ClinVar Miner

List of variants in gene MSH6 reported as likely benign for Lynch syndrome

Included ClinVar conditions (18):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 237
Download table as spreadsheet
HGVS dbSNP
MSH6:c.3647-51_3647-35del17 rs267607687
NM_000179.2(MSH6):c.-159C>T rs41540312
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1021T>G (p.Ser341Ala) rs1558660119
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.1125G>A (p.Glu375=) rs1060504741
NM_000179.2(MSH6):c.1153A>C (p.Arg385=) rs781652274
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1182T>C (p.Ser394=) rs863224325
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1206C>T (p.Phe402=) rs779504190
NM_000179.2(MSH6):c.1207C>A (p.Leu403Ile) rs876659223
NM_000179.2(MSH6):c.1209C>G (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1269T>G (p.Leu423=) rs774457540
NM_000179.2(MSH6):c.1272C>T (p.Val424=) rs63751452
NM_000179.2(MSH6):c.133G>T (p.Gly45Cys) rs978968846
NM_000179.2(MSH6):c.1347G>A (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.135C>A (p.Gly45=) rs876659020
NM_000179.2(MSH6):c.1400G>A (p.Gly467Asp) rs1558661547
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1410A>G (p.Ser470=) rs863224326
NM_000179.2(MSH6):c.1419G>T (p.Leu473=) rs864622535
NM_000179.2(MSH6):c.1434T>C (p.Tyr478=) rs1057521265
NM_000179.2(MSH6):c.1443A>G (p.Ala481=) rs878853703
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1487G>A (p.Cys496Tyr) rs764593111
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1515T>C (p.Tyr505=) rs878853704
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1554C>T (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.1560T>C (p.Gly520=) rs762396230
NM_000179.2(MSH6):c.1581G>A (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1581G>T (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1623C>T (p.Ser541=) rs777678406
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1667A>T (p.Tyr556Phe) rs63751312
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1713T>G (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1716G>A (p.Gln572=) rs745772518
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1770C>T (p.Pro590=) rs267608070
NM_000179.2(MSH6):c.1776A>G (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1806A>C (p.Ser602=) rs1057520981
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.1904G>A (p.Arg635Lys) rs1558663439
NM_000179.2(MSH6):c.1914T>G (p.Leu638=) rs766310490
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.2013G>A (p.Leu671=) rs765289515
NM_000179.2(MSH6):c.2035T>C (p.Leu679=) rs757741943
NM_000179.2(MSH6):c.204G>A (p.Lys68=) rs864622565
NM_000179.2(MSH6):c.207G>A (p.Ala69=) rs757025193
NM_000179.2(MSH6):c.2124A>G (p.Glu708=) rs781730324
NM_000179.2(MSH6):c.2154C>T (p.Ser718=) rs771662801
NM_000179.2(MSH6):c.2187C>T (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2193A>G (p.Gln731=) rs1055190211
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.219C>T (p.Asn73=) rs1060504756
NM_000179.2(MSH6):c.2211A>C (p.Ala737=) rs780916013
NM_000179.2(MSH6):c.2227T>C (p.Leu743=) rs749308906
NM_000179.2(MSH6):c.2241G>A (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2250A>C (p.Thr750=) rs1060504746
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2319C>A (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2367T>C (p.Asn789=) rs1060504738
NM_000179.2(MSH6):c.2391C>T (p.Asp797=) rs754870044
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.240A>G (p.Val80=) rs864622281
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.243G>T (p.Ala81=) rs1057523564
NM_000179.2(MSH6):c.246T>C (p.Pro82=) rs786201527
NM_000179.2(MSH6):c.249T>G (p.Ala83=) rs876658308
NM_000179.2(MSH6):c.2505G>A (p.Gln835=) rs863224328
NM_000179.2(MSH6):c.2508C>T (p.Asn836=) rs758170249
NM_000179.2(MSH6):c.2547A>G (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255C>T (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.2583T>A (p.Ala861=) rs1060504763
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+15delG rs1553408495
NM_000179.2(MSH6):c.261-14C>T rs369366445
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2676T>G (p.Ser892=) rs863224329
NM_000179.2(MSH6):c.2682G>A (p.Gln894=) rs756239543
NM_000179.2(MSH6):c.2685A>T (p.Thr895=) rs749539614
NM_000179.2(MSH6):c.2688A>G (p.Lys896=) rs876659173
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2820T>A (p.Ala940=) rs878853722
NM_000179.2(MSH6):c.2901A>C (p.Ile967=) rs863224330
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2964C>T (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2982C>T (p.Tyr994=) rs367758473
NM_000179.2(MSH6):c.2997C>G (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.3006C>T (p.Gly1002=) rs878853726
NM_000179.2(MSH6):c.3012A>G (p.Lys1004=) rs864622378
NM_000179.2(MSH6):c.3024C>G (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3029C>T (p.Thr1010Ile) rs768925694
NM_000179.2(MSH6):c.3030T>C (p.Thr1010=) rs1060504753
NM_000179.2(MSH6):c.3072G>A (p.Arg1024=) rs878853728
NM_000179.2(MSH6):c.3084A>T (p.Ser1028=) rs786201843
NM_000179.2(MSH6):c.3098T>A (p.Met1033Lys) rs751035257
NM_000179.2(MSH6):c.30C>T (p.Phe10=) rs786201869
NM_000179.2(MSH6):c.3126A>C (p.Lys1042Asn) rs1558668218
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3173-10_3173-6del rs781520783
NM_000179.2(MSH6):c.3173-12C>T rs1057517629
NM_000179.2(MSH6):c.3173-18T>C rs189672273
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3201T>C (p.Ser1067=) rs878853731
NM_000179.2(MSH6):c.3204A>T (p.Arg1068=) rs1060504764
NM_000179.2(MSH6):c.3207G>T (p.Gly1069=) rs267608074
NM_000179.2(MSH6):c.3213T>C (p.Asp1071=) rs534232216
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3255C>A (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3255C>G (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3258C>T (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3261C>G (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261C>T (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3327T>C (p.Ile1109=) rs878853733
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3435A>G (p.Arg1145=) rs1060504742
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3439-8A>G rs863224332
NM_000179.2(MSH6):c.3486T>C (p.Ala1162=) rs781119463
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3492G>A (p.Val1164=) rs1060504745
NM_000179.2(MSH6):c.3510T>C (p.Ile1170=) rs1001812170
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3556+10T>C rs863224333
NM_000179.2(MSH6):c.3556+32_3556+35delTTCA rs780754745
NM_000179.2(MSH6):c.3556+36_3556+39delGTCA rs55684722
NM_000179.2(MSH6):c.3557-40T>A rs189436849
NM_000179.2(MSH6):c.3570T>C (p.Phe1190=) rs1060504765
NM_000179.2(MSH6):c.3579A>G (p.Glu1193=) rs1060504759
NM_000179.2(MSH6):c.3625C>T (p.Leu1209=) rs753675331
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3647-11dupT rs774223571
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.3657T>C (p.Thr1219=) rs745491567
NM_000179.2(MSH6):c.3711G>A (p.Glu1237=) rs754289472
NM_000179.2(MSH6):c.3720A>G (p.Lys1240=) rs786203260
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3792A>C (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+21T>C rs34315174
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3801+8C>A rs864622734
NM_000179.2(MSH6):c.3802-8T>G rs864622195
NM_000179.2(MSH6):c.381C>T (p.Val127=) rs863224334
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3852G>T (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3861T>C (p.Tyr1287=) rs1060504739
NM_000179.2(MSH6):c.3882T>C (p.Cys1294=) rs1060504744
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.393A>G (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3964G>A (p.Glu1322Lys) rs1553333707
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15del rs267608132
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+27TAAC[3] rs267608136
NM_000179.2(MSH6):c.4002-10delT rs59056100
NM_000179.2(MSH6):c.4002-11_4002-10delTTinsA rs1553333946
NM_000179.2(MSH6):c.4002-11_4002-4delTTAATTTT rs1060504752
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-8A>T rs778957100
NM_000179.2(MSH6):c.4002-8delA rs267608139
NM_000179.2(MSH6):c.4012C>T (p.Leu1338=) rs1060504743
NM_000179.2(MSH6):c.4018A>G (p.Ser1340Gly) rs1558395603
NM_000179.2(MSH6):c.4062G>T (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.2(MSH6):c.417A>G (p.Thr139=) rs758390144
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+19_457+20delAT rs1491215647
NM_000179.2(MSH6):c.458-17A>G rs554847828
NM_000179.2(MSH6):c.458-5delT rs587781955
NM_000179.2(MSH6):c.458-6T>C rs1060504740
NM_000179.2(MSH6):c.458-8C>G rs372091232
NM_000179.2(MSH6):c.475G>A (p.Ala159Thr) rs1553411396
NM_000179.2(MSH6):c.511G>C (p.Glu171Gln) rs1558656518
NM_000179.2(MSH6):c.524C>T (p.Ala175Val) rs1060502929
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.542A>C (p.Glu181Ala) rs1558656620
NM_000179.2(MSH6):c.552T>C (p.Asn184=) rs786203679
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.60C>T (p.Ala20=) rs878853749
NM_000179.2(MSH6):c.627+9C>T rs373155872
NM_000179.2(MSH6):c.628-12C>T rs752105994
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.747G>A (p.Arg249=) rs63750372
NM_000179.2(MSH6):c.846G>C (p.Val282=) rs573638836
NM_000179.2(MSH6):c.84A>T (p.Ser28=) rs1060504748
NM_000179.2(MSH6):c.87C>G (p.Arg29=) rs778354962
NM_000179.2(MSH6):c.911T>C (p.Val304Ala) rs1481054050
NM_000179.2(MSH6):c.927T>C (p.Ser309=) rs771288794
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.971A>G (p.Lys324Arg) rs1558659961
NM_000179.2(MSH6):c.975A>G (p.Gln325=) rs193922345
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.993A>G (p.Ser331=) rs1060504750
NM_001281492.1(MSH6):c.3611+10dup rs730882138
NM_001281492.1(MSH6):c.3611+4_3611+8dup rs587782853

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.