094
NM_000251.2(MSH2):c.1508T>C (p.Leu503Pro) rs587779095
NM_000251.2(MSH2):c.1510+11G>C rs370675562
NM_000251.2(MSH2):c.1510+1G>A rs1114167852
NM_000251.2(MSH2):c.1510+2T>C rs1060502023
NM_000251.2(MSH2):c.1510+6_1510+7delAA rs1060502013
NM_000251.2(MSH2):c.1510G>C (p.Gly504Arg) rs63751600
NM_000251.2(MSH2):c.1511-10G>T rs587779096
NM_000251.2(MSH2):c.1511-10_1511-7delGATT rs864622529
NM_000251.2(MSH2):c.1511-1516C>T rs3771281
NM_000251.2(MSH2):c.1511-1G>A rs267607964
NM_000251.2(MSH2):c.1511-2A>G rs267607962
NM_000251.2(MSH2):c.1511-41G>C rs202215396
NM_000251.2(MSH2):c.1511-91G>T rs3732182
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1511-?_2005+?del
NM_000251.2(MSH2):c.1516G>T (p.Asp506Tyr) rs63750492
NM_000251.2(MSH2):c.1520del (p.Pro507fs) rs1553366510
NM_000251.2(MSH2):c.1522G>A (p.Gly508Ser) rs267607968
NM_000251.2(MSH2):c.1528C>T (p.Gln510Ter) rs587779097
NM_000251.2(MSH2):c.1534_1543del (p.Lys512fs) rs1553366522
NM_000251.2(MSH2):c.1546A>G (p.Ser516Gly) rs878853803
NM_000251.2(MSH2):c.1547G>A (p.Ser516Asn) rs373564353
NM_000251.2(MSH2):c.1547G>T (p.Ser516Ile) rs373564353
NM_000251.2(MSH2):c.154_155insG (p.Leu52fs) rs63750352
NM_000251.2(MSH2):c.1550C>T (p.Ala517Val) rs1060501997
NM_000251.2(MSH2):c.1550_1551CA[1] (p.Gln518fs) rs63749930
NM_000251.2(MSH2):c.1552C>T (p.Gln518Ter) rs63750780
NM_000251.2(MSH2):c.1557del (p.Phe519fs) rs1553366554
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1560dup (p.Tyr521fs) rs1553366561
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1566C>G (p.Tyr522Ter) rs63750224
NM_000251.2(MSH2):c.1567T>A (p.Phe523Ile) rs267607966
NM_000251.2(MSH2):c.156G>A (p.Leu52=) rs750241099
NM_000251.2(MSH2):c.1571G>A (p.Arg524His) rs63751207
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1571G>T (p.Arg524Leu) rs63751207
NM_000251.2(MSH2):c.1576del (p.Thr526fs) rs63750094
NM_000251.2(MSH2):c.1578del (p.Cys527fs) rs63750738
NM_000251.2(MSH2):c.157G>T (p.Ala53Ser) rs755931648
NM_000251.2(MSH2):c.1582A>C (p.Lys528Gln) rs199744440
NM_000251.2(MSH2):c.1587del (p.Glu530fs) rs63750845
NM_000251.2(MSH2):c.1593_1613del (p.Lys531_Lys537del) rs63750510
NM_000251.2(MSH2):c.1594dup (p.Val532fs) rs63750104
NM_000251.2(MSH2):c.1595T>C (p.Val532Ala) rs754778750
NM_000251.2(MSH2):c.1600C>T (p.Arg534Cys) rs63750029
NM_000251.2(MSH2):c.1601G>A (p.Arg534His) rs587778523
NM_000251.2(MSH2):c.1601G>T (p.Arg534Leu) rs587778523
NM_000251.2(MSH2):c.1602T>A (p.Arg534=) rs267607965
NM_000251.2(MSH2):c.1605C>T (p.Asn535=) rs587779098
NM_000251.2(MSH2):c.160G>T (p.Ala54Ser) rs749212640
NM_000251.2(MSH2):c.1627del (p.Asp543fs) rs63750675
NM_000251.2(MSH2):c.1637dup (p.Asn547fs) rs1553366642
NM_000251.2(MSH2):c.1638G>C (p.Lys546Asn) rs372350768
NM_000251.2(MSH2):c.1638_1639dup (p.Asn547fs) rs63750662
NM_000251.2(MSH2):c.163C>T (p.Arg55Trp)
NM_000251.2(MSH2):c.163del (p.Arg55fs) rs63750337
NM_000251.2(MSH2):c.1640A>G (p.Asn547Ser) rs267607967
NM_000251.2(MSH2):c.1642G>T (p.Gly548Cys) rs63750538
NM_000251.2(MSH2):c.164G>A (p.Arg55Gln) rs748196422
NM_000251.2(MSH2):c.1654A>C (p.Thr552Pro) rs63750838
NM_000251.2(MSH2):c.1654A>G (p.Thr552Ala) rs63750838
NM_000251.2(MSH2):c.1656del (p.Asn553fs) rs1114167817
NM_000251.2(MSH2):c.1659C>T (p.Asn553=) rs869312796
NM_000251.2(MSH2):c.1660A>C (p.Ser554Arg) rs63751656
NM_000251.2(MSH2):c.1660A>G (p.Ser554Gly) rs63751656
NM_000251.2(MSH2):c.1660A>T (p.Ser554Cys) rs63751656
NM_000251.2(MSH2):c.1661+12G>A rs3732183
NM_000251.2(MSH2):c.1661+17T>G rs377461923
NM_000251.2(MSH2):c.1661+1G>A rs267607969
NM_000251.2(MSH2):c.1661+1G>T rs267607969
NM_000251.2(MSH2):c.1661+25delT rs1553366691
NM_000251.2(MSH2):c.1661+5G>C rs267607972
NM_000251.2(MSH2):c.1661+6C>T rs267607973
NM_000251.2(MSH2):c.1661+90T>C rs10183143
NM_000251.2(MSH2):c.1661+9G>T rs1060504414
NM_000251.2(MSH2):c.1661G>C (p.Ser554Thr) rs63750597
NM_000251.2(MSH2):c.1662-12_1677delTTCGATTTGCAGCAAATTGACTTCTTTA rs864622436
NM_000251.2(MSH2):c.1662-17dup rs587779099
NM_000251.2(MSH2):c.1662-18T>C rs376235435
NM_000251.2(MSH2):c.1662-1G>A rs267607970
NM_000251.2(MSH2):c.1662-23A>G rs56404027
NM_000251.2(MSH2):c.1662-2A>G rs267607971
NM_000251.2(MSH2):c.1662-3C>T rs878853804
NM_000251.2(MSH2):c.1662-9G>A rs17218356
NM_000251.2(MSH2):c.1662-?_*(1_?)del
NM_000251.2(MSH2):c.1662-?_*(272_?)del
NM_000251.2(MSH2):c.1662-?_*(272_?)dup
NM_000251.2(MSH2):c.1662-?_1759+?del
NM_000251.2(MSH2):c.1662-?_1759+?dup98 rs1558514437
NM_000251.2(MSH2):c.1662-?_2458+?del
NM_000251.2(MSH2):c.1665del (p.Lys555fs) rs63751120
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1667T>C (p.Leu556Ser) rs587779101
NM_000251.2(MSH2):c.1667T>G (p.Leu556Trp) rs587779101
NM_000251.2(MSH2):c.1667_1668insA (p.Thr557fs) rs1553367587
NM_000251.2(MSH2):c.1667del (p.Lys555_Leu556insTer) rs267607694
NM_000251.2(MSH2):c.1667dup (p.Leu556fs) rs267607694
NM_000251.2(MSH2):c.1669A>C (p.Thr557Pro) rs63750432
NM_000251.2(MSH2):c.166G>T (p.Glu56Ter) rs587779102
NM_000251.2(MSH2):c.166del (p.Glu56fs) rs63750087
NM_000251.2(MSH2):c.1670C>G (p.Thr557Ser) rs139920308
NM_000251.2(MSH2):c.1676del (p.Ser558_Leu559insTer) rs63750633
NM_000251.2(MSH2):c.167A>T (p.Glu56Val) rs587782004
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1681G>A (p.Glu561Lys) rs63750328
NM_000251.2(MSH2):c.1681_1682dup (p.Glu562fs) rs1553367608
NM_000251.2(MSH2):c.1683del (p.Glu562fs) rs63750406
NM_000251.2(MSH2):c.1685A>T (p.Glu562Val) rs63750997
NM_000251.2(MSH2):c.1686G>C (p.Glu562Asp) rs786203850
NM_000251.2(MSH2):c.1687dup (p.Tyr563fs) rs587779103
NM_000251.2(MSH2):c.1688A>C (p.Tyr563Ser) rs63751054
NM_000251.2(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.2(MSH2):c.1692_1693del (p.Lys565_Asn566insTer) rs1553367635
NM_000251.2(MSH2):c.1693A>T (p.Lys565Ter) rs587779104
NM_000251.2(MSH2):c.1696_1697del (p.Lys565_Asn566insTer) rs63750737
NM_000251.2(MSH2):c.1699A>G (p.Lys567Glu) rs63751149
NM_000251.2(MSH2):c.1699A>T (p.Lys567Ter) rs63751149
NM_000251.2(MSH2):c.169G>A (p.Val57Met) rs267607913
NM_000251.2(MSH2):c.1700_1704del (p.Lys567fs) rs63750474
NM_000251.2(MSH2):c.1702dup (p.Thr568fs) rs587779105
NM_000251.2(MSH2):c.1705_1706del (p.Glu569fs) rs63750393
NM_000251.2(MSH2):c.1705_1706dup (p.Tyr570fs) rs63750393
NM_000251.2(MSH2):c.1705_1706insT (p.Glu569fs) rs587779106
NM_000251.2(MSH2):c.1706A>G (p.Glu569Gly) rs786201077
NM_000251.2(MSH2):c.1708del (p.Tyr570fs) rs1131692279
NM_000251.2(MSH2):c.1717del (p.Ala573fs) rs267607974
NM_000251.2(MSH2):c.1720C>T (p.Gln574Ter) rs63751298
NM_000251.2(MSH2):c.1720del (p.Gln574fs) rs63751299
NM_000251.2(MSH2):c.1724A>G (p.Asp575Gly) rs370330868
NM_000251.2(MSH2):c.1726G>C (p.Ala576Pro) rs587779107
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1738G>T (p.Glu580Ter) rs63751411
NM_000251.2(MSH2):c.1746C>A (p.Val582=) rs786201486
NM_000251.2(MSH2):c.1748A>C (p.Asn583Thr) rs201118107
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1748A>T (p.Asn583Ile) rs201118107
NM_000251.2(MSH2):c.1755T>C (p.Ser585=) rs63750112
NM_000251.2(MSH2):c.1759+11_1759+15delTAGAA rs878853805
NM_000251.2(MSH2):c.1759+16C>G rs1057517573
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1759+1G>C rs587779108
NM_000251.2(MSH2):c.1759+1G>T
NM_000251.2(MSH2):c.1759+2T>A rs267607976
NM_000251.2(MSH2):c.1759+2T>C rs267607976
NM_000251.2(MSH2):c.1759+3A>T rs863224630
NM_000251.2(MSH2):c.1759+501A>G rs17036614
NM_000251.2(MSH2):c.1759G>C (p.Gly587Arg) rs63751140
NM_000251.2(MSH2):c.1760-10T>A rs767536391
NM_000251.2(MSH2):c.1760-110_1760-108dup rs587779109
NM_000251.2(MSH2):c.1760-16T>G rs768370188
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1760-62G>A rs17218439
NM_000251.2(MSH2):c.1760-?_*(272_?)del
NM_000251.2(MSH2):c.1760-?_2005+?del
NM_000251.2(MSH2):c.1760-?_2210+?del
NM_000251.2(MSH2):c.1760-?_2458+?del
NM_000251.2(MSH2):c.1760delG (p.Gly587Alafs) rs63750103
NM_000251.2(MSH2):c.1764T>G (p.Tyr588Ter) rs63750844
NM_000251.2(MSH2):c.1771_1772insA (p.Pro591fs) rs267607977
NM_000251.2(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.2(MSH2):c.1777C>T (p.Gln593Ter) rs63750200
NM_000251.2(MSH2):c.1779_1782del (p.Gln593fs) rs63750113
NM_000251.2(MSH2):c.1781_1782insCT (p.Leu595fs) rs267607691
NM_000251.2(MSH2):c.1786_1788del (p.Asn596del) rs63749831
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.1787dup (p.Asn596fs) rs587779111
NM_000251.2(MSH2):c.1788_1789del (p.Asn596fs) rs63750495
NM_000251.2(MSH2):c.1790A>C (p.Asp597Ala) rs548407418
NM_000251.2(MSH2):c.1796T>C (p.Leu599Ser) rs747504492
NM_000251.2(MSH2):c.1799C>T (p.Ala600Val) rs63751236
NM_000251.2(MSH2):c.1801C>T (p.Gln601Ter) rs63750047
NM_000251.2(MSH2):c.1802A>G (p.Gln601Arg) rs779447213
NM_000251.2(MSH2):c.1803G>C (p.Gln601His) rs1553368556
NM_000251.2(MSH2):c.1804C>G (p.Leu602Val) rs748797209
NM_000251.2(MSH2):c.1805T>C (p.Leu602Pro) rs1553368561
NM_000251.2(MSH2):c.1807G>A (p.Asp603Asn) rs63750657
NM_000251.2(MSH2):c.1808A>G (p.Asp603Gly) rs267607985
NM_000251.2(MSH2):c.1809del (p.Asp603fs) rs63751129
NM_000251.2(MSH2):c.1812_1814TGT[1] (p.Val606del) rs267607978
NM_000251.2(MSH2):c.1813G>A (p.Val605Ile) rs730881777
NM_000251.2(MSH2):c.1813G>C (p.Val605Leu) rs730881777
NM_000251.2(MSH2):c.1813G>T (p.Val605Phe) rs730881777
NM_000251.2(MSH2):c.1817T>C (p.Val606Ala) rs376044376
NM_000251.2(MSH2):c.1818_1877del (p.Ser607_Glu626del) rs1553368576
NM_000251.2(MSH2):c.181C>G (p.Gln61Glu) rs63750951
NM_000251.2(MSH2):c.181C>T (p.Gln61Ter) rs63750951
NM_000251.2(MSH2):c.1825G>T (p.Ala609Ser) rs150980616
NM_000251.2(MSH2):c.1826C>T (p.Ala609Val) rs63750665
NM_000251.2(MSH2):c.1827del (p.His610fs) rs587779112
NM_000251.2(MSH2):c.1828C>A (p.His610Asn) rs267607980
NM_000251.2(MSH2):c.182A>C (p.Gln61Pro) rs587779113
NM_000251.2(MSH2):c.1831G>A (p.Val611Met) rs369385048
NM_000251.2(MSH2):c.1832T>A (p.Val611Glu) rs1553368590
NM_000251.2(MSH2):c.1835C>G (p.Ser612Ter) rs63750493
NM_000251.2(MSH2):c.1838dup (p.Asn613fs) rs1114167815
NM_000251.2(MSH2):c.1847C>G (p.Pro616Arg) rs587779965
NM_000251.2(MSH2):c.1850T>C (p.Val617Ala) rs1260310695
NM_000251.2(MSH2):c.1853del (p.Pro618fs) rs267607984
NM_000251.2(MSH2):c.1854A>G (p.Pro618=) rs786203744
NM_000251.2(MSH2):c.1856A>G (p.Tyr619Cys) rs63749982
NM_000251.2(MSH2):c.1857T>G (p.Tyr619Ter) rs63750312
NM_000251.2(MSH2):c.1858_1859dup (p.Arg621fs) rs63750806
NM_000251.2(MSH2):c.1861C>G (p.Arg621Gly) rs63750508
NM_000251.2(MSH2):c.1861C>T (p.Arg621Ter) rs63750508
NM_000251.2(MSH2):c.1862G>A (p.Arg621Gln) rs759263820
NM_000251.2(MSH2):c.1864C>A (p.Pro622Thr) rs63750280
NM_000251.2(MSH2):c.1865C>A (p.Pro622Gln) rs28929483
NM_000251.2(MSH2):c.1865C>T (p.Pro622Leu) rs28929483
NM_000251.2(MSH2):c.186_187dup (p.Val63fs) rs63750160
NM_000251.2(MSH2):c.1873T>G (p.Leu625Val) rs63750669
NM_000251.2(MSH2):c.187del (p.Gly62_Val63insTer) rs63750160
NM_000251.2(MSH2):c.187dup (p.Val63fs) rs63750160
NM_000251.2(MSH2):c.1881A>C (p.Lys627Asn) rs63750626
NM_000251.2(MSH2):c.1882G>T (p.Gly628Ter) rs371776176
NM_000251.2(MSH2):c.1884A>T (p.Gly628=) rs786202663
NM_000251.2(MSH2):c.1885C>T (p.Gln629Ter) rs63750203
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1889_1892del (p.Gly630fs) rs63750960
NM_000251.2(MSH2):c.1897A>G (p.Ile633Val) rs771695599
NM_000251.2(MSH2):c.1897dup (p.Ile633fs) rs587779114
NM_000251.2(MSH2):c.1901T>G (p.Leu634Ter) rs1114167811
NM_000251.2(MSH2):c.1906G>C (p.Ala636Pro) rs63750875
NM_000251.2(MSH2):c.1907C>T (p.Ala636Val) rs63750279
NM_000251.2(MSH2):c.1911del (p.Arg638fs) rs63750893
NM_000251.2(MSH2):c.1912A>G (p.Arg638Gly) rs267607981
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.1916A>G (p.His639Arg) rs587779116
NM_000251.2(MSH2):c.1917T>A (p.His639Gln) rs1800152
NM_000251.2(MSH2):c.1921T>G (p.Cys641Gly) rs63749946
NM_000251.2(MSH2):c.1922_1923GT[1] (p.Cys641_Val642insTer) rs587779117
NM_000251.2(MSH2):c.1924G>T (p.Val642Phe) rs776528054
NM_000251.2(MSH2):c.1927G>A (p.Glu643Lys) rs374840361
NM_000251.2(MSH2):c.1933C>G (p.Gln645Glu) rs267607982
NM_000251.2(MSH2):c.1935A>C (p.Gln645His) rs587780684
NM_000251.2(MSH2):c.1937A>G (p.Asp646Gly) rs41295290
NM_000251.2(MSH2):c.1951A>G (p.Ile651Val) rs878853806
NM_000251.2(MSH2):c.1955C>A (p.Pro652His) rs267607983
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1963_1964del (p.Val655fs) rs864622121
NM_000251.2(MSH2):c.1967A>G (p.Tyr656Cys) rs185356145
NM_000251.2(MSH2):c.1967_1970dup (p.Phe657fs) rs587779118
NM_000251.2(MSH2):c.1968C>G (p.Tyr656Ter) rs63751317
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.1980T>A (p.Asp660Glu) rs1060501988
NM_000251.2(MSH2):c.1980_1981del (p.Asp660fs) rs587779119
NM_000251.2(MSH2):c.1982_1985del (p.Lys661fs) rs587779120
NM_000251.2(MSH2):c.1984C>T (p.Gln662Ter) rs786204321
NM_000251.2(MSH2):c.1984_1985del (p.Gln662fs) rs587779121
NM_000251.2(MSH2):c.1986G>C (p.Gln662His) rs587780685
NM_000251.2(MSH2):c.1986_1987del (p.Gln662fs) rs587779122
NM_000251.2(MSH2):c.1986del (p.Met663fs) rs63749929
NM_000251.2(MSH2):c.198C>T (p.Tyr66=) rs730881784
NM_000251.2(MSH2):c.1996_1997del (p.Ile666fs) rs63751700
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.1A>G (p.Met1Val) rs267607911
NM_000251.2(MSH2):c.1A>T (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2005+1G>A rs267607986
NM_000251.2(MSH2):c.2005+1G>C rs267607986
NM_000251.2(MSH2):c.2005+1G>T rs267607986
NM_000251.2(MSH2):c.2005+25T>G rs267607989
NM_000251.2(MSH2):c.2005+2T>C rs267607987
NM_000251.2(MSH2):c.2005+2_2005+12del rs587779123
NM_000251.2(MSH2):c.2005+2del rs587779124
NM_000251.2(MSH2):c.2005+3_2005+14del rs587779125
NM_000251.2(MSH2):c.2005+6A>C rs1060502018
NM_000251.2(MSH2):c.2005+8dup rs267607992
NM_000251.2(MSH2):c.2005G>C (p.Gly669Arg) rs63751668
NM_000251.2(MSH2):c.2006-1G>C rs267607988
NM_000251.2(MSH2):c.2006-1G>T rs267607988
NM_000251.2(MSH2):c.2006-265A>G rs2059520
NM_000251.2(MSH2):c.2006-26dup rs781614743
NM_000251.2(MSH2):c.2006-2A>G rs267607991
NM_000251.2(MSH2):c.2006-36_2006-33dup rs587779126
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.2006-5T>A rs267607990
NM_000251.2(MSH2):c.2006-6T>C rs2303428
NM_000251.2(MSH2):c.2006-6T>G rs2303428
NM_000251.2(MSH2):c.2006-?_2210+?del
NM_000251.2(MSH2):c.2006G>A (p.Gly669Asp) rs63751640
NM_000251.2(MSH2):c.2006G>C (p.Gly669Ala) rs63751640
NM_000251.2(MSH2):c.2006G>T (p.Gly669Val) rs63751640
NM_000251.2(MSH2):c.2008C>T (p.Pro670Ser) rs1558519495
NM_000251.2(MSH2):c.2009C>A (p.Pro670His) rs41294982
NM_000251.2(MSH2):c.2009C>T (p.Pro670Leu) rs41294982
NM_000251.2(MSH2):c.200T>A (p.Met67Lys) rs876660001
NM_000251.2(MSH2):c.2010del (p.Asn671fs) rs63751123
NM_000251.2(MSH2):c.2011A>T (p.Asn671Tyr) rs63751232
NM_000251.2(MSH2):c.2012A>G (p.Asn671Ser) rs1558519505
NM_000251.2(MSH2):c.2013T>A (p.Asn671Lys) rs587779127
NM_000251.2(MSH2):c.2015del (p.Met672fs) rs63751161
NM_000251.2(MSH2):c.2017G>A (p.Gly673Arg) rs1558519543
NM_000251.2(MSH2):c.2020G>C (p.Gly674Arg) rs63750234
NM_000251.2(MSH2):c.2021G>A (p.Gly674Asp) rs267607996
NM_000251.2(MSH2):c.2021_2022del (p.Gly674fs) rs267608000
NM_000251.2(MSH2):c.2023_2025delinsGCC (p.Lys675Ala) rs587779128
NM_000251.2(MSH2):c.2026T>C (p.Ser676Pro) rs63751089
NM_000251.2(MSH2):c.2031_2032AT[2] (p.Ile679fs) rs587779129
NM_000251.2(MSH2):c.2032T>C (p.Tyr678His) rs876659093
NM_000251.2(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.2(MSH2):c.2039G>A (p.Arg680Gln) rs1203462814
NM_000251.2(MSH2):c.2041C>T (p.Gln681Ter) rs730881762
NM_000251.2(MSH2):c.2045C>T (p.Thr682Ile) rs587779130
NM_000251.2(MSH2):c.2046_2047del (p.Val684fs) rs587779131
NM_000251.2(MSH2):c.2047G>A (p.Gly683Arg) rs267607995
NM_000251.2(MSH2):c.2047G>T (p.Gly683Trp) rs267607995
NM_000251.2(MSH2):c.2048G>T (p.Gly683Val) rs755920849
NM_000251.2(MSH2):c.2048_2111dup (p.Ile704Metfs) rs1553369051
NM_000251.2(MSH2):c.204del (p.Pro69fs) rs63750199
NM_000251.2(MSH2):c.2056_2082delinsTATATGTTGTGCCATGTGAATATA (p.Val686_Phe694delinsTyrMetLeuCysHisValAsnIle) rs587779132
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2061C>G (p.Leu687=) rs63750032
NM_000251.2(MSH2):c.2063T>G (p.Met688Arg) rs63749993
NM_000251.2(MSH2):c.2064G>A (p.Met688Ile) rs63750790
NM_000251.2(MSH2):c.2066C>T (p.Ala689Val) rs1060502020
NM_000251.2(MSH2):c.2068C>G (p.Gln690Glu) rs587779134
NM_000251.2(MSH2):c.2071dup (p.Ile691fs) rs63749878
NM_000251.2(MSH2):c.2073T>G (p.Ile691Met) rs779101144
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>T (p.Gly692Trp) rs63750232
NM_000251.2(MSH2):c.2074_2081del (p.Gly692fs) rs587779135
NM_000251.2(MSH2):c.2075G>A (p.Gly692Glu) rs63751432
NM_000251.2(MSH2):c.2075G>T (p.Gly692Val) rs63751432
NM_000251.2(MSH2):c.2076G>A (p.Gly692=) rs1060504422
NM_000251.2(MSH2):c.2077T>C (p.Cys693Arg) rs1558519728
NM_000251.2(MSH2):c.2082del (p.Phe694fs) rs63750689
NM_000251.2(MSH2):c.2083G>A (p.Val695Met) rs772491283
NM_000251.2(MSH2):c.2086C>G (p.Pro696Ala) rs546201898
NM_000251.2(MSH2):c.2087C>T (p.Pro696Leu) rs267607994
NM_000251.2(MSH2):c.2088A>G (p.Pro696=) rs878853807
NM_000251.2(MSH2):c.2089T>C (p.Cys697Arg) rs63750961
NM_000251.2(MSH2):c.2090G>A (p.Cys697Tyr) rs63750398
NM_000251.2(MSH2):c.2090G>T (p.Cys697Phe) rs63750398
NM_000251.2(MSH2):c.2091T>A (p.Cys697Ter) rs63750872
NM_000251.2(MSH2):c.2095T>C (p.Ser699Pro) rs1428704795
NM_000251.2(MSH2):c.2096C>G (p.Ser699Ter) rs587779136
NM_000251.2(MSH2):c.2096C>T (p.Ser699Leu) rs587779136
NM_000251.2(MSH2):c.209C>A (p.Ala70Glu) rs587782481
NM_000251.2(MSH2):c.20del (p.Glu7fs) rs267607915
NM_000251.2(MSH2):c.2100del (p.Glu701fs) rs1553369113
NM_000251.2(MSH2):c.2105T>G (p.Val702Gly) rs587779137
NM_000251.2(MSH2):c.2106G>A (p.Val702=) rs786201108
NM_000251.2(MSH2):c.2108C>A (p.Ser703Tyr) rs267607999
NM_000251.2(MSH2):c.211+1G>T rs1114167883
NM_000251.2(MSH2):c.211+8C>G rs267607916
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.211+98T>C rs3815865
NM_000251.2(MSH2):c.211+9C>G rs2303426
NM_000251.2(MSH2):c.2111T>C (p.Ile704Thr) rs564657106
NM_000251.2(MSH2):c.2113del (p.Val705fs) rs63749811
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.212-1G>A rs267607914
NM_000251.2(MSH2):c.212-2A>G rs267607917
NM_000251.2(MSH2):c.212-2delA rs1060502007
NM_000251.2(MSH2):c.212-3A>T rs879255341
NM_000251.2(MSH2):c.212-478T>G rs587779138
NM_000251.2(MSH2):c.212-4delT rs746333570
NM_000251.2(MSH2):c.212-?_1076+?del
NM_000251.2(MSH2):c.212-?_1276+?del
NM_000251.2(MSH2):c.212-?_1386+?del
NM_000251.2(MSH2):c.212-?_1510+?del
NM_000251.2(MSH2):c.212-?_2458+?del
NM_000251.2(MSH2):c.212-?_366+?del
NM_000251.2(MSH2):c.212-?_366+?dup
NM_000251.2(MSH2):c.212-?_645+?del
NM_000251.2(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409
NM_000251.2(MSH2):c.2123T>A (p.Ile708Asn) rs63750108
NM_000251.2(MSH2):c.2125T>G (p.Leu709Val) rs1060502030
NM_000251.2(MSH2):c.212_366del155 (p.Ala72Phefs) rs1553350052
NM_000251.2(MSH2):c.2131C>T (p.Arg711Ter) rs63750636
NM_000251.2(MSH2):c.2132G>A (p.Arg711Gln) rs138465383
NM_000251.2(MSH2):c.2135dup (p.Gly713fs) rs63751453
NM_000251.2(MSH2):c.2139G>C (p.Gly713=) rs63750003
NM_000251.2(MSH2):c.2139G>T (p.Gly713=) rs63750003
NM_000251.2(MSH2):c.213A>G (p.Gly71=) rs878853808
NM_000251.2(MSH2):c.2141C>T (p.Ala714Val) rs63751224
NM_000251.2(MSH2):c.2141dup (p.Gly715fs) rs63750545
NM_000251.2(MSH2):c.2145del (p.Asp716fs) rs1553369164
NM_000251.2(MSH2):c.2148del (p.Asp716fs) rs1553369165
NM_000251.2(MSH2):c.2150_2153del (p.Ser717fs) rs878853809
NM_000251.2(MSH2):c.2152C>T (p.Gln718Ter) rs587779139
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2160_2163del (p.Gly721fs) rs63750722
NM_000251.2(MSH2):c.2161G>T (p.Gly721Ter) rs1060502032
NM_000251.2(MSH2):c.2164G>T (p.Val722Phe) rs587781996
NM_000251.2(MSH2):c.2166C>A (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2166C>T (p.Val722=) rs1057520969
NM_000251.2(MSH2):c.2167dup (p.Ser723fs) rs587779140
NM_000251.2(MSH2):c.2168C>T (p.Ser723Phe) rs63750794
NM_000251.2(MSH2):c.2178G>A (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2178G>C (p.Met726Ile) rs587782396
NM_000251.2(MSH2):c.2179G>C (p.Ala727Pro) rs104895026
NM_000251.2(MSH2):c.2182_2199del (p.Glu728_Ala733del) rs1553369194
NM_000251.2(MSH2):c.2187G>T (p.Met729Ile) rs587779141
NM_000251.2(MSH2):c.2191G>T (p.Glu731Ter) rs63749802
NM_000251.2(MSH2):c.2194_2196del (p.Thr732del) rs63750562
NM_000251.2(MSH2):c.2197G>A (p.Ala733Thr) rs772662439
NM_000251.2(MSH2):c.219G>A (p.Lys73=) rs1800150
NM_000251.2(MSH2):c.21G>A (p.Glu7=) rs1060504423
NM_000251.2(MSH2):c.21dup (p.Thr8fs) rs1553348668
NM_000251.2(MSH2):c.2203A>G (p.Ile735Val) rs2229061
NM_000251.2(MSH2):c.2204del (p.Ile735fs) rs63750572
NM_000251.2(MSH2):c.2205C>A (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.220A>C (p.Asn74His) rs150548839
NM_000251.2(MSH2):c.2210+11_2210+22del rs730881782
NM_000251.2(MSH2):c.2210+1G>A rs267608002
NM_000251.2(MSH2):c.2210+1G>C rs267608002
NM_000251.2(MSH2):c.2210+274T>G rs4608577
NM_000251.2(MSH2):c.2210+317G>C rs4638843
NM_000251.2(MSH2):c.2210+77T>A rs267608005
NM_000251.2(MSH2):c.2210+8dup rs267608004
NM_000251.2(MSH2):c.2210+9A>G rs878853810
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2211-1G>T rs267607979
NM_000251.2(MSH2):c.2211-2A>C rs267608001
NM_000251.2(MSH2):c.2211-2A>G rs267608001
NM_000251.2(MSH2):c.2211-2A>T rs267608001
NM_000251.2(MSH2):c.2211-5T>G rs368596736
NM_000251.2(MSH2):c.2211-6C>A rs267608003
NM_000251.2(MSH2):c.2211-?_2458+?del
NM_000251.2(MSH2):c.2228C>A (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.2228C>G (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.2228_2231del (p.Asp742_Ser743insTer) rs63751156
NM_000251.2(MSH2):c.2231T>G (p.Leu744Ter) rs63750403
NM_000251.2(MSH2):c.2232_2234AAT[3] (p.Ile747dup) rs267607690
NM_000251.2(MSH2):c.2236_2241del (p.Ile746_Ile747del) rs587779142
NM_000251.2(MSH2):c.2237_2238insA (p.Ile747fs) rs1553369641
NM_000251.2(MSH2):c.223_224del (p.Leu75fs) rs63750712
NM_000251.2(MSH2):c.2240_2241del (p.Ile747fs) rs63751036
NM_000251.2(MSH2):c.2241A>T (p.Ile747=) rs1060504411
NM_000251.2(MSH2):c.2242G>C (p.Asp748His) rs267608007
NM_000251.2(MSH2):c.2242G>T (p.Asp748Tyr) rs267608007
NM_000251.2(MSH2):c.2243A>T (p.Asp748Val) rs1558521518
NM_000251.2(MSH2):c.2245G>A (p.Glu749Lys) rs63751477
NM_000251.2(MSH2):c.2251G>A (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2251G>C (p.Gly751Arg) rs63751119
NM_000251.2(MSH2):c.2261del (p.Thr754fs) rs267608009
NM_000251.2(MSH2):c.226C>T (p.Gln76Ter) rs63750042
NM_000251.2(MSH2):c.2272G>A (p.Asp758Asn) rs876658254
NM_000251.2(MSH2):c.2275G>T (p.Gly759Ter) rs63749854
NM_000251.2(MSH2):c.2277A>G (p.Gly759=) rs1057520316
NM_000251.2(MSH2):c.227_228AG[1] (p.Ser77fs) rs63749848
NM_000251.2(MSH2):c.2282G>C (p.Gly761Ala) rs876659937
NM_000251.2(MSH2):c.2283G>A (p.Gly761=) rs755548149
NM_000251.2(MSH2):c.2283del (p.Gly761_Leu762insTer) rs786204050
NM_000251.2(MSH2):c.2285T>C (p.Leu762Ser) rs1558521698
NM_000251.2(MSH2):c.228G>T (p.Gln76His) rs587782857
NM_000251.2(MSH2):c.2290del (p.Trp764fs) rs63749913
NM_000251.2(MSH2):c.2291G>A (p.Trp764Ter) rs587779143
NM_000251.2(MSH2):c.2292G>A (p.Trp764Ter) rs63751105
NM_000251.2(MSH2):c.2292G>C (p.Trp764Cys) rs63751105
NM_000251.2(MSH2):c.2293G>A (p.Ala765Thr) rs63750368
NM_000251.2(MSH2):c.2294C>T (p.Ala765Val) rs1261458082
NM_000251.2(MSH2):c.2294del (p.Ala765fs) rs63750346
NM_000251.2(MSH2):c.2295del (p.Ile766fs) rs63751143
NM_000251.2(MSH2):c.2304del (p.Glu768fs) rs587783053
NM_000251.2(MSH2):c.2305del (p.Tyr769fs) rs63750896
NM_000251.2(MSH2):c.2308A>G (p.Ile770Val) rs63750684
NM_000251.2(MSH2):c.2309T>C (p.Ile770Thr) rs371718349
NM_000251.2(MSH2):c.2317A>G (p.Lys773Glu) rs1558521813
NM_000251.2(MSH2):c.2321T>G (p.Ile774Ser) rs878853811
NM_000251.2(MSH2):c.2322T>C (p.Ile774=) rs56397910
NM_000251.2(MSH2):c.2334C>A (p.Cys778Ter) rs63750618
NM_000251.2(MSH2):c.2335dup (p.Met779fs) rs63750149
NM_000251.2(MSH2):c.2337G>A (p.Met779Ile) rs41295292
NM_000251.2(MSH2):c.2347del (p.His783fs) rs63750233
NM_000251.2(MSH2):c.2355T>C (p.His785=) rs1114167840
NM_000251.2(MSH2):c.2360T>G (p.Leu787Arg) rs1558521929
NM_000251.2(MSH2):c.2360_2361dup (p.Thr788fs) rs63750803
NM_000251.2(MSH2):c.2361dup (p.Thr788fs) rs63750803
NM_000251.2(MSH2):c.2362dup (p.Thr788fs) rs63750463
NM_000251.2(MSH2):c.2363_2364del (p.Thr788fs) rs63750937
NM_000251.2(MSH2):c.2366C>T (p.Ala789Val) rs876660292
NM_000251.2(MSH2):c.2375A>G (p.Asn792Ser) rs587782891
NM_000251.2(MSH2):c.2388del (p.Val797fs) rs63749983
NM_000251.2(MSH2):c.2393A>G (p.Asn798Ser) rs786204073
NM_000251.2(MSH2):c.23C>G (p.Thr8Arg) rs17217716
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2400A>G (p.Leu800=) rs201298777
NM_000251.2(MSH2):c.2403T>C (p.His801=) rs1060504410
NM_000251.2(MSH2):c.2406_2407CA[1] (p.Thr803fs) rs63750060
NM_000251.2(MSH2):c.2410G>A (p.Ala804Thr) rs1060502005
NM_000251.2(MSH2):c.2417C>T (p.Thr806Ile) rs758889557
NM_000251.2(MSH2):c.2418dup (p.Thr807fs) rs587779144
NM_000251.2(MSH2):c.2420C>G (p.Thr807Ser) rs41295294
NM_000251.2(MSH2):c.2422G>T (p.Glu808Ter) rs34986638
NM_000251.2(MSH2):c.2425G>T (p.Glu809Ter) rs202145681
NM_000251.2(MSH2):c.2427dup (p.Thr810fs) rs63751079
NM_000251.2(MSH2):c.2432T>G (p.Leu811Ter) rs63751018
NM_000251.2(MSH2):c.2437A>G (p.Met813Val) rs63749841
NM_000251.2(MSH2):c.243_273delinsCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAGCCTCGCTTCCCAGCCCTCACTAACATTAACGAAAACAACCCACCCACTAAACCCCATTAAACGCCTAACAATCGGAAGCCTATTTTGCAGGGTTTCTCCATCACCAACAGCATTCTCCCCACATCCACCCCCCAAATGACAATCCCACTTTACTTAAAACTCACAG (p.Lys82_Asp91delinsTer)
NM_000251.2(MSH2):c.2446C>T (p.Gln816Ter) rs63749917
NM_000251.2(MSH2):c.244A>T (p.Lys82Ter) rs587779145
NM_000251.2(MSH2):c.2458+12T>C rs1553369841
NM_000251.2(MSH2):c.2458+16G>A rs373624698
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2458+2T>C rs1278858560
NM_000251.2(MSH2):c.2458+3A>C rs761709497
NM_000251.2(MSH2):c.2458+8C>G rs189025757
NM_000251.2(MSH2):c.2458+9T>C rs864622575
NM_000251.2(MSH2):c.2459-12A>G rs267608012
NM_000251.2(MSH2):c.2459-1G>A rs1060501991
NM_000251.2(MSH2):c.2459-?_*(272_?)del
NM_000251.2(MSH2):c.2459-?_2634+?del
NM_000251.2(MSH2):c.2459-?_2634+?dup176 rs1558524086
NM_000251.2(MSH2):c.2459G>A (p.Gly820Asp) rs794729229
NM_000251.2(MSH2):c.2459_2460GT[1] (p.Val821fs) rs1114167828
NM_000251.2(MSH2):c.2463C>T (p.Val821=) rs886056136
NM_000251.2(MSH2):c.2464_2465TG[1] (p.Cys822_Asp823delinsTer) rs63751621
NM_000251.2(MSH2):c.2466T>A (p.Cys822Ter) rs63749846
NM_000251.2(MSH2):c.2470C>G (p.Gln824Glu) rs63750623
NM_000251.2(MSH2):c.2470C>T (p.Gln824Ter) rs63750623
NM_000251.2(MSH2):c.2472_2473del (p.Ser825fs) rs1553370310
NM_000251.2(MSH2):c.2479G>C (p.Gly827Arg) rs63750478
NM_000251.2(MSH2):c.2484dup (p.His829fs) rs1553370324
NM_000251.2(MSH2):c.2485_2498dup (p.Ala834fs) rs587779146
NM_000251.2(MSH2):c.2485del (p.His829fs) rs63751117
NM_000251.2(MSH2):c.2500G>A (p.Ala834Thr) rs63750757
NM_000251.2(MSH2):c.2502_2508del (p.Asn835fs) rs63751447
NM_000251.2(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.2(MSH2):c.2507del (p.Phe836fs) rs63750008
NM_000251.2(MSH2):c.2516A>G (p.His839Arg) rs63750027
NM_000251.2(MSH2):c.2517T>A (p.His839Gln) rs267608016
NM_000251.2(MSH2):c.2518G>A (p.Val840Ile) rs878853812
NM_000251.2(MSH2):c.2521del (p.Val840_Ile841insTer) rs587779147
NM_000251.2(MSH2):c.2523_2524AG[1] (p.Glu842fs) rs587779148
NM_000251.2(MSH2):c.2525A>T (p.Glu842Val) rs373393954
NM_000251.2(MSH2):c.2527_2528TG[1] (p.Cys843_Ala844insTer) rs63749975
NM_000251.2(MSH2):c.2533A>G (p.Lys845Glu) rs63750571
NM_000251.2(MSH2):c.2536C>T (p.Gln846Ter) rs63750857
NM_000251.2(MSH2):c.2537A>G (p.Gln846Arg) rs140754514
NM_000251.2(MSH2):c.2545C>T (p.Leu849=) rs587778527
NM_000251.2(MSH2):c.2545del (p.Leu849fs) rs587779149
NM_000251.2(MSH2):c.2551C>A (p.Leu851Ile) rs267608015
NM_000251.2(MSH2):c.2554_2556GAG[1] (p.Glu853del) rs766906365
NM_000251.2(MSH2):c.2556G>C (p.Glu852Asp) rs587781453
NM_000251.2(MSH2):c.2558A>C (p.Glu853Ala) rs63750797
NM_000251.2(MSH2):c.2558A>G (p.Glu853Gly) rs63750797
NM_000251.2(MSH2):c.255_256del (p.Phe85fs) rs267607921
NM_000251.2(MSH2):c.255dup (p.Glu86Ter) rs63751158
NM_000251.2(MSH2):c.2567A>G (p.Tyr856Cys) rs587779150
NM_000251.2(MSH2):c.2575G>T (p.Glu859Ter) rs63749830
NM_000251.2(MSH2):c.2576_2584del (p.Glu859_Gln861del) rs587781278
NM_000251.2(MSH2):c.2579C>A (p.Ser860Ter) rs63750849
NM_000251.2(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.2(MSH2):c.2581C>T (p.Gln861Ter) rs63750291
NM_000251.2(MSH2):c.2583A>G (p.Gln861=) rs63751093
NM_000251.2(MSH2):c.2591A>C (p.Asp864Ala) rs863224642
NM_000251.2(MSH2):c.2593_2597del (p.Ile865fs) rs587779151
NM_000251.2(MSH2):c.2602C>G (p.Pro868Ala) rs63751400
NM_000251.2(MSH2):c.2606C>A (p.Ala869Glu) rs730881772
NM_000251.2(MSH2):c.2609C>G (p.Ala870Gly) rs63750709
NM_000251.2(MSH2):c.260C>G (p.Ser87Cys) rs587781447
NM_000251.2(MSH2):c.2615A>G (p.Lys872Arg) rs587780686
NM_000251.2(MSH2):c.2617T>G (p.Cys873Gly) rs63750795
NM_000251.2(MSH2):c.2620T>G (p.Tyr874Asp) rs879254152
NM_000251.2(MSH2):c.2620_2621ins115 (p.?)
NM_000251.2(MSH2):c.2622T>A (p.Tyr874Ter) rs587779152
NM_000251.2(MSH2):c.2629_2630AG[2] (p.Glu878fs) rs63751618
NM_000251.2(MSH2):c.2634+12T>C rs372907481
NM_000251.2(MSH2):c.2634+1G>A rs267608019
NM_000251.2(MSH2):c.2634+1G>T rs267608019
NM_000251.2(MSH2):c.2634+2T>C rs876660546
NM_000251.2(MSH2):c.2634+30del rs267608021
NM_000251.2(MSH2):c.2634+5G>C rs267608017
NM_000251.2(MSH2):c.2634+5G>T rs267608017
NM_000251.2(MSH2):c.2634+8A>G rs1060502004
NM_000251.2(MSH2):c.2634G>A (p.Glu878=) rs63751624
NM_000251.2(MSH2):c.2634G>C (p.Glu878Asp) rs63751624
NM_000251.2(MSH2):c.2635-1G>T rs267608020
NM_000251.2(MSH2):c.2635-214T>C rs2042649
NM_000251.2(MSH2):c.2635-2A>G
NM_000251.2(MSH2):c.2635-3C>G rs587779153
NM_000251.2(MSH2):c.2635-5_2635-3inv
NM_000251.2(MSH2):c.2635-?_*(272_?)del
NM_000251.2(MSH2):c.2635C>T (p.Gln879Ter) rs63751469
NM_000251.2(MSH2):c.263_264del (p.Phe88fs) rs267607920
NM_000251.2(MSH2):c.2647del (p.Ile883fs) rs63750084
NM_000251.2(MSH2):c.2647dup (p.Ile883fs) rs63750084
NM_000251.2(MSH2):c.264dup (p.Val89fs) rs267607920
NM_000251.2(MSH2):c.2651T>G (p.Ile884Ser) rs63750409
NM_000251.2(MSH2):c.2653C>T (p.Gln885Ter) rs63750808
NM_000251.2(MSH2):c.2656G>T (p.Glu886Ter) rs1230083633
NM_000251.2(MSH2):c.2657A>G (p.Glu886Gly) rs63750350
NM_000251.2(MSH2):c.2662del (p.Leu888fs) rs63751007
NM_000251.2(MSH2):c.2681T>G (p.Met894Arg) rs1558526026
NM_000251.2(MSH2):c.2697G>T (p.Met899Ile) rs878853813
NM_000251.2(MSH2):c.2699C>G (p.Ser900Ter) rs878853814
NM_000251.2(MSH2):c.269_290dup (p.Tyr98fs) rs1553350126
NM_000251.2(MSH2):c.2714C>G (p.Thr905Arg) rs267608022
NM_000251.2(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.2(MSH2):c.2716A>G (p.Ile906Val) rs876658598
NM_000251.2(MSH2):c.2717T>C (p.Ile906Thr) rs587780687
NM_000251.2(MSH2):c.2718A>G (p.Ile906Met) rs876659835
NM_000251.2(MSH2):c.271G>C (p.Asp91His) rs1558457163
NM_000251.2(MSH2):c.2722T>A (p.Leu908Ile) rs1085308059
NM_000251.2(MSH2):c.2726A>T (p.Lys909Ile) rs34319539
NM_000251.2(MSH2):c.2732T>G (p.Leu911Arg) rs41295182
NM_000251.2(MSH2):c.2734A>C (p.Lys912Gln) rs1060501998
NM_000251.2(MSH2):c.2738C>G (p.Ala913Gly) rs1060502026
NM_000251.2(MSH2):c.273_275TCT[2] (p.Leu94del) rs267607919
NM_000251.2(MSH2):c.2740G>T (p.Glu914Ter) rs267608024
NM_000251.2(MSH2):c.274C>G (p.Leu92Val) rs587779154
NM_000251.2(MSH2):c.2754G>T (p.Lys918Asn) rs1553370893
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.2766T>G (p.Phe922Leu)
NM_000251.2(MSH2):c.2768T>A (p.Val923Glu) rs146421227
NM_000251.2(MSH2):c.276T>G (p.Leu92=) rs1060504425
NM_000251.2(MSH2):c.2777T>A (p.Ile926Asn) rs199747712
NM_000251.2(MSH2):c.277C>T (p.Leu93Phe) rs63751429
NM_000251.2(MSH2):c.2782T>C (p.Ser928Pro) rs587781852
NM_000251.2(MSH2):c.2785C>T (p.Arg929Ter) rs551060742
NM_000251.2(MSH2):c.2786G>A (p.Arg929Gln) rs587779967
NM_000251.2(MSH2):c.2789T>A (p.Ile930Lys) rs587783054
NM_000251.2(MSH2):c.278_279del (p.Leu93fs) rs63749872
NM_000251.2(MSH2):c.2790A>G (p.Ile930Met) rs587779155
NM_000251.2(MSH2):c.2792A>C (p.Lys931Thr) rs267608023
NM_000251.2(MSH2):c.2797dup (p.Thr933fs) rs587779156
NM_000251.2(MSH2):c.2801C>A (p.Thr934Lys) rs587779969
NM_000251.2(MSH2):c.2802G>A (p.Thr934=) rs150259097
NM_000251.2(MSH2):c.2802G>C (p.Thr934=) rs150259097
NM_000251.2(MSH2):c.287G>A (p.Arg96His) rs63750002
NM_000251.2(MSH2):c.289C>T (p.Gln97Ter) rs63750970
NM_000251.2(MSH2):c.28C>T (p.Gln10Ter) rs63751099
NM_000251.2(MSH2):c.293A>G (p.Tyr98Cys) rs63750887
NM_000251.2(MSH2):c.295A>C (p.Arg99=) rs63750230
NM_000251.2(MSH2):c.29dup (p.Leu11fs) rs63750589
NM_000251.2(MSH2):c.301G>T (p.Glu101Ter) rs63750318
NM_000251.2(MSH2):c.301_306del (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.304G>A (p.Val102Ile) rs193922373
NM_000251.2(MSH2):c.308A>G (p.Tyr103Cys) rs63751173
NM_000251.2(MSH2):c.317G>A (p.Arg106Lys) rs41295286
NM_000251.2(MSH2):c.319G>C (p.Ala107Pro) rs587779158
NM_000251.2(MSH2):c.327T>C (p.Asn109=) rs63751437
NM_000251.2(MSH2):c.329A>G (p.Lys110Arg) rs63751040
NM_000251.2(MSH2):c.333A>G (p.Ala111=) rs1060504408
NM_000251.2(MSH2):c.335C>G (p.Ser112Cys) rs769215192
NM_000251.2(MSH2):c.336C>A (p.Ser112=) rs34312619
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.340G>T (p.Glu114Ter) rs878853815
NM_000251.2(MSH2):c.344del (p.Asn115fs) rs63751195
NM_000251.2(MSH2):c.347_350del (p.Asp116fs) rs63750501
NM_000251.2(MSH2):c.34dup (p.Glu12fs) rs63750614
NM_000251.2(MSH2):c.352dup (p.Tyr118fs) rs587779159
NM_000251.2(MSH2):c.354T>G (p.Tyr118Ter) rs1553350250
NM_000251.2(MSH2):c.361T>A (p.Tyr121Asn) rs878853816
NM_000251.2(MSH2):c.363T>G (p.Tyr121Ter) rs63750458
NM_000251.2(MSH2):c.365A>T (p.Lys122Met) rs863224643
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.366+1G>T rs267607924
NM_000251.2(MSH2):c.366+24A>G rs200890440
NM_000251.2(MSH2):c.366+25C>T rs764158568
NM_000251.2(MSH2):c.366+2T>C rs1558457533
NM_000251.2(MSH2):c.366+43G>A rs185555345
NM_000251.2(MSH2):c.366+53A>C rs267607923
NM_000251.2(MSH2):c.366+88G>A rs864622763
NM_000251.2(MSH2):c.367-13del rs587779160
NM_000251.2(MSH2):c.367-19A>T rs730881783
NM_000251.2(MSH2):c.367-1G>A rs267607925
NM_000251.2(MSH2):c.367-371_646-513del
NM_000251.2(MSH2):c.367-452_646-722del
NM_000251.2(MSH2):c.367-466_645+658del
NM_000251.2(MSH2):c.367-681_646-956del
NM_000251.2(MSH2):c.367-?_1076+?del
NM_000251.2(MSH2):c.367-?_1276+?del
NM_000251.2(MSH2):c.367-?_1386+?del
NM_000251.2(MSH2):c.367-?_1759+?del
NM_000251.2(MSH2):c.367-?_645+?del
NM_000251.2(MSH2):c.367-?_942+?del
NM_000251.2(MSH2):c.368del (p.Ala123fs) rs63750210
NM_000251.2(MSH2):c.376G>A (p.Gly126Ser) rs767371843
NM_000251.2(MSH2):c.376G>C (p.Gly126Arg) rs767371843
NM_000251.2(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.2(MSH2):c.380A>T (p.Asn127Ile) rs17217772
NM_000251.2(MSH2):c.380_381del (p.Asn127fs) rs63751227
NM_000251.2(MSH2):c.381_382TC[3] (p.Gln130fs) rs63750924
NM_000251.2(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.2(MSH2):c.383T>G (p.Leu128Arg) rs730881768
NM_000251.2(MSH2):c.388C>T (p.Gln130Ter) rs1060501989
NM_000251.2(MSH2):c.388_389del (p.Gln130fs) rs63750704
NM_000251.2(MSH2):c.38G>T (p.Ser13Ile) rs63749907
NM_000251.2(MSH2):c.399C>T (p.Asp133=) rs61756462
NM_000251.2(MSH2):c.399del (p.Asp133fs) rs63751290
NM_000251.2(MSH2):c.403C>T (p.Leu135Phe) rs193096019
NM_000251.2(MSH2):c.405C>G (p.Leu135=) rs778368203
NM_000251.2(MSH2):c.408del (p.Phe136fs) rs63750408
NM_000251.2(MSH2):c.416del (p.Asn139fs) rs63750401
NM_000251.2(MSH2):c.421A>G (p.Met141Val) rs193922374
NM_000251.2(MSH2):c.425C>G (p.Ser142Ter) rs63750910
NM_000251.2(MSH2):c.427G>A (p.Ala143Thr) rs878853817
NM_000251.2(MSH2):c.42G>A (p.Ala14=) rs374396150
NM_000251.2(MSH2):c.431C>G (p.Ser144Cys) rs878853818
NM_000251.2(MSH2):c.432C>T (p.Ser144=) rs1558459072
NM_000251.2(MSH2):c.433A>G (p.Ile145Val) rs876659264
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.437G>T (p.Gly146Val) rs772052262
NM_000251.2(MSH2):c.438T>C (p.Gly146=) rs587779161
NM_000251.2(MSH2):c.446G>A (p.Gly149Asp) rs587779162
NM_000251.2(MSH2):c.447T>C (p.Gly149=) rs786203142
NM_000251.2(MSH2):c.454del (p.Met152fs) rs63751449
NM_000251.2(MSH2):c.459C>T (p.Ser153=) rs63751065
NM_000251.2(MSH2):c.464T>A (p.Val155Asp) rs876658188
NM_000251.2(MSH2):c.464T>C (p.Val155Ala) rs876658188
NM_000251.2(MSH2):c.470G>C (p.Gly157Ala) rs765489269
NM_000251.2(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.472C>T (p.Gln158Ter) rs63751226
NM_000251.2(MSH2):c.475dup (p.Arg159fs) rs786204319
NM_000251.2(MSH2):c.478C>T (p.Gln160Ter) rs63751426
NM_000251.2(MSH2):c.480G>T (p.Gln160His) rs1558459273
NM_000251.2(MSH2):c.482T>A (p.Val161Asp) rs63750126
NM_000251.2(MSH2):c.484G>A (p.Gly162Arg) rs63750624
NM_000251.2(MSH2):c.485G>C (p.Gly162Ala) rs63750773
NM_000251.2(MSH2):c.488T>A (p.Val163Asp) rs63750214
NM_000251.2(MSH2):c.488T>G (p.Val163Gly) rs63750214
NM_000251.2(MSH2):c.490G>A (p.Gly164Arg) rs63750582
NM_000251.2(MSH2):c.490G>T (p.Gly164Trp) rs63750582
NM_000251.2(MSH2):c.491G>A (p.Gly164Glu) rs786204082
NM_000251.2(MSH2):c.493T>G (p.Tyr165Asp) rs587779163
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.49G>T (p.Val17Phe) rs63750966
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.4_21dup (p.Ala2_Glu7dup) rs281864943
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.506_509del (p.Ile169fs) rs63751013
NM_000251.2(MSH2):c.507A>G (p.Ile169Met) rs748762580
NM_000251.2(MSH2):c.508C>T (p.Gln170Ter) rs63750843
NM_000251.2(MSH2):c.510dup (p.Arg171fs) rs1553350787
NM_000251.2(MSH2):c.511_583dup (p.Gly195delinsGluGluThrArgThrValTer) rs1553350789
NM_000251.2(MSH2):c.512G>A (p.Arg171Lys) rs63750902
NM_000251.2(MSH2):c.513del (p.Lys172fs) rs63750933
NM_000251.2(MSH2):c.518T>C (p.Leu173Pro) rs63750070
NM_000251.2(MSH2):c.518T>G (p.Leu173Arg) rs63750070
NM_000251.2(MSH2):c.518del (p.Leu173fs) rs63750069
NM_000251.2(MSH2):c.523_564del (p.Leu175_Glu188del) rs63750705
NM_000251.2(MSH2):c.524T>C (p.Leu175Pro) rs63751291
NM_000251.2(MSH2):c.524_525TG[2] (p.Cys176_Glu177delinsTer) rs587779164
NM_000251.2(MSH2):c.529G>A (p.Glu177Lys) rs63750382
NM_000251.2(MSH2):c.529G>T (p.Glu177Ter) rs63750382
NM_000251.2(MSH2):c.530_531del (p.Glu177fs) rs63750551
NM_000251.2(MSH2):c.531A>G (p.Glu177=) rs1060504416
NM_000251.2(MSH2):c.53G>A (p.Gly18Asp) rs1200418561
NM_000251.2(MSH2):c.547C>T (p.Gln183Ter) rs63750037
NM_000251.2(MSH2):c.54C>G (p.Gly18=) rs63750777
NM_000251.2(MSH2):c.551del (p.Phe184fs) rs267607928
NM_000251.2(MSH2):c.552C>T (p.Phe184=) rs786202238
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.2(MSH2):c.560T>C (p.Leu187Pro) rs63751444
NM_000251.2(MSH2):c.560T>G (p.Leu187Arg) rs63751444
NM_000251.2(MSH2):c.561_569del (p.Glu188_Leu190del) rs63750088
NM_000251.2(MSH2):c.565G>T (p.Ala189Ser) rs63750821
NM_000251.2(MSH2):c.566C>G (p.Ala189Gly) rs141021599
NM_000251.2(MSH2):c.568_570CTC[1] (p.Leu191del) rs587779165
NM_000251.2(MSH2):c.569_570delinsCT (p.Leu190Pro) rs267607927
NM_000251.2(MSH2):c.573C>T (p.Leu191=) rs1800151
NM_000251.2(MSH2):c.576C>T (p.Ile192=) rs864622381
NM_000251.2(MSH2):c.577C>T (p.Gln193Ter) rs63751326
NM_000251.2(MSH2):c.587C>A (p.Pro196Gln) rs754478179
NM_000251.2(MSH2):c.587del (p.Pro196fs) rs63750682
NM_000251.2(MSH2):c.592G>A (p.Glu198Lys) rs587779166
NM_000251.2(MSH2):c.592dup (p.Glu198fs) rs63750786
NM_000251.2(MSH2):c.593A>G (p.Glu198Gly) rs63750327
NM_000251.2(MSH2):c.595T>C (p.Cys199Arg) rs63751110
NM_000251.2(MSH2):c.596G>A (p.Cys199Tyr) rs63751136
NM_000251.2(MSH2):c.599T>A (p.Val200Asp) rs587779167
NM_000251.2(MSH2):c.5C>T (p.Ala2Val) rs587778521
NM_000251.2(MSH2):c.605C>G (p.Pro202Arg) rs1060502002
NM_000251.2(MSH2):c.606C>G (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.606C>T (p.Pro202=) rs63750600
NM_000251.2(MSH2):c.607G>A (p.Gly203Arg) rs587779973
NM_000251.2(MSH2):c.610G>A (p.Gly204Arg) rs63750574
NM_000251.2(MSH2):c.610G>T (p.Gly204Ter) rs63750574
NM_000251.2(MSH2):c.611_612GA[5] (p.Thr206fs) rs1553350946
NM_000251.2(MSH2):c.613G>T (p.Glu205Ter) rs63749984
NM_000251.2(MSH2):c.616dup (p.Thr206fs) rs63750995
NM_000251.2(MSH2):c.622_627dup (p.Gly208_Asp209dup) rs1553350958
NM_000251.2(MSH2):c.638_639del (p.Leu213fs) rs63751622
NM_000251.2(MSH2):c.63C>T (p.Arg21=) rs1060504419
NM_000251.2(MSH2):c.642_645delACAG (p.Gln215Terfs) rs63751695
NM_000251.2(MSH2):c.643C>T (p.Gln215Ter) rs63751274
NM_000251.2(MSH2):c.644del (p.Gln215fs) rs1558459885
NM_000251.2(MSH2):c.645+1G>A rs267607689
NM_000251.2(MSH2):c.645+1G>T rs267607689
NM_000251.2(MSH2):c.645+2T>C rs876658996
NM_000251.2(MSH2):c.645+3A>G rs587779168
NM_000251.2(MSH2):c.646-1_648delGATA rs1553351549
NM_000251.2(MSH2):c.646-2A>G rs587779169
NM_000251.2(MSH2):c.646-3T>C rs267607930
NM_000251.2(MSH2):c.646-3T>G rs267607930
NM_000251.2(MSH2):c.646-3_654del rs267607929
NM_000251.2(MSH2):c.646-?_*(272_?)del
NM_000251.2(MSH2):c.646-?_1076+?del
NM_000251.2(MSH2):c.646-?_1076+?dup431
NM_000251.2(MSH2):c.646-?_1276+?del
NM_000251.2(MSH2):c.646-?_1386+?del
NM_000251.2(MSH2):c.646-?_792+?del
NM_000251.2(MSH2):c.646-?_942+?del
NM_000251.2(MSH2):c.646A>G (p.Ile216Val) rs63749936
NM_000251.2(MSH2):c.64T>A (p.Phe22Ile) rs1189127007
NM_000251.2(MSH2):c.650_654del (p.Ile217fs) rs63751602
NM_000251.2(MSH2):c.652C>T (p.Gln218Ter) rs587779170
NM_000251.2(MSH2):c.672C>G (p.Ile224Met) rs587779171
NM_000251.2(MSH2):c.675_679delinsTAAT (p.Glu226fs) rs587779172
NM_000251.2(MSH2):c.685A>T (p.Lys229Ter) rs587779173
NM_000251.2(MSH2):c.687_688insT (p.Ala230fs) rs63750364
NM_000251.2(MSH2):c.687del (p.Ala230fs) rs63749897
NM_000251.2(MSH2):c.687dup (p.Ala230fs) rs63749897
NM_000251.2(MSH2):c.691del (p.Asp231fs) rs587779174
NM_000251.2(MSH2):c.696_697del (p.Ser233fs) rs63750426
NM_000251.2(MSH2):c.6G>T (p.Ala2=) rs368270856
NM_000251.2(MSH2):c.701C>T (p.Thr234Ile) rs730881773
NM_000251.2(MSH2):c.704_705del (p.Lys235fs) rs281864944
NM_000251.2(MSH2):c.705del (p.Asp236fs) rs281864944
NM_000251.2(MSH2):c.711_714del (p.Tyr238fs) rs63751288
NM_000251.2(MSH2):c.712T>G (p.Tyr238Asp) rs1060501987
NM_000251.2(MSH2):c.715C>T (p.Gln239Ter) rs63750488
NM_000251.2(MSH2):c.716A>G (p.Gln239Arg) rs199676483
NM_000251.2(MSH2):c.717_721delinsTTA (p.Gln239fs) rs63750690
NM_000251.2(MSH2):c.71dup (p.Met26fs) rs587779175
NM_000251.2(MSH2):c.725dup (p.Asn242fs) rs587779176
NM_000251.2(MSH2):c.726C>T (p.Asn242=) rs748427458
NM_000251.2(MSH2):c.728G>A (p.Arg243Gln) rs63751455
NM_000251.2(MSH2):c.735G>C (p.Leu245Phe) rs864622271
NM_000251.2(MSH2):c.735dup (p.Lys246fs) rs63750107
NM_000251.2(MSH2):c.736A>C (p.Lys246Gln) rs63750881
NM_000251.2(MSH2):c.736A>T (p.Lys246Ter) rs63750881
NM_000251.2(MSH2):c.73_74insC (p.Gly25fs) rs587779177
NM_000251.2(MSH2):c.742A>G (p.Lys248Glu) rs587779178
NM_000251.2(MSH2):c.744A>C (p.Lys248Asn) rs1060502022
NM_000251.2(MSH2):c.746del (p.Lys249fs) rs63749832
NM_000251.2(MSH2):c.754C>T (p.Gln252Ter) rs63750347
NM_000251.2(MSH2):c.759_762del (p.Met253fs) rs267607931
NM_000251.2(MSH2):c.759del (p.Met253fs) rs63751160
NM_000251.2(MSH2):c.75del (p.Met26fs) rs1553348760
NM_000251.2(MSH2):c.761del (p.Asn254fs) rs587779179
NM_000251.2(MSH2):c.762T>C (p.Asn254=) rs587779180
NM_000251.2(MSH2):c.763A>G (p.Ser255Gly) rs761529282
NM_000251.2(MSH2):c.763_766delinsTT (p.Ser255fs) rs63750329
NM_000251.2(MSH2):c.766G>A (p.Ala256Thr) rs377403073
NM_000251.2(MSH2):c.767_768dup (p.Val257fs) rs587779181
NM_000251.2(MSH2):c.781A>G (p.Met261Val) rs786201941
NM_000251.2(MSH2):c.782T>C (p.Met261Thr) rs63749969
NM_000251.2(MSH2):c.782_783insA (p.Met261fs) rs786204144
NM_000251.2(MSH2):c.786G>T (p.Glu262Asp) rs754820584
NM_000251.2(MSH2):c.788_789del (p.Asn263fs) rs63751614
NM_000251.2(MSH2):c.792+10_943-448del
NM_000251.2(MSH2):c.792+1G>A rs267607934
NM_000251.2(MSH2):c.792+5A>G rs267607935
NM_000251.2(MSH2):c.792+6T>A rs553480072
NM_000251.2(MSH2):c.792G>A (p.Gln264=) rs587779183
NM_000251.2(MSH2):c.792G>C (p.Gln264His) rs587779183
NM_000251.2(MSH2):c.793-29A>T rs267607932
NM_000251.2(MSH2):c.793-2A>C rs267607933
NM_000251.2(MSH2):c.793-30A>G rs587779184
NM_000251.2(MSH2):c.793-6_942+450del rs1553352366
NM_000251.2(MSH2):c.793-?_1076+?del
NM_000251.2(MSH2):c.793-?_1076+?dup284
NM_000251.2(MSH2):c.793-?_1276+?del484
NM_000251.2(MSH2):c.793-?_1276+?dup
NM_000251.2(MSH2):c.793-?_1386+?deldel594
NM_000251.2(MSH2):c.793-?_942+?del
NM_000251.2(MSH2):c.795T>C (p.Val265=) rs63749903
NM_000251.2(MSH2):c.795del (p.Ala266fs) rs63749902
NM_000251.2(MSH2):c.798A>T (p.Ala266=) rs878853825
NM_000251.2(MSH2):c.7G>T (p.Val3Leu) rs1257347271
NM_000251.2(MSH2):c.803C>T (p.Ser268Leu) rs563410947
NM_000251.2(MSH2):c.806C>A (p.Ser269Ter) rs63750058
NM_000251.2(MSH2):c.806C>T (p.Ser269Leu) rs63750058
NM_000251.2(MSH2):c.80C>T (p.Pro27Leu) rs750746034
NM_000251.2(MSH2):c.810_811del (p.Ser271fs) rs63751133
NM_000251.2(MSH2):c.811_814del (p.Ser271fs) rs587779185
NM_000251.2(MSH2):c.814_815delinsAT (p.Ala272Met) rs587779186
NM_000251.2(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.2(MSH2):c.817_818delinsAA (p.Val273Lys) rs63749840
NM_000251.2(MSH2):c.819_821delinsTG (p.Ile274fs) rs864622261
NM_000251.2(MSH2):c.820A>G (p.Ile274Val) rs371944271
NM_000251.2(MSH2):c.82G>T (p.Glu28Ter) rs63751246
NM_000251.2(MSH2):c.82del (p.Glu28fs) rs587779188
NM_000251.2(MSH2):c.830T>A (p.Leu277Ter) rs786203424
NM_000251.2(MSH2):c.835C>G (p.Leu279Val) rs375351205
NM_000251.2(MSH2):c.836del (p.Leu279fs) rs63751159
NM_000251.2(MSH2):c.837C>T (p.Leu279=) rs747730026
NM_000251.2(MSH2):c.839dup (p.Leu280fs) rs63750091
NM_000251.2(MSH2):c.842C>A (p.Ser281Ter) rs63749991
NM_000251.2(MSH2):c.842C>G (p.Ser281Ter) rs63749991
NM_000251.2(MSH2):c.843A>G (p.Ser281=) rs150197753
NM_000251.2(MSH2):c.845A>G (p.Asp282Gly) rs587779978
NM_000251.2(MSH2):c.845_848del (p.Asp282fs) rs1553352462
NM_000251.2(MSH2):c.847G>T (p.Asp283Tyr) rs63750381
NM_000251.2(MSH2):c.84G>A (p.Glu28=) rs752220575
NM_000251.2(MSH2):c.854A>G (p.Asn285Ser) rs1060502031
NM_000251.2(MSH2):c.854del (p.Asn285fs) rs63750701
NM_000251.2(MSH2):c.859G>T (p.Gly287Ter) rs63750276
NM_000251.2(MSH2):c.85A>T (p.Lys29Ter) rs1060502001
NM_000251.2(MSH2):c.860_868del (p.Gly287_Phe289del) rs864622042
NM_000251.2(MSH2):c.860dup (p.Gln288fs) rs193922375
NM_000251.2(MSH2):c.862C>T (p.Gln288Ter) rs63750097
NM_000251.2(MSH2):c.863del (p.Gln288fs) rs587779189
NM_000251.2(MSH2):c.868G>T (p.Glu290Ter) rs587779190
NM_000251.2(MSH2):c.873_876del (p.Thr292fs) rs587779191
NM_000251.2(MSH2):c.87_90del (p.Thr31fs) rs1060502000
NM_000251.2(MSH2):c.881_882del (p.Thr293_Phe294insTer) rs63751115
NM_000251.2(MSH2):c.885C>G (p.Asp295Glu) rs201334592
NM_000251.2(MSH2):c.888C>G (p.Phe296Leu) rs876659918
NM_000251.2(MSH2):c.888del (p.Phe296fs) rs587779192
NM_000251.2(MSH2):c.892C>T (p.Gln298Ter) rs63750934
NM_000251.2(MSH2):c.896A>G (p.Tyr299Cys) rs1558464315
NM_000251.2(MSH2):c.896_897AT[3] (p.Met300fs) rs63750885
NM_000251.2(MSH2):c.89C>T (p.Pro30Leu) rs757892928
NM_000251.2(MSH2):c.901A>T (p.Lys301Ter) rs63749915
NM_000251.2(MSH2):c.905T>A (p.Leu302Ter) rs63749914
NM_000251.2(MSH2):c.912dup (p.Ala305fs) rs863224833
NM_000251.2(MSH2):c.913G>A (p.Ala305Thr) rs63751454
NM_000251.2(MSH2):c.915_922dup (p.Arg308fs) rs63750046
NM_000251.2(MSH2):c.925G>C (p.Ala309Pro) rs781257094
NM_000251.2(MSH2):c.929T>C (p.Leu310Pro) rs63750640
NM_000251.2(MSH2):c.929T>G (p.Leu310Arg) rs63750640
NM_000251.2(MSH2):c.92C>G (p.Thr31Ser) rs746635262
NM_000251.2(MSH2):c.933C>T (p.Asn311=) rs1060504424
NM_000251.2(MSH2):c.934C>G (p.Leu312Val) rs756398636
NM_000251.2(MSH2):c.942+17_942+29delAAAAAAAAAAAAA rs11309117
NM_000251.2(MSH2):c.942+1G>T rs587779193
NM_000251.2(MSH2):c.942+1delG rs1194793421
NM_000251.2(MSH2):c.942+20_942+29del rs11309117
NM_000251.2(MSH2):c.942+26_942+29delAAAA rs11309117
NM_000251.2(MSH2):c.942+28_942+29del rs11309117
NM_000251.2(MSH2):c.942+2T>G rs587779195
NM_000251.2(MSH2):c.942+2_942+6delTAAAA rs755583143
NM_000251.2(MSH2):c.942+2del rs587779194
NM_000251.2(MSH2):c.942+3A>T rs193922376
NM_000251.2(MSH2):c.942+3_942+7delAAAAA rs11309117
NM_000251.2(MSH2):c.942+3delA rs11309117
NM_000251.2(MSH2):c.942G>A (p.Gln314=) rs587779197
NM_000251.2(MSH2):c.943-1G>A rs12476364
NM_000251.2(MSH2):c.943-1G>C rs12476364
NM_000251.2(MSH2):c.943-25T>C rs775155213
NM_000251.2(MSH2):c.943-2A>G rs587779198
NM_000251.2(MSH2):c.943-?_1076+?del
NM_000251.2(MSH2):c.944G>T (p.Gly315Val) rs202026056
NM_000251.2(MSH2):c.94A>C (p.Thr32Pro) rs1060502033
NM_000251.2(MSH2):c.94_103del (p.Thr32fs) rs63750728
NM_000251.2(MSH2):c.955G>T (p.Asp319Tyr) rs876660605
NM_000251.2(MSH2):c.956A>T (p.Asp319Val) rs786204185
NM_000251.2(MSH2):c.958dup (p.Thr320fs) rs63749852
NM_000251.2(MSH2):c.95C>A (p.Thr32Asn) rs552361923
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000251.2(MSH2):c.965G>T (p.Gly322Val) rs4987188
NM_000251.2(MSH2):c.966C>T (p.Gly322=) rs878853829
NM_000251.2(MSH2):c.968C>A (p.Ser323Tyr) rs63750732
NM_000251.2(MSH2):c.968C>G (p.Ser323Cys) rs63750732
NM_000251.2(MSH2):c.968C>T (p.Ser323Phe) rs63750732
NM_000251.2(MSH2):c.970C>T (p.Gln324Ter) rs63750502
NM_000251.2(MSH2):c.970_971del (p.Gln324fs) rs63751044
NM_000251.2(MSH2):c.970_971ins4
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.2(MSH2):c.973dup (p.Ser325fs) rs63749945
NM_000251.2(MSH2):c.975T>C (p.Ser325=) rs1060504413
NM_000251.2(MSH2):c.978G>C (p.Leu326=) rs1060504418
NM_000251.2(MSH2):c.97A>C (p.Thr33Pro) rs63751107
NM_000251.2(MSH2):c.97A>G (p.Thr33Ala) rs63751107
NM_000251.2(MSH2):c.982G>A (p.Ala328Thr) rs753237286
NM_000251.2(MSH2):c.982G>C (p.Ala328Pro) rs753237286
NM_000251.2(MSH2):c.984C>G (p.Ala328=) rs4987189
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.2(MSH2):c.989T>C (p.Leu330Pro) rs63750630
NM_000251.2(MSH2):c.991A>G (p.Asn331Asp) rs267607938
NM_000251.2(MSH2):c.992A>G (p.Asn331Ser) rs779673318
NM_000251.2(MSH2):c.997T>C (p.Cys333Arg) rs63750468
NM_000251.2(MSH2):c.998G>A (p.Cys333Tyr) rs63750828
NM_000251.2:c.(?_1277)_(2634_?)del
NM_000251.2:c.1-?_1076+?dup
NM_000251.2:c.1760-?_2802+?del
NM_000251.2:c.1760-?_2805+?del
NM_000251.2:c.904-?_1386+?del
NM_001258281.1(MSH2):c.-130G>T rs587782786
NM_001258281.1(MSH2):c.-87G>A rs552303079
NM_001258281.1:c.595-?_2607+?del
Single allele
nsv513794

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.