ClinVar Miner

List of variants studied for Lynch syndrome

Included ClinVar conditions (18):
Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 4600
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 3p22.2(chr3:37089011-37116538)
MHS6:c.3647-65_3647-61del rs3136363
MLH1, 1-BP DEL, 1784T
MLH1, 11.6-KB DEL
MLH1, 2-BP DEL, 593AG
MLH1, 3-BP DEL, 213AGA
MLH1, 3.5-KB DEL
MLH1, 370-BP DEL
MLH1, EPIGENETICALLY SILENCED
MLH1, EX16DEL
MLH1, EX18DEL
MLH1, HYPERMETHYLATION
MLH1:c.(?_-198)_207+?del
MLH1:c.(?_-198)_306+?del
MSH2, 32-KB DEL, EX1-6
MSH2, DEL 50 CODONS
MSH6, 1-BP DEL, 594T
MSH6, 1-BP DEL, LEU222TER
MSH6, 13-KB DEL
MSH6, TRP1024TER
MSH6:c.3647-51_3647-35del17 rs267607687
NC_000002.11:g.(?_47369148)_(47369581_?)dup
NC_000002.11:g.(?_47596287)_(47596720_?)dup
NC_000002.11:g.(?_47596287)_(47604216_?)dup
NC_000002.11:g.(?_47596287)_(47614167_?)del
NC_000002.11:g.(?_47596287)_(47614167_?)dup
NC_000002.11:g.(?_47604153)_(47604216_?)del
NC_000002.11:g.(?_47606092)_(47614167_?)del
NC_000002.11:g.(?_47630206)_(47630541_?)del
NC_000002.11:g.(?_47630206)_(47635694_?)del
NC_000002.11:g.(?_47630206)_(47710367_?)del
NC_000002.11:g.(?_47639553)_(47710367_?)del
NC_000002.11:g.(?_47698104)_(47710367_?)dup
NC_000002.11:g.(?_47709918)_(47710088_?)del
NC_000002.11:g.(?_48010221)_(48010632_?)dup
NC_000002.11:g.(?_48010221)_(48032166_?)dup
NC_000002.11:g.(?_48018066)_(48018262_?)del
NC_000002.11:g.(?_48018066)_(48028294_?)del
NC_000002.11:g.(?_48030559)_(48032166_?)del
NC_000002.11:g.38121110_47669522inv
NC_000003.11:g.(?_37038110)_(37042544_?)del
NC_000003.11:g.(?_37053311)_(37059090_?)del
NC_000007.13:g.(?_6031604)_(6038906_?)del
NC_000007.13:g.(?_6031604)_(6042267_?)del
NC_000007.13:g.(?_6031604)_(6045662_?)del
NC_000007.13:g.(?_6031604)_(6048737_?)del
NC_000007.13:g.(?_6036957)_(6043689_?)del
NC_000007.13:g.(?_6043321)_(6043689_?)del
NC_000007.14:g.5997388del
NM_000179.2 (MSH6):c.3984_3987dupGTCA (p.Leu1330Valfs) rs267608121
NM_000179.2(MSH6):c.(?_-1)_457+?del
NM_000179.2(MSH6):c.(?_-152)_(*93_?)del
NM_000179.2(MSH6):c.(?_-152)_457+?del
NM_000179.2(MSH6):c.*1A>G rs587781604
NM_000179.2(MSH6):c.*24_*28delGTTGA rs587779200
NM_000179.2(MSH6):c.*4247G>A
NM_000179.2(MSH6):c.*5045T>C rs2537742
NM_000179.2(MSH6):c.*77_*78dup rs587779201
NM_000179.2(MSH6):c.*85T>A rs2020906
NM_000179.2(MSH6):c.-11863_457+1921del
NM_000179.2(MSH6):c.-118G>A rs556432240
NM_000179.2(MSH6):c.-13022_-1711del
NM_000179.2(MSH6):c.-152-?_4001+?dup
NM_000179.2(MSH6):c.-159C>T rs41540312
NM_000179.2(MSH6):c.-18G>T rs199913053
NM_000179.2(MSH6):c.-210C>T rs181096360
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-3097_457+2010del
NM_000179.2(MSH6):c.-41G>T rs886056140
NM_000179.2(MSH6):c.-448G>A rs3136229
NM_000179.2(MSH6):c.-51G>T rs375109921
NM_000179.2(MSH6):c.-557T>G rs3136228
NM_000179.2(MSH6):c.-56G>T rs886056139
NM_000179.2(MSH6):c.-6G>C rs730881822
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1021T>G (p.Ser341Ala) rs1558660119
NM_000179.2(MSH6):c.102_104CGC[1] (p.Ala37del) rs1553408197
NM_000179.2(MSH6):c.1030C>G (p.Gln344Glu) rs730881815
NM_000179.2(MSH6):c.1034A>G (p.Asn345Ser) rs864622377
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1039_1040insC (p.Glu347fs) rs1553412441
NM_000179.2(MSH6):c.1044C>A (p.Ser348=) rs587779202
NM_000179.2(MSH6):c.1046A>G (p.Gln349Arg) rs869312797
NM_000179.2(MSH6):c.104C>T (p.Ala35Val) rs776547943
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.1061G>T (p.Gly354Val) rs730881788
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1079G>T (p.Ser360Ile) rs267608060
NM_000179.2(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.1082G>A (p.Arg361His) rs63750440
NM_000179.2(MSH6):c.1085del (p.Pro362fs) rs267608056
NM_000179.2(MSH6):c.108T>G (p.Ala36=) rs63750213
NM_000179.2(MSH6):c.1093T>C (p.Trp365Arg) rs752628520
NM_000179.2(MSH6):c.1094G>C (p.Trp365Ser) rs587780558
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1100A>G (p.His367Arg) rs1553412495
NM_000179.2(MSH6):c.1101del (p.His367fs) rs587779203
NM_000179.2(MSH6):c.1106C>T (p.Thr369Ile) rs375974046
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1120A>G (p.Lys374Glu) rs1558660575
NM_000179.2(MSH6):c.1125G>A (p.Glu375=) rs1060504741
NM_000179.2(MSH6):c.1127A>G (p.Glu376Gly) rs764150912
NM_000179.2(MSH6):c.1128_1132del (p.Arg378_Arg379insTer) rs1114167801
NM_000179.2(MSH6):c.1130_1134AGAGA[1] (p.Arg378_Arg379insTer) rs267608077
NM_000179.2(MSH6):c.1133G>A (p.Arg378Lys) rs587779205
NM_000179.2(MSH6):c.1134A>C (p.Arg378Ser) rs878853700
NM_000179.2(MSH6):c.1139_1143del (p.Asp380fs) rs587779206
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.1147_1149AGG[2] (p.Arg385del) rs267608043
NM_000179.2(MSH6):c.1153A>C (p.Arg385=) rs781652274
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1163A>C (p.His388Pro) rs786201185
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1167C>T (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.1168_1170delinsAA (p.Asp390fs) rs863225398
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1182T>C (p.Ser394=) rs863224325
NM_000179.2(MSH6):c.1184C>T (p.Thr395Ile) rs767658494
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1189T>C (p.Tyr397His) rs587779913
NM_000179.2(MSH6):c.118G>A (p.Ala40Thr) rs754231971
NM_000179.2(MSH6):c.118G>T (p.Ala40Ser) rs754231971
NM_000179.2(MSH6):c.1190A>G (p.Tyr397Cys) rs63750065
NM_000179.2(MSH6):c.1190_1191del (p.Tyr397fs) rs63750439
NM_000179.2(MSH6):c.1193T>A (p.Val398Glu) rs587779208
NM_000179.2(MSH6):c.1196C>T (p.Pro399Leu) rs878853701
NM_000179.2(MSH6):c.1206C>T (p.Phe402=) rs779504190
NM_000179.2(MSH6):c.1207C>A (p.Leu403Ile) rs876659223
NM_000179.2(MSH6):c.1209C>G (p.Leu403=) rs748603803
NM_000179.2(MSH6):c.1238G>C (p.Trp413Ser) rs786201049
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1252T>C (p.Ser418Pro) rs1251033858
NM_000179.2(MSH6):c.1255C>G (p.Gln419Glu) rs762814792
NM_000179.2(MSH6):c.1255_1268del (p.Gln419fs) rs876661251
NM_000179.2(MSH6):c.1257G>A (p.Gln419=) rs63750026
NM_000179.2(MSH6):c.125_132dup (p.Gly45fs) rs1553408245
NM_000179.2(MSH6):c.1267C>A (p.Leu423Ile) rs587781657
NM_000179.2(MSH6):c.1269T>G (p.Leu423=) rs774457540
NM_000179.2(MSH6):c.1270G>A (p.Val424Ile) rs768299607
NM_000179.2(MSH6):c.1272C>G (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1272C>T (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1273A>G (p.Ile425Val) rs63749971
NM_000179.2(MSH6):c.1276del (p.Cys426fs) rs587779209
NM_000179.2(MSH6):c.1290G>A (p.Gly430=) rs1558661242
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1295_1296insAA (p.Phe432fs) rs1060502946
NM_000179.2(MSH6):c.1296T>G (p.Phe432Leu) rs863224614
NM_000179.2(MSH6):c.1299T>A (p.Tyr433Ter) rs267608055
NM_000179.2(MSH6):c.1299T>G (p.Tyr433Ter) rs267608055
NM_000179.2(MSH6):c.1304T>C (p.Leu435Pro) rs63751405
NM_000179.2(MSH6):c.1321C>G (p.Leu441Val) rs1553412749
NM_000179.2(MSH6):c.1325T>C (p.Ile442Thr) rs587779210
NM_000179.2(MSH6):c.1333_1334del (p.Val444_Ser445insTer) rs1060502940
NM_000179.2(MSH6):c.1338A>T (p.Glu446Asp) rs587779211
NM_000179.2(MSH6):c.133G>T (p.Gly45Cys) rs978968846
NM_000179.2(MSH6):c.1345C>T (p.Leu449=) rs3136333
NM_000179.2(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.2(MSH6):c.1347G>A (p.Leu449=) rs786201760
NM_000179.2(MSH6):c.1350_1351del (p.Phe451fs) rs878853702
NM_000179.2(MSH6):c.1352del (p.Phe451fs) rs869312769
NM_000179.2(MSH6):c.1359A>G (p.Lys453=) rs864622147
NM_000179.2(MSH6):c.135C>A (p.Gly45=) rs876659020
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1367G>A (p.Trp456Ter) rs587780538
NM_000179.2(MSH6):c.1369G>C (p.Ala457Pro) rs267608052
NM_000179.2(MSH6):c.136G>A (p.Gly46Arg) rs863224616
NM_000179.2(MSH6):c.136G>C (p.Gly46Arg) rs863224616
NM_000179.2(MSH6):c.1400G>A (p.Gly467Asp) rs1558661547
NM_000179.2(MSH6):c.1401C>T (p.Gly467=) rs1558661556
NM_000179.2(MSH6):c.1402C>T (p.Arg468Cys) rs369456858
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1406A>G (p.Tyr469Cys) rs748165218
NM_000179.2(MSH6):c.1407T>A (p.Tyr469Ter) rs587781408
NM_000179.2(MSH6):c.1410A>G (p.Ser470=) rs863224326
NM_000179.2(MSH6):c.1417C>G (p.Leu473Val) rs1060502924
NM_000179.2(MSH6):c.1419G>T (p.Leu473=) rs864622535
NM_000179.2(MSH6):c.1421_1422dup (p.Gln475fs) rs63750854
NM_000179.2(MSH6):c.1434T>C (p.Tyr478=) rs1057521265
NM_000179.2(MSH6):c.1439T>A (p.Val480Glu) rs1244531716
NM_000179.2(MSH6):c.1443A>G (p.Ala481=) rs878853703
NM_000179.2(MSH6):c.1444C>T (p.Arg482Ter) rs63750909
NM_000179.2(MSH6):c.1445G>C (p.Arg482Pro)
NM_000179.2(MSH6):c.1447G>C (p.Val483Leu) rs786204084
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1450G>A (p.Glu484Lys) rs587782706
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1477G>T (p.Glu493Ter) rs267608046
NM_000179.2(MSH6):c.1480G>T (p.Ala494Ser) rs758699749
NM_000179.2(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.2(MSH6):c.1487G>A (p.Cys496Tyr) rs764593111
NM_000179.2(MSH6):c.1498G>A (p.Ala500Thr) rs786204127
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.150G>T (p.Trp50Cys) rs876659674
NM_000179.2(MSH6):c.1515T>C (p.Tyr505=) rs878853704
NM_000179.2(MSH6):c.1519dup (p.Arg507fs) rs876658881
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1528_1530AGG[1] (p.Arg511del) rs993163672
NM_000179.2(MSH6):c.1529G>A (p.Arg510Lys) rs864622572
NM_000179.2(MSH6):c.1535A>G (p.Glu512Gly) rs1060502930
NM_000179.2(MSH6):c.1547T>A (p.Ile516Asn) rs587779213
NM_000179.2(MSH6):c.1553C>A (p.Thr518Asn) rs1553412945
NM_000179.2(MSH6):c.1554C>T (p.Thr518=) rs786201471
NM_000179.2(MSH6):c.155A>T (p.Glu52Val) rs878853707
NM_000179.2(MSH6):c.1560T>C (p.Gly520=) rs762396230
NM_000179.2(MSH6):c.1564C>A (p.Gln522Lys) rs878853708
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1569T>G (p.Thr523=) rs587779214
NM_000179.2(MSH6):c.1570_1571insC (p.Tyr524fs) rs878853709
NM_000179.2(MSH6):c.1571dup (p.Tyr524Ter) rs1553412966
NM_000179.2(MSH6):c.1572C>A (p.Tyr524Ter) rs587779215
NM_000179.2(MSH6):c.1572C>G (p.Tyr524Ter) rs587779215
NM_000179.2(MSH6):c.1573_3439-429dupinsTAT
NM_000179.2(MSH6):c.1576G>A (p.Val526Met) rs1060502899
NM_000179.2(MSH6):c.1580del (p.Leu527fs) rs63751090
NM_000179.2(MSH6):c.1581G>A (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1581G>T (p.Leu527=) rs775618855
NM_000179.2(MSH6):c.1590del (p.Ser532fs) rs587779216
NM_000179.2(MSH6):c.1596dup (p.Glu533Ter) rs587779217
NM_000179.2(MSH6):c.1599G>C (p.Glu533Asp) rs373726731
NM_000179.2(MSH6):c.1602del (p.Tyr535fs) rs63751234
NM_000179.2(MSH6):c.1606_1609AGTA[1] (p.Lys537fs) rs771764652
NM_000179.2(MSH6):c.1614_1615delinsAG (p.Tyr538_Leu539delinsTer) rs267608049
NM_000179.2(MSH6):c.1614_1615delinsG (p.Tyr538_Leu539delinsTer) rs587779218
NM_000179.2(MSH6):c.1615_1617CTT[1] (p.Leu540del) rs1064793600
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1621A>C (p.Ser541Arg) rs587779778
NM_000179.2(MSH6):c.1623C>T (p.Ser541=) rs777678406
NM_000179.2(MSH6):c.1628_1629del (p.Lys543fs) rs587779219
NM_000179.2(MSH6):c.1632_1635del (p.Lys545fs) rs267608064
NM_000179.2(MSH6):c.1633A>G (p.Lys545Glu) rs1064793403
NM_000179.2(MSH6):c.1634_1635del (p.Lys545fs) rs267608064
NM_000179.2(MSH6):c.1634_1637del (p.Lys545fs) rs63749874
NM_000179.2(MSH6):c.1635_1636AG[1] (p.Glu546fs) rs267608076
NM_000179.2(MSH6):c.1636G>C (p.Glu546Gln) rs63751172
NM_000179.2(MSH6):c.1651G>A (p.Gly551Ser) rs1558662449
NM_000179.2(MSH6):c.1652G>A (p.Gly551Asp) rs587779917
NM_000179.2(MSH6):c.1661G>A (p.Arg554His) rs730881791
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1667A>T (p.Tyr556Phe) rs63751312
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.1675T>C (p.Cys559Arg) rs1558662565
NM_000179.2(MSH6):c.1676G>A (p.Cys559Tyr) rs63750595
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1678T>C (p.Phe560Leu) rs863224617
NM_000179.2(MSH6):c.1691C>A (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1705_1706del (p.Phe569fs) rs587783056
NM_000179.2(MSH6):c.1708A>G (p.Ile570Val) rs61748081
NM_000179.2(MSH6):c.1713T>G (p.Gly571=) rs781019496
NM_000179.2(MSH6):c.1716G>A (p.Gln572=) rs745772518
NM_000179.2(MSH6):c.1723G>T (p.Asp575Tyr) rs863224619
NM_000179.2(MSH6):c.1729C>T (p.Arg577Cys) rs542838372
NM_000179.2(MSH6):c.1730G>A (p.Arg577His) rs376220212
NM_000179.2(MSH6):c.1732C>T (p.His578Tyr) rs768854566
NM_000179.2(MSH6):c.1739C>T (p.Ser580Leu) rs41295270
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1746dup (p.Arg583Ter) rs863224474
NM_000179.2(MSH6):c.1754T>C (p.Leu585Pro) rs587779220
NM_000179.2(MSH6):c.175C>A (p.Pro59Thr) rs761033647
NM_000179.2(MSH6):c.1760C>T (p.Ala587Val) rs1060502907
NM_000179.2(MSH6):c.1763A>G (p.His588Arg) rs786202725
NM_000179.2(MSH6):c.1769C>T (p.Pro590Leu) rs587782635
NM_000179.2(MSH6):c.1770C>T (p.Pro590=) rs267608070
NM_000179.2(MSH6):c.1771C>T (p.Pro591Ser) rs267608045
NM_000179.2(MSH6):c.1776A>G (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1784del (p.Leu595fs) rs267608050
NM_000179.2(MSH6):c.1786T>A (p.Phe596Ile) rs587779918
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1793A>G (p.Lys598Arg) rs587779919
NM_000179.2(MSH6):c.1794dup (p.Gly599fs) rs587780670
NM_000179.2(MSH6):c.1805C>A (p.Ser602Ter) rs730881816
NM_000179.2(MSH6):c.1805C>G (p.Ser602Ter) rs730881816
NM_000179.2(MSH6):c.1806A>C (p.Ser602=) rs1057520981
NM_000179.2(MSH6):c.1806_1809del (p.Glu604fs) rs63750735
NM_000179.2(MSH6):c.1809G>A (p.Lys603=) rs876660790
NM_000179.2(MSH6):c.1814C>G (p.Thr605Ser) rs587781616
NM_000179.2(MSH6):c.1819dup (p.Thr607fs) rs587779221
NM_000179.2(MSH6):c.1820C>G (p.Thr607Arg) rs786201676
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1830G>T (p.Lys610Asn) rs201735525
NM_000179.2(MSH6):c.1835C>A (p.Ser612Ter) rs63750564
NM_000179.2(MSH6):c.1842del (p.Cys615fs) rs730881825
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.184C>T (p.Arg62Cys) rs876659508
NM_000179.2(MSH6):c.1857A>C (p.Glu619Asp) rs63751121
NM_000179.2(MSH6):c.1858G>A (p.Gly620Ser) rs876661043
NM_000179.2(MSH6):c.185G>A (p.Arg62His) rs867979237
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1868C>T (p.Pro623Leu) rs63750462
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.1869del (p.Gly624fs) rs71539659
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1871del (p.Gly624fs) rs777159874
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.1878G>C (p.Gln626His) rs767285340
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.188C>A (p.Ser63Tyr) rs587779920
NM_000179.2(MSH6):c.1894A>G (p.Lys632Glu) rs755847154
NM_000179.2(MSH6):c.1901_1902del (p.Thr633_Leu634insTer) rs267608082
NM_000179.2(MSH6):c.1904G>A (p.Arg635Lys) rs1558663439
NM_000179.2(MSH6):c.1914T>G (p.Leu638=) rs766310490
NM_000179.2(MSH6):c.1915G>A (p.Glu639Lys) rs143517321
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1933del (p.Glu645fs) rs1558663559
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.1957_1960dup (p.Met654fs) rs63751167
NM_000179.2(MSH6):c.1993G>T (p.Glu665Ter) rs1333555322
NM_000179.2(MSH6):c.1995G>C (p.Glu665Asp) rs587778532
NM_000179.2(MSH6):c.1996T>C (p.Ser666Pro) rs587779222
NM_000179.2(MSH6):c.1999G>C (p.Asp667His) rs151086192
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2008G>A (p.Gly670Arg) rs63749857
NM_000179.2(MSH6):c.2013G>A (p.Leu671=) rs765289515
NM_000179.2(MSH6):c.2018C>T (p.Pro673Leu) rs864622085
NM_000179.2(MSH6):c.2025G>C (p.Glu675Asp) rs587779223
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2035T>C (p.Leu679=) rs757741943
NM_000179.2(MSH6):c.203A>G (p.Lys68Arg) rs863224620
NM_000179.2(MSH6):c.2041_2042CT[2] (p.Ser682fs) rs267608057
NM_000179.2(MSH6):c.2045C>T (p.Ser682Phe) rs587779225
NM_000179.2(MSH6):c.2048_2049CT[3] (p.Leu684_Gly685insTer) rs587779226
NM_000179.2(MSH6):c.204G>A (p.Lys68=) rs864622565
NM_000179.2(MSH6):c.2054G>C (p.Gly685Ala) rs63750358
NM_000179.2(MSH6):c.2056_2060delinsCTTCTACCTCAAAAA (p.Gly686fs) rs878853711
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2060_2061GT[1] (p.Val688fs) rs63750075
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2079dup (p.Cys694fs) rs267608083
NM_000179.2(MSH6):c.207G>A (p.Ala69=) rs757025193
NM_000179.2(MSH6):c.2080T>C (p.Cys694Arg) rs587779228
NM_000179.2(MSH6):c.2087T>C (p.Ile696Thr) rs587779229
NM_000179.2(MSH6):c.2089del (p.Asp697fs) rs863224475
NM_000179.2(MSH6):c.2092C>A (p.Gln698Lys) rs63750832
NM_000179.2(MSH6):c.2092C>G (p.Gln698Glu) rs63750832
NM_000179.2(MSH6):c.2092C>T (p.Gln698Ter) rs63750832
NM_000179.2(MSH6):c.2098C>A (p.Leu700Ile) rs587779230
NM_000179.2(MSH6):c.2098C>T (p.Leu700Phe) rs587779230
NM_000179.2(MSH6):c.2105C>G (p.Ser702Ter) rs63751419
NM_000179.2(MSH6):c.2107A>G (p.Met703Val) rs751867550
NM_000179.2(MSH6):c.2117T>C (p.Phe706Ser) rs587779231
NM_000179.2(MSH6):c.2124A>G (p.Glu708=) rs781730324
NM_000179.2(MSH6):c.2124_2126dup (p.Tyr709Ter) rs1558664335
NM_000179.2(MSH6):c.2127T>A (p.Tyr709Ter) rs587779232
NM_000179.2(MSH6):c.2137del (p.Asp713fs) rs864622257
NM_000179.2(MSH6):c.2145_2146CA[1] (p.Thr716fs) rs786204048
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2150_2153del (p.Val717fs) rs267608058
NM_000179.2(MSH6):c.2154C>T (p.Ser718=) rs771662801
NM_000179.2(MSH6):c.215_258del (p.Leu72fs) rs1553408380
NM_000179.2(MSH6):c.2161A>C (p.Arg721=) rs537604099
NM_000179.2(MSH6):c.2161A>G (p.Arg721Gly) rs537604099
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2176_2177delinsAG (p.Phe726Ser) rs63750136
NM_000179.2(MSH6):c.2177T>A (p.Phe726Tyr) rs574358605
NM_000179.2(MSH6):c.2180C>T (p.Thr727Ile)
NM_000179.2(MSH6):c.2183A>C (p.Lys728Thr) rs35552856
NM_000179.2(MSH6):c.2183A>G (p.Lys728Arg) rs35552856
NM_000179.2(MSH6):c.2187C>T (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2189A>G (p.Tyr730Cys) rs587782900
NM_000179.2(MSH6):c.2191C>T (p.Gln731Ter) rs63751442
NM_000179.2(MSH6):c.2193A>G (p.Gln731=) rs1055190211
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.2194C>T (p.Arg732Ter) rs63751127
NM_000179.2(MSH6):c.2195G>A (p.Arg732Gln) rs749746725
NM_000179.2(MSH6):c.219C>T (p.Asn73=) rs1060504756
NM_000179.2(MSH6):c.2200G>A (p.Val734Met) rs587780671
NM_000179.2(MSH6):c.2203C>A (p.Leu735Ile) rs786204071
NM_000179.2(MSH6):c.2210C>T (p.Ala737Val) rs869312798
NM_000179.2(MSH6):c.2211A>C (p.Ala737=) rs780916013
NM_000179.2(MSH6):c.2225A>C (p.Asn742Thr) rs878853715
NM_000179.2(MSH6):c.2225A>G (p.Asn742Ser) rs878853715
NM_000179.2(MSH6):c.2227T>C (p.Leu743=) rs749308906
NM_000179.2(MSH6):c.2230dup (p.Glu744fs) rs786201050
NM_000179.2(MSH6):c.2234T>A (p.Ile745Asn) rs1558664787
NM_000179.2(MSH6):c.2235T>G (p.Ile745Met) rs556339046
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2241G>A (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2246G>A (p.Gly749Glu) rs1060502916
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2250A>C (p.Thr750=) rs1060504746
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2281A>G (p.Arg761Gly) rs199876321
NM_000179.2(MSH6):c.2282G>A (p.Arg761Lys) rs587779233
NM_000179.2(MSH6):c.2287G>A (p.Asp763Asn) rs1558664969
NM_000179.2(MSH6):c.2291C>A (p.Thr764Asn) rs561198849
NM_000179.2(MSH6):c.2294dup (p.Cys765fs) rs1553413673
NM_000179.2(MSH6):c.2295C>G (p.Cys765Trp) rs63750985
NM_000179.2(MSH6):c.2297A>G (p.His766Arg) rs1060502870
NM_000179.2(MSH6):c.2300C>G (p.Thr767Ser) rs587781462
NM_000179.2(MSH6):c.2300C>T (p.Thr767Ile) rs587781462
NM_000179.2(MSH6):c.2302_2304del (p.Pro768del) rs63750647
NM_000179.2(MSH6):c.2308_2312delinsT (p.Gly770fs) rs864622585
NM_000179.2(MSH6):c.2312A>T (p.Lys771Met) rs864622586
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2315G>A (p.Arg772Gln) rs63750725
NM_000179.2(MSH6):c.2316_2317dup (p.Leu773fs) rs1553413693
NM_000179.2(MSH6):c.2318T>C (p.Leu773Pro) rs863224623
NM_000179.2(MSH6):c.2319C>A (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2320C>G (p.Leu774Val) rs864622324
NM_000179.2(MSH6):c.2329T>A (p.Trp777Arg) rs267608067
NM_000179.2(MSH6):c.2330G>A (p.Trp777Ter) rs587779234
NM_000179.2(MSH6):c.2339C>G (p.Ala780Gly) rs63749899
NM_000179.2(MSH6):c.233G>A (p.Arg78Lys) rs864622425
NM_000179.2(MSH6):c.2341C>A (p.Pro781Thr) rs587779235
NM_000179.2(MSH6):c.2341C>T (p.Pro781Ser) rs587779235
NM_000179.2(MSH6):c.2342C>T (p.Pro781Leu) rs1553413710
NM_000179.2(MSH6):c.2347T>A (p.Cys783Ser) rs373721483
NM_000179.2(MSH6):c.2348_2349del (p.Leu782_Cys783insTer) rs267608065
NM_000179.2(MSH6):c.2360C>G (p.Ala787Gly) rs63750637
NM_000179.2(MSH6):c.2360C>T (p.Ala787Val) rs63750637
NM_000179.2(MSH6):c.2367T>C (p.Asn789=) rs1060504738
NM_000179.2(MSH6):c.2375T>C (p.Leu792Pro) rs587779236
NM_000179.2(MSH6):c.2379_2380del (p.Ala794fs) rs587779237
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2387A>G (p.Glu796Gly) rs532445704
NM_000179.2(MSH6):c.2391C>T (p.Asp797=) rs754870044
NM_000179.2(MSH6):c.2392C>G (p.Leu798Val) rs587779238
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2408A>G (p.Asp803Gly) rs63751450
NM_000179.2(MSH6):c.240A>G (p.Val80=) rs864622281
NM_000179.2(MSH6):c.2417C>G (p.Ser806Cys) rs372990379
NM_000179.2(MSH6):c.2419G>A (p.Glu807Lys) rs587779923
NM_000179.2(MSH6):c.2419G>T (p.Glu807Ter) rs587779923
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.2426_2428del (p.Val809del) rs587779240
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.243G>T (p.Ala81=) rs1057523564
NM_000179.2(MSH6):c.246T>C (p.Pro82=) rs786201527
NM_000179.2(MSH6):c.2480A>C (p.Asn827Thr) rs1558665569
NM_000179.2(MSH6):c.2491C>G (p.Pro831Ala) rs267608053
NM_000179.2(MSH6):c.249T>G (p.Ala83=) rs876658308
NM_000179.2(MSH6):c.24C>G
NM_000179.2(MSH6):c.2503C>T (p.Gln835Ter) rs63751321
NM_000179.2(MSH6):c.2505G>A (p.Gln835=) rs863224328
NM_000179.2(MSH6):c.2508C>T (p.Asn836=) rs758170249
NM_000179.2(MSH6):c.2511C>G (p.His837Gln) rs587779925
NM_000179.2(MSH6):c.2515G>C (p.Asp839His) rs1553413868
NM_000179.2(MSH6):c.2518A>C (p.Ser840Arg) rs863224624
NM_000179.2(MSH6):c.2535dup (p.Glu846Ter) rs587779241
NM_000179.2(MSH6):c.2547A>G (p.Thr849=) rs769018957
NM_000179.2(MSH6):c.2549A>G (p.Tyr850Cys) rs63750389
NM_000179.2(MSH6):c.254_256CCA[1] (p.Thr86del) rs1553408448
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.255C>T (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2562G>C (p.Lys854Asn) rs759048538
NM_000179.2(MSH6):c.2562G>T (p.Lys854Asn) rs759048538
NM_000179.2(MSH6):c.2569G>A (p.Asp857Asn) rs368437140
NM_000179.2(MSH6):c.2569_2572del (p.Asp857fs) rs587779243
NM_000179.2(MSH6):c.2583T>A (p.Ala861=) rs1060504763
NM_000179.2(MSH6):c.2597A>C (p.Lys866Thr) rs190075874
NM_000179.2(MSH6):c.2597A>T (p.Lys866Ile) rs190075874
NM_000179.2(MSH6):c.260+101C>A rs267608030
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+131C>A rs267608031
NM_000179.2(MSH6):c.260+15delG rs1553408495
NM_000179.2(MSH6):c.260+2214C>T rs3136245
NM_000179.2(MSH6):c.260+22C>G rs55927047
NM_000179.2(MSH6):c.260+2467A>G rs3136247
NM_000179.2(MSH6):c.260+25A>C rs267608027
NM_000179.2(MSH6):c.260+43G>A rs267608028
NM_000179.2(MSH6):c.260+96A>C rs267608029
NM_000179.2(MSH6):c.2600T>G (p.Val867Gly) rs139598980
NM_000179.2(MSH6):c.261-1170G>T rs3136272
NM_000179.2(MSH6):c.261-14C>T rs369366445
NM_000179.2(MSH6):c.261-3237_3735del
NM_000179.2(MSH6):c.261-36A>G rs1800931
NM_000179.2(MSH6):c.261-?_457+?dup rs1558651844
NM_000179.2(MSH6):c.2611_2614dup (p.Ile872fs) rs63750357
NM_000179.2(MSH6):c.2624T>C (p.Met875Thr) rs774774596
NM_000179.2(MSH6):c.2629G>A (p.Glu877Lys) rs730881797
NM_000179.2(MSH6):c.2630A>G (p.Glu877Gly) rs1060502873
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2633T>G (p.Val878Gly) rs2020912
NM_000179.2(MSH6):c.2636C>A (p.Ala879Asp) rs1558666061
NM_000179.2(MSH6):c.2640_2641insAAA (p.Gly881_Phe882insLys) rs1252374906
NM_000179.2(MSH6):c.2641delinsAAAA (p.Gly881delinsLysSer) rs63751408
NM_000179.2(MSH6):c.2645_2653del (p.Phe882_Lys885delinsTer) rs876660630
NM_000179.2(MSH6):c.2656A>G (p.Ile886Val) rs2020914
NM_000179.2(MSH6):c.2660T>C (p.Leu887Pro) rs1558666142
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.2670C>A (p.Val890=) rs863224625
NM_000179.2(MSH6):c.2672_2674delinsC (p.Ile891fs) rs587779244
NM_000179.2(MSH6):c.2676T>G (p.Ser892=) rs863224329
NM_000179.2(MSH6):c.2677C>A (p.Leu893Met) rs370754319
NM_000179.2(MSH6):c.267C>G (p.Asp89Glu) rs762818044
NM_000179.2(MSH6):c.2680C>T (p.Gln894Ter) rs878853718
NM_000179.2(MSH6):c.2682G>A (p.Gln894=) rs756239543
NM_000179.2(MSH6):c.2685A>T (p.Thr895=) rs749539614
NM_000179.2(MSH6):c.2688A>G (p.Lys896=) rs876659173
NM_000179.2(MSH6):c.2690dup (p.Asn897fs) rs1553414010
NM_000179.2(MSH6):c.2692_2693del (p.Asn897_Pro898insTer) rs1553414029
NM_000179.2(MSH6):c.2693C>G (p.Pro898Arg) rs876661281
NM_000179.2(MSH6):c.2701C>A (p.Arg901Ser) rs772514245
NM_000179.2(MSH6):c.2701C>T (p.Arg901Cys) rs772514245
NM_000179.2(MSH6):c.2702G>A (p.Arg901His) rs63749889
NM_000179.2(MSH6):c.2708C>T (p.Pro903Leu) rs1060502919
NM_000179.2(MSH6):c.2714T>A (p.Leu905Ter) rs587779245
NM_000179.2(MSH6):c.2719_2720del (p.Val907fs) rs63750904
NM_000179.2(MSH6):c.2722G>A (p.Glu908Lys) rs886056144
NM_000179.2(MSH6):c.2731C>T (p.Arg911Ter) rs63751017
NM_000179.2(MSH6):c.2732G>A (p.Arg911Gln) rs761622304
NM_000179.2(MSH6):c.2734T>C (p.Trp912Arg) rs1060502869
NM_000179.2(MSH6):c.2739T>C (p.Asp913=) rs63750056
NM_000179.2(MSH6):c.2739_2740dup (p.Thr914fs) rs1553414092
NM_000179.2(MSH6):c.2743G>A (p.Ala915Thr) rs1558666565
NM_000179.2(MSH6):c.2743G>T (p.Ala915Ser) rs1558666565
NM_000179.2(MSH6):c.2744C>A (p.Ala915Asp) rs766427609
NM_000179.2(MSH6):c.2752C>T (p.His918Tyr) rs1558666591
NM_000179.2(MSH6):c.275C>T (p.Pro92Leu) rs1257646433
NM_000179.2(MSH6):c.2764C>T (p.Arg922Ter) rs587779246
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.2765del (p.Arg922fs) rs587779247
NM_000179.2(MSH6):c.2768dup (p.Thr924fs) rs267608063
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2775A>C (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2777T>C (p.Leu926Pro) rs1060502948
NM_000179.2(MSH6):c.2782A>G (p.Thr928Ala) rs1057519255
NM_000179.2(MSH6):c.2788A>G (p.Lys930Glu) rs878853719
NM_000179.2(MSH6):c.2789A>G (p.Lys930Arg) rs878853720
NM_000179.2(MSH6):c.2805dup (p.Asp936Ter) rs876659189
NM_000179.2(MSH6):c.2815C>T (p.Gln939Ter) rs63750140
NM_000179.2(MSH6):c.2820T>A (p.Ala940=) rs878853722
NM_000179.2(MSH6):c.2825_2827del (p.Ala942del) rs587779249
NM_000179.2(MSH6):c.2827G>T (p.Asp943Tyr) rs143520357
NM_000179.2(MSH6):c.2832_2833del (p.Ile944fs) rs730881827
NM_000179.2(MSH6):c.2846_2847AG[1] (p.Ser950fs) rs869312770
NM_000179.2(MSH6):c.2851_2858del (p.Leu951fs) rs63750940
NM_000179.2(MSH6):c.2857G>C (p.Glu953Gln) rs753034685
NM_000179.2(MSH6):c.2873_2874del (p.Gln958fs) rs1553414239
NM_000179.2(MSH6):c.2876G>A (p.Arg959His) rs757653982
NM_000179.2(MSH6):c.2901A>C (p.Ile967=) rs863224330
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2906A>C (p.Tyr969Ser) rs63749919
NM_000179.2(MSH6):c.2906A>G (p.Tyr969Cys) rs63749919
NM_000179.2(MSH6):c.2906A>T (p.Tyr969Phe) rs63749919
NM_000179.2(MSH6):c.2910G>A (p.Trp970Ter) rs765411990
NM_000179.2(MSH6):c.2910G>C (p.Trp970Cys) rs765411990
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2927G>A (p.Arg976His) rs63751113
NM_000179.2(MSH6):c.2931C>G (p.Tyr977Ter) rs63750111
NM_000179.2(MSH6):c.2945del (p.Pro982fs) rs587779250
NM_000179.2(MSH6):c.2949G>C (p.Glu983Asp) rs780485157
NM_000179.2(MSH6):c.2950A>C (p.Asn984His) rs146359682
NM_000179.2(MSH6):c.2951A>C (p.Asn984Thr) rs587779927
NM_000179.2(MSH6):c.2955C>G (p.Phe985Leu) rs63750942
NM_000179.2(MSH6):c.2959A>G (p.Thr987Ala) rs746631156
NM_000179.2(MSH6):c.2960C>T (p.Thr987Ile) rs587779928
NM_000179.2(MSH6):c.2963G>C (p.Arg988Pro) rs115386788
NM_000179.2(MSH6):c.2963G>T (p.Arg988Leu) rs115386788
NM_000179.2(MSH6):c.2964C>T (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2976del (p.Glu993fs) rs587779251
NM_000179.2(MSH6):c.297G>T (p.Lys99Asn) rs63751258
NM_000179.2(MSH6):c.2982C>T (p.Tyr994=) rs367758473
NM_000179.2(MSH6):c.2983G>A (p.Glu995Lys) rs63750258
NM_000179.2(MSH6):c.2983G>T (p.Glu995Ter) rs63750258
NM_000179.2(MSH6):c.2984del (p.Glu995fs) rs63749938
NM_000179.2(MSH6):c.2992T>A (p.Ser998Thr) rs730881800
NM_000179.2(MSH6):c.2997C>G (p.Thr999=) rs751279827
NM_000179.2(MSH6):c.3006C>T (p.Gly1002=) rs878853726
NM_000179.2(MSH6):c.3010A>G (p.Lys1004Glu) rs1558667702
NM_000179.2(MSH6):c.3012A>G (p.Lys1004=) rs864622378
NM_000179.2(MSH6):c.3013C>T (p.Arg1005Ter) rs63750563
NM_000179.2(MSH6):c.3014G>A (p.Arg1005Gln) rs587782324
NM_000179.2(MSH6):c.3018C>A (p.Tyr1006Ter) rs1553414395
NM_000179.2(MSH6):c.3019T>C (p.Trp1007Arg) rs1553414398
NM_000179.2(MSH6):c.3020G>A (p.Trp1007Ter) rs587779252
NM_000179.2(MSH6):c.3021G>C (p.Trp1007Cys) rs587779253
NM_000179.2(MSH6):c.3024C>G (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3029C>T (p.Thr1010Ile) rs768925694
NM_000179.2(MSH6):c.3030T>C (p.Thr1010=) rs1060504753
NM_000179.2(MSH6):c.3037_3039AAG[1] (p.Lys1014del) rs267608073
NM_000179.2(MSH6):c.3037_3041del (p.Lys1013fs) rs587782712
NM_000179.2(MSH6):c.3049A>C (p.Asn1017His) rs1060502943
NM_000179.2(MSH6):c.3051_3052TC[1] (p.Leu1018fs) rs63751407
NM_000179.2(MSH6):c.3062C>A (p.Ala1021Asp) rs63750287
NM_000179.2(MSH6):c.3067G>T (p.Glu1023Ter) rs267608059
NM_000179.2(MSH6):c.3071G>A (p.Arg1024Gln) rs372705506
NM_000179.2(MSH6):c.3072G>A (p.Arg1024=) rs878853728
NM_000179.2(MSH6):c.3076G>T (p.Asp1026Tyr) rs267608054
NM_000179.2(MSH6):c.3079G>A (p.Val1027Ile) rs876658397
NM_000179.2(MSH6):c.3084A>T (p.Ser1028=) rs786201843
NM_000179.2(MSH6):c.3098T>A (p.Met1033Lys) rs751035257
NM_000179.2(MSH6):c.309C>A (p.Tyr103Ter) rs1553410230
NM_000179.2(MSH6):c.30C>T (p.Phe10=) rs786201869
NM_000179.2(MSH6):c.3100C>T (p.Arg1034Trp) rs587779930
NM_000179.2(MSH6):c.3103C>T (p.Arg1035Ter) rs63749999
NM_000179.2(MSH6):c.3108_3109del (p.Phe1037fs) rs1553414519
NM_000179.2(MSH6):c.3111C>A (p.Phe1037Leu) rs587781673
NM_000179.2(MSH6):c.3113A>G (p.Tyr1038Cys) rs773357672
NM_000179.2(MSH6):c.3119_3120del (p.Asn1039_Phe1040insTer) rs267608042
NM_000179.2(MSH6):c.3126A>C (p.Lys1042Asn) rs1558668218
NM_000179.2(MSH6):c.3139T>C (p.Trp1047Arg) rs1114167753
NM_000179.2(MSH6):c.3142C>G (p.Gln1048Glu) rs200492211
NM_000179.2(MSH6):c.3142C>T (p.Gln1048Ter) rs200492211
NM_000179.2(MSH6):c.3149del (p.Ala1050fs) rs1060502882
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3153_3154AG[1] (p.Glu1052fs) rs63750833
NM_000179.2(MSH6):c.315G>T (p.Trp105Cys) rs1060502902
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3163G>A (p.Ala1055Thr) rs587779254
NM_000179.2(MSH6):c.3163G>C (p.Ala1055Pro) rs587779254
NM_000179.2(MSH6):c.3172+171C>T rs3136337
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3172G>C (p.Asp1058His) rs863225404
NM_000179.2(MSH6):c.3173-101G>C rs2072447
NM_000179.2(MSH6):c.3173-10_3173-6del rs781520783
NM_000179.2(MSH6):c.3173-12C>T rs1057517629
NM_000179.2(MSH6):c.3173-18T>C rs189672273
NM_000179.2(MSH6):c.3173-1G>C rs397515875
NM_000179.2(MSH6):c.3173-1_3173delGA rs587779256
NM_000179.2(MSH6):c.3173-3C>G rs1060502944
NM_000179.2(MSH6):c.3173-433_3556+228del
NM_000179.2(MSH6):c.3181C>G (p.Leu1061Val) rs1553331250
NM_000179.2(MSH6):c.3182del (p.Leu1061fs) rs63750196
NM_000179.2(MSH6):c.3185G>A (p.Cys1062Tyr) rs1558386797
NM_000179.2(MSH6):c.3188T>G (p.Leu1063Arg) rs1060502901
NM_000179.2(MSH6):c.3195_3198del (p.Asn1065fs) rs267608085
NM_000179.2(MSH6):c.3196_3197TA[3] (p.Ser1067fs) rs63749821
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3200G>C (p.Ser1067Thr) rs730881803
NM_000179.2(MSH6):c.3201T>C (p.Ser1067=) rs878853731
NM_000179.2(MSH6):c.3202C>T (p.Arg1068Ter) rs63749843
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3204A>T (p.Arg1068=) rs1060504764
NM_000179.2(MSH6):c.3205G>A (p.Gly1069Arg) rs764113705
NM_000179.2(MSH6):c.3205G>C (p.Gly1069Arg) rs764113705
NM_000179.2(MSH6):c.3206G>A (p.Gly1069Glu) rs63750784
NM_000179.2(MSH6):c.3207G>T (p.Gly1069=) rs267608074
NM_000179.2(MSH6):c.320C>T (p.Pro107Leu) rs878853732
NM_000179.2(MSH6):c.3213T>C (p.Asp1071=) rs534232216
NM_000179.2(MSH6):c.3214G>A (p.Gly1072Ser) rs1558386938
NM_000179.2(MSH6):c.3215_3222del (p.Gly1072fs) rs1057517552
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3218C>G (p.Pro1073Arg) rs587779257
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3220A>T (p.Met1074Leu) rs730881804
NM_000179.2(MSH6):c.3220_3221del (p.Met1074fs) rs1553331290
NM_000179.2(MSH6):c.3221T>C (p.Met1074Thr) rs1060502927
NM_000179.2(MSH6):c.3221del (p.Met1074fs) rs267608090
NM_000179.2(MSH6):c.3226C>G (p.Arg1076Gly) rs63750617
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3227G>A (p.Arg1076His) rs779617676
NM_000179.2(MSH6):c.3232G>C (p.Val1078Leu) rs587779932
NM_000179.2(MSH6):c.3233T>C (p.Val1078Ala) rs376452612
NM_000179.2(MSH6):c.3238_3239del (p.Leu1080fs) rs863225406
NM_000179.2(MSH6):c.3244C>T (p.Pro1082Ser) rs186240214
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3255C>A (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3255C>G (p.Thr1085=) rs371568610
NM_000179.2(MSH6):c.3256C>G (p.Pro1086Ala) rs756108143
NM_000179.2(MSH6):c.3258C>T (p.Pro1086=) rs863224331
NM_000179.2(MSH6):c.3259C>A (p.Pro1087Thr) rs63750998
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3259_3260insT (p.Pro1087fs) rs587779258
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3261C>G (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261C>T (p.Pro1087=) rs370226185
NM_000179.2(MSH6):c.3261_3263CTT[1] (p.Phe1088del) rs1060502917
NM_000179.2(MSH6):c.3261del (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3261dup (p.Phe1088fs) rs267608078
NM_000179.2(MSH6):c.3263dup (p.Glu1090fs) rs267608091
NM_000179.2(MSH6):c.3268_3274del (p.Glu1090fs) rs587779259
NM_000179.2(MSH6):c.3270G>C (p.Glu1090Asp) rs876660165
NM_000179.2(MSH6):c.3271C>G (p.Leu1091Val) rs1060502914
NM_000179.2(MSH6):c.3272T>G (p.Leu1091Arg) rs864622637
NM_000179.2(MSH6):c.3273dup (p.Lys1092Ter) rs267608095
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3299C>T (p.Thr1100Met) rs63750442
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3307T>G (p.Phe1103Val) rs1553331522
NM_000179.2(MSH6):c.3311_3312del (p.Phe1104fs) rs267608092
NM_000179.2(MSH6):c.3312T>A (p.Phe1104Leu) rs747441460
NM_000179.2(MSH6):c.3312del (p.Phe1104fs) rs267608092
NM_000179.2(MSH6):c.3312dup (p.Gly1105fs) rs267608092
NM_000179.2(MSH6):c.3314G>T (p.Gly1105Val) rs1060502910
NM_000179.2(MSH6):c.3320del (p.Asp1107fs) rs63750377
NM_000179.2(MSH6):c.3324dup (p.Ile1109fs) rs267608088
NM_000179.2(MSH6):c.3327T>C (p.Ile1109=) rs878853733
NM_000179.2(MSH6):c.3332_3335dup (p.Asp1112delinsGluTer) rs587782562
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.3338T>G (p.Ile1113Ser) rs41295272
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3341_3342insC (p.Ile1115fs) rs587779260
NM_000179.2(MSH6):c.334A>G (p.Asn112Asp) rs864622397
NM_000179.2(MSH6):c.3355G>T (p.Glu1119Ter) rs267608084
NM_000179.2(MSH6):c.335A>C (p.Asn112Thr) rs587779934
NM_000179.2(MSH6):c.335A>G (p.Asn112Ser) rs587779934
NM_000179.2(MSH6):c.3364C>G (p.Gln1122Glu) rs1060502892
NM_000179.2(MSH6):c.3367G>T (p.Glu1123Ter) rs267608086
NM_000179.2(MSH6):c.3371dup (p.Asn1124fs) rs1553331659
NM_000179.2(MSH6):c.3379G>A (p.Ala1127Thr) rs1060502880
NM_000179.2(MSH6):c.3379_3438+5del65 rs1553331676
NM_000179.2(MSH6):c.3383A>G (p.Tyr1128Cys) rs587779261
NM_000179.2(MSH6):c.3386_3388del (p.Cys1129_Val1130delinsLeu) rs587776705
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.3401G>C (p.Gly1134Ala) rs1376398586
NM_000179.2(MSH6):c.3415G>A (p.Gly1139Ser) rs63751063
NM_000179.2(MSH6):c.3416G>T (p.Gly1139Val) rs1316409501
NM_000179.2(MSH6):c.341C>G (p.Pro114Arg) rs863224626
NM_000179.2(MSH6):c.3425C>T (p.Thr1142Met) rs267608089
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3431T>G (p.Met1144Arg) rs864622607
NM_000179.2(MSH6):c.3435A>G (p.Arg1145=) rs1060504742
NM_000179.2(MSH6):c.3435del (p.Arg1145fs) rs863224476
NM_000179.2(MSH6):c.3436C>T (p.Gln1146Ter) rs63750356
NM_000179.2(MSH6):c.3437A>C (p.Gln1146Pro) rs587779262
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+1G>A rs267608096
NM_000179.2(MSH6):c.3438+2T>C rs1033749344
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3438+797_3438+798insTATins1839_3438+797
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3439-8A>G rs863224332
NM_000179.2(MSH6):c.3439-?_3556+?del
NM_000179.2(MSH6):c.3442G>A (p.Gly1148Ser) rs63750257
NM_000179.2(MSH6):c.3442G>C (p.Gly1148Arg) rs63750257
NM_000179.2(MSH6):c.3445T>A (p.Leu1149Ile) rs878853735
NM_000179.2(MSH6):c.3452C>G (p.Ala1151Gly) rs587782625
NM_000179.2(MSH6):c.3463C>T (p.Gln1155Ter) rs1553332166
NM_000179.2(MSH6):c.3467T>C (p.Met1156Thr) rs876659549
NM_000179.2(MSH6):c.3469G>A (p.Gly1157Ser) rs587779264
NM_000179.2(MSH6):c.346G>A (p.Asp116Asn) rs1060502871
NM_000179.2(MSH6):c.3470G>A (p.Gly1157Asp) rs752212361
NM_000179.2(MSH6):c.3470_3472GTT[1] (p.Cys1158del) rs587779265
NM_000179.2(MSH6):c.3476dup (p.Tyr1159Ter) rs587782111
NM_000179.2(MSH6):c.3477C>A (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3477C>G (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3477C>T (p.Tyr1159=) rs398123231
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3478G>C (p.Val1160Leu) rs376799914
NM_000179.2(MSH6):c.3478G>T (p.Val1160Phe) rs376799914
NM_000179.2(MSH6):c.3482_3484CTG[3] (p.Ala1162dup) rs63751427
NM_000179.2(MSH6):c.3484G>C (p.Ala1162Pro) rs587779266
NM_000179.2(MSH6):c.3486T>C (p.Ala1162=) rs781119463
NM_000179.2(MSH6):c.3487G>T (p.Glu1163Ter) rs587779267
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3492G>A (p.Val1164=) rs1060504745
NM_000179.2(MSH6):c.34C>A (p.Pro12Thr) rs587782084
NM_000179.2(MSH6):c.3508A>C (p.Ile1170Leu) rs1558389423
NM_000179.2(MSH6):c.3510T>C (p.Ile1170=) rs1001812170
NM_000179.2(MSH6):c.3511_3512del (p.Ile1170_Asp1171insTer) rs63751410
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3513_3514del (p.Asp1171fs) rs63750194
NM_000179.2(MSH6):c.3514dup (p.Arg1172fs) rs63751327
NM_000179.2(MSH6):c.3515G>C (p.Arg1172Thr) rs864622217
NM_000179.2(MSH6):c.3516_3519del (p.Arg1172fs) rs267608099
NM_000179.2(MSH6):c.3517_3528del (p.Val1173_Arg1176del) rs587779268
NM_000179.2(MSH6):c.3519_3520insA (p.Phe1174fs) rs63750296
NM_000179.2(MSH6):c.3519_3522dup (p.Thr1175fs) rs267608101
NM_000179.2(MSH6):c.3524C>G (p.Thr1175Ser) rs369583604
NM_000179.2(MSH6):c.3526A>T (p.Arg1176Ter) rs786203968
NM_000179.2(MSH6):c.3529C>G (p.Leu1177Val) rs748398941
NM_000179.2(MSH6):c.3543C>G (p.Asp1181Glu) rs267608100
NM_000179.2(MSH6):c.3556+10T>C rs863224333
NM_000179.2(MSH6):c.3556+146G>A rs7562048
NM_000179.2(MSH6):c.3556+160T>C rs56320267
NM_000179.2(MSH6):c.3556+1G>T
NM_000179.2(MSH6):c.3556+1delG rs1064793489
NM_000179.2(MSH6):c.3556+32_3556+35delTTCA rs780754745
NM_000179.2(MSH6):c.3556+36_3556+39delGTCA rs55684722
NM_000179.2(MSH6):c.3556+3_3556+13del rs587779269
NM_000179.2(MSH6):c.3556+64C>A rs587779270
NM_000179.2(MSH6):c.3557-2dup rs587779271
NM_000179.2(MSH6):c.3557-3A>T rs41295274
NM_000179.2(MSH6):c.3557-40T>A rs189436849
NM_000179.2(MSH6):c.3557-4delT rs267608102
NM_000179.2(MSH6):c.3557-?_(*93_?)del
NM_000179.2(MSH6):c.3557G>A (p.Gly1186Asp) rs587781690
NM_000179.2(MSH6):c.3558_3565del (p.Glu1187fs) rs267608108
NM_000179.2(MSH6):c.3563G>A (p.Ser1188Asn) rs587779272
NM_000179.2(MSH6):c.356T>G (p.Phe119Cys) rs1060502893
NM_000179.2(MSH6):c.3570T>C (p.Phe1190=) rs1060504765
NM_000179.2(MSH6):c.3573dup (p.Val1192fs) rs1057517764
NM_000179.2(MSH6):c.3574del (p.Val1192fs) rs1553332671
NM_000179.2(MSH6):c.3577G>A (p.Glu1193Lys) rs63751328
NM_000179.2(MSH6):c.3579A>G (p.Glu1193=) rs1060504759
NM_000179.2(MSH6):c.3598A>G (p.Ile1200Val) rs781627838
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3600A>G (p.Ile1200Met) rs587781482
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3604A>G (p.Met1202Val) rs369778514
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3605_3608TGCA[1] (p.His1203fs) rs587779274
NM_000179.2(MSH6):c.3610G>A (p.Ala1204Thr) rs869312799
NM_000179.2(MSH6):c.3613_3615dup (p.Thr1205dup) rs1558390840
NM_000179.2(MSH6):c.3614C>T (p.Thr1205Ile) rs587779275
NM_000179.2(MSH6):c.3619C>T (p.His1207Tyr) rs760391254
NM_000179.2(MSH6):c.361C>T (p.Arg121Cys) rs763593669
NM_000179.2(MSH6):c.3625C>T (p.Leu1209=) rs753675331
NM_000179.2(MSH6):c.362G>A (p.Arg121His) rs769279475
NM_000179.2(MSH6):c.3632T>C (p.Leu1211Pro) rs864622041
NM_000179.2(MSH6):c.3634G>A (p.Val1212Met) rs864622748
NM_000179.2(MSH6):c.3635T>C (p.Val1212Ala) rs1060502896
NM_000179.2(MSH6):c.3635dup (p.Asp1213fs) rs63750731
NM_000179.2(MSH6):c.3636G>T (p.Val1212=) rs1363247790
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3646+1G>T rs1553332772
NM_000179.2(MSH6):c.3646+35_3646+38delATCT rs1805181
NM_000179.2(MSH6):c.3646+35_3646+38dup rs1805181
NM_000179.2(MSH6):c.3646+3_3646+4insT rs587779277
NM_000179.2(MSH6):c.3646+91T>C rs3136359
NM_000179.2(MSH6):c.3646_3646+3del rs267608106
NM_000179.2(MSH6):c.3647-11dupT rs774223571
NM_000179.2(MSH6):c.3647-1G>A rs587779279
NM_000179.2(MSH6):c.3647-2A>C rs267608111
NM_000179.2(MSH6):c.3647-35_3647-34insTTTGTTCTAATTCCTTT rs397515292
NM_000179.2(MSH6):c.3647-51_3647-35dup rs267607687
NM_000179.2(MSH6):c.3647-66_3647-61del rs587779281
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.3647-6_3647-1del rs267608112
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3650G>A (p.Arg1217Lys) rs63749898
NM_000179.2(MSH6):c.3652G>C (p.Gly1218Arg) rs776407427
NM_000179.2(MSH6):c.3656C>T (p.Thr1219Ile) rs63750949
NM_000179.2(MSH6):c.3657T>C (p.Thr1219=) rs745491567
NM_000179.2(MSH6):c.3660_3663dup (p.Phe1222fs) rs752404604
NM_000179.2(MSH6):c.3674C>T (p.Thr1225Met) rs63750370
NM_000179.2(MSH6):c.3678_3706dup (p.Ala1236delinsGluTer) rs1553332996
NM_000179.2(MSH6):c.3679A>T (p.Ile1227Leu) rs587779282
NM_000179.2(MSH6):c.3682G>C (p.Ala1228Pro) rs587779283
NM_000179.2(MSH6):c.3685A>C (p.Asn1229His) rs774249402
NM_000179.2(MSH6):c.3686A>G (p.Asn1229Ser) rs730881807
NM_000179.2(MSH6):c.3690del (p.Val1231fs) rs730881829
NM_000179.2(MSH6):c.3691_3693GTT[1] (p.Val1232del) rs587779284
NM_000179.2(MSH6):c.3694G>C (p.Val1232Leu) rs41295276
NM_000179.2(MSH6):c.3699_3702del (p.Lys1233fs) rs193922343
NM_000179.2(MSH6):c.3699_3702dup (p.Leu1235fs) rs193922343
NM_000179.2(MSH6):c.3701_3706dup (p.Glu1234_Leu1235dup) rs63750523
NM_000179.2(MSH6):c.3705T>C (p.Leu1235=) rs545552712
NM_000179.2(MSH6):c.3706G>C (p.Ala1236Pro) rs1553333039
NM_000179.2(MSH6):c.3711G>A (p.Glu1237=) rs754289472
NM_000179.2(MSH6):c.3711G>C (p.Glu1237Asp) rs754289472
NM_000179.2(MSH6):c.3717_3721dup (p.Cys1241Ter) rs878853736
NM_000179.2(MSH6):c.3720A>G (p.Lys1240=) rs786203260
NM_000179.2(MSH6):c.3722G>A (p.Cys1241Tyr) rs1021631442
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3724_3726del (p.Arg1242del) rs63749942
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3725G>T (p.Arg1242Leu) rs63750119
NM_000179.2(MSH6):c.3725_3727del (p.Arg1242_Thr1243delinsPro) rs587779286
NM_000179.2(MSH6):c.3725_3737del (p.Arg1242fs) rs587779287
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3728C>A (p.Thr1243Lys) rs878853737
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3729_3732dup (p.Phe1245fs) rs587779288
NM_000179.2(MSH6):c.3740C>G (p.Thr1247Ser) rs786204182
NM_000179.2(MSH6):c.3742C>G (p.His1248Asp) rs63750882
NM_000179.2(MSH6):c.3743_3744insT (p.Tyr1249fs) rs786201084
NM_000179.2(MSH6):c.3753_3756dup (p.Val1253fs) rs876661222
NM_000179.2(MSH6):c.3757_3758insA (p.Val1253fs) rs587779289
NM_000179.2(MSH6):c.3757_3767del (p.Val1253fs) rs1553333093
NM_000179.2(MSH6):c.3758T>C (p.Val1253Ala) rs202066386
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3768T>G (p.Tyr1256Ter) rs63751058
NM_000179.2(MSH6):c.3772C>T (p.Gln1258Ter) rs63750554
NM_000179.2(MSH6):c.3784G>C (p.Val1262Leu) rs587779290
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3788G>A (p.Arg1263His) rs147852216
NM_000179.2(MSH6):c.3792A>C (p.Leu1264=) rs786202051
NM_000179.2(MSH6):c.3797_3798AT[1] (p.Met1267fs) rs267608114
NM_000179.2(MSH6):c.3798_3801+26del rs587779291
NM_000179.2(MSH6):c.3800T>C (p.Met1267Thr) rs148445930
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+1G>T rs876660943
NM_000179.2(MSH6):c.3801+21T>C rs34315174
NM_000179.2(MSH6):c.3801+2T>C rs1558392617
NM_000179.2(MSH6):c.3801+38T>A rs587779292
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3801+8C>A rs864622734
NM_000179.2(MSH6):c.3802-40C>G rs3136367
NM_000179.2(MSH6):c.3802-42_3802-41insA rs267608116
NM_000179.2(MSH6):c.3802-8T>G rs864622195
NM_000179.2(MSH6):c.3803C>A (p.Ala1268Glu) rs587779293
NM_000179.2(MSH6):c.3803C>T (p.Ala1268Val) rs587779293
NM_000179.2(MSH6):c.3804dup (p.Cys1269fs) rs267608118
NM_000179.2(MSH6):c.3811G>A (p.Val1271Ile) rs770929545
NM_000179.2(MSH6):c.3814_3827dup (p.Asp1277fs) rs1558393070
NM_000179.2(MSH6):c.3817_3820AATG[3] (p.Cys1275Ter) rs63750262
NM_000179.2(MSH6):c.381C>T (p.Val127=) rs863224334
NM_000179.2(MSH6):c.3820G>A (p.Glu1274Lys) rs587779294
NM_000179.2(MSH6):c.3820G>T (p.Glu1274Ter) rs587779294
NM_000179.2(MSH6):c.3824G>A (p.Cys1275Tyr) rs150990541
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3836G>A (p.Ser1279Asn) rs864622400
NM_000179.2(MSH6):c.3837_3843del (p.Ser1279fs) rs1553333370
NM_000179.2(MSH6):c.3838C>T (p.Gln1280Ter) rs63750139
NM_000179.2(MSH6):c.383G>T (p.Arg128Leu) rs63750143
NM_000179.2(MSH6):c.3840_3846del (p.Glu1281fs) rs63751319
NM_000179.2(MSH6):c.3841G>C (p.Glu1281Gln) rs876659115
NM_000179.2(MSH6):c.3841_3847dup (p.Ile1283fs) rs1114167720
NM_000179.2(MSH6):c.3844A>C (p.Thr1282Pro) rs764507968
NM_000179.2(MSH6):c.3847A>G (p.Ile1283Val) rs144714869
NM_000179.2(MSH6):c.3847_3850dup (p.Thr1284fs) rs267608128
NM_000179.2(MSH6):c.3850_3857dup (p.Tyr1287fs) rs1553333432
NM_000179.2(MSH6):c.3850dup (p.Thr1284fs) rs1553333421
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3852G>T (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3861T>C (p.Tyr1287=) rs1060504739
NM_000179.2(MSH6):c.3864dup (p.Phe1289fs) rs878853739
NM_000179.2(MSH6):c.3867C>G (p.Phe1289Leu) rs878853740
NM_000179.2(MSH6):c.3882T>C (p.Cys1294=) rs1060504744
NM_000179.2(MSH6):c.3887_3893del (p.Lys1296fs) rs267608130
NM_000179.2(MSH6):c.38A>C (p.Lys13Thr) rs41294988
NM_000179.2(MSH6):c.3904G>A (p.Ala1302Thr) rs1553333561
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3917_3938dup (p.Gln1314_Lys1315insTer) rs1553333584
NM_000179.2(MSH6):c.3918dup (p.Asn1307Ter) rs1553333594
NM_000179.2(MSH6):c.3919A>C (p.Asn1307His) rs730881808
NM_000179.2(MSH6):c.3920_3927dup (p.Glu1310fs) rs587779295
NM_000179.2(MSH6):c.3922_3940dup (p.Gln1314fs) rs1553333598
NM_000179.2(MSH6):c.3922_3944dup (p.Lys1315fs) rs1553333599
NM_000179.2(MSH6):c.3923_3924insATCT
NM_000179.2(MSH6):c.3930G>C (p.Glu1310Asp) rs267608129
NM_000179.2(MSH6):c.3932_3935dup (p.Ile1313fs) rs267608127
NM_000179.2(MSH6):c.3934_3937dup (p.Ile1313fs) rs760190301
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.3936_3951del (p.Ile1313fs) rs1553333635
NM_000179.2(MSH6):c.3938_3941dup (p.Gln1314fs) rs267608126
NM_000179.2(MSH6):c.3939_3940dup (p.Gln1314fs) rs730881830
NM_000179.2(MSH6):c.3939_3957dup (p.Ala1320delinsSerLysGlyThrTer) rs63750767
NM_000179.2(MSH6):c.3939_3959dup (p.Gln1314_Ala1320dup) rs1553333670
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.393A>G (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3940C>T (p.Gln1314Ter) rs1416452389
NM_000179.2(MSH6):c.3949C>G (p.His1317Asp) rs759092293
NM_000179.2(MSH6):c.3952A>T
NM_000179.2(MSH6):c.3953_3954ins32 (p.?)
NM_000179.2(MSH6):c.3957dup (p.Ala1320fs) rs587779297
NM_000179.2(MSH6):c.3959_3962del (p.Ala1320fs) rs267608120
NM_000179.2(MSH6):c.395A>C (p.Gln132Pro) rs587779298
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3963A>G (p.Arg1321=) rs267608125
NM_000179.2(MSH6):c.3963A>T (p.Arg1321Ser) rs267608125
NM_000179.2(MSH6):c.3964G>A (p.Glu1322Lys) rs1553333707
NM_000179.2(MSH6):c.3964G>T (p.Glu1322Ter) rs1553333707
NM_000179.2(MSH6):c.3969_3979del (p.Phe1323fs) rs587779299
NM_000179.2(MSH6):c.3969_4001+51dup rs1553333716
NM_000179.2(MSH6):c.3969_4001+52dup rs1553333718
NM_000179.2(MSH6):c.3971_3973AGA[1] (p.Lys1325del) rs587779300
NM_000179.2(MSH6):c.3972G>C (p.Glu1324Asp) rs587779938
NM_000179.2(MSH6):c.3973A>T (p.Lys1325Ter) rs1060502937
NM_000179.2(MSH6):c.3980_3983dup (p.Leu1330fs) rs1553333738
NM_000179.2(MSH6):c.3984_3985insATCA (p.Ser1329fs) rs267608124
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.2(MSH6):c.3992G>T (p.Arg1331Leu) rs184131049
NM_000179.2(MSH6):c.3994T>A (p.Leu1332Ile) rs786204160
NM_000179.2(MSH6):c.3996_3999dup (p.Arg1334fs) rs1553333753
NM_000179.2(MSH6):c.3996_4000dup (p.Arg1334fs) rs587779301
NM_000179.2(MSH6):c.3G>T (p.Met1Ile) rs876660095
NM_000179.2(MSH6):c.4000C>T (p.Arg1334Trp) rs773763465
NM_000179.2(MSH6):c.4000_4001+17dup19 rs1064794929
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15del rs267608132
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+1G>C rs1114167729
NM_000179.2(MSH6):c.4001+27TAAC[3] rs267608136
NM_000179.2(MSH6):c.4001+2T>C rs267608131
NM_000179.2(MSH6):c.4001+34_4001+43dup rs1553333811
NM_000179.2(MSH6):c.4001+42_4001+44dup rs926031657
NM_000179.2(MSH6):c.4001+42_4001+45dup rs587779304
NM_000179.2(MSH6):c.4001+47T>C rs587779305
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-10delT rs59056100
NM_000179.2(MSH6):c.4002-11_4002-10del rs59056100
NM_000179.2(MSH6):c.4002-11_4002-10delTTinsA rs1553333946
NM_000179.2(MSH6):c.4002-11_4002-10dup rs59056100
NM_000179.2(MSH6):c.4002-11_4002-4delTTAATTTT rs1060504752
NM_000179.2(MSH6):c.4002-12_4002-10dup rs59056100
NM_000179.2(MSH6):c.4002-13_4002-10dup rs59056100
NM_000179.2(MSH6):c.4002-14T>C rs587781041
NM_000179.2(MSH6):c.4002-22_4002-10delinsAAGGG rs878853744
NM_000179.2(MSH6):c.4002-22_4002-4del rs587779310
NM_000179.2(MSH6):c.4002-31_4002-8inv
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-8A>T rs778957100
NM_000179.2(MSH6):c.4002-8delA rs267608139
NM_000179.2(MSH6):c.4002-8dupA rs267608139
NM_000179.2(MSH6):c.4002-9_4002-7delAAT rs864622105
NM_000179.2(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.2(MSH6):c.4005A>C (p.Glu1335Asp) rs786204130
NM_000179.2(MSH6):c.4012C>T (p.Leu1338=) rs1060504743
NM_000179.2(MSH6):c.4016_4017dup (p.Ser1340fs) rs876661127
NM_000179.2(MSH6):c.4018A>G (p.Ser1340Gly) rs1558395603
NM_000179.2(MSH6):c.4022_4077dup (p.Leu1360delinsLysGlyGlnLeuTer) rs1553334006
NM_000179.2(MSH6):c.4024_4044del (p.Arg1342_Glu1348del) rs1064792973
NM_000179.2(MSH6):c.4034_4042del (p.Val1345_Ala1347del) rs864622703
NM_000179.2(MSH6):c.4039G>C (p.Ala1347Pro) rs730881809
NM_000179.2(MSH6):c.4043A>C (p.Glu1348Ala) rs1449733937
NM_000179.2(MSH6):c.4061T>A (p.Leu1354Gln) rs267608140
NM_000179.2(MSH6):c.4062G>T (p.Leu1354=) rs863224335
NM_000179.2(MSH6):c.4064_4065insGTCA (p.Leu1356fs) rs267608141
NM_000179.2(MSH6):c.4068G>C (p.Leu1356Phe) rs192740549
NM_000179.2(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.2(MSH6):c.4072A>G (p.Lys1358Glu) rs199739099
NM_000179.2(MSH6):c.4077_4080dup (p.Ter1361IleextTer?) rs575068534
NM_000179.2(MSH6):c.4079_4080TA[1] (p.Ter1361AspextTer?) rs863224830
NM_000179.2(MSH6):c.4081dup (p.Ter1361LeuextTer?) rs1060502898
NM_000179.2(MSH6):c.4083_*3GACT[3] (p.Ter1361=) rs765313977
NM_000179.2(MSH6):c.417A>G (p.Thr139=) rs758390144
NM_000179.2(MSH6):c.41C>T (p.Ser14Phe) rs863224628
NM_000179.2(MSH6):c.426G>A (p.Trp142Ter) rs63750342
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.440T>A (p.Leu147His) rs63750525
NM_000179.2(MSH6):c.448C>T (p.Pro150Ser) rs587782406
NM_000179.2(MSH6):c.44C>T (p.Pro15Leu) rs869312800
NM_000179.2(MSH6):c.457+1223T>C rs2348244
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+14C>G rs267608033
NM_000179.2(MSH6):c.457+19_457+20delAT rs1491215647
NM_000179.2(MSH6):c.457+2T>A rs267608036
NM_000179.2(MSH6):c.457+2dupT rs876661224
NM_000179.2(MSH6):c.457+394T>C rs3136284
NM_000179.2(MSH6):c.457+3A>G rs1060502921
NM_000179.2(MSH6):c.457+52T>A rs3136282
NM_000179.2(MSH6):c.457+52_457+53dup rs397839804
NM_000179.2(MSH6):c.457+59_457+60del rs587779312
NM_000179.2(MSH6):c.457+63_457+64del rs267608034
NM_000179.2(MSH6):c.457G>A (p.Gly153Ser) rs1060502885
NM_000179.2(MSH6):c.457G>T (p.Gly153Cys) rs1060502885
NM_000179.2(MSH6):c.458-13C>G rs1057522695
NM_000179.2(MSH6):c.458-17A>G rs554847828
NM_000179.2(MSH6):c.458-1G>A rs267608035
NM_000179.2(MSH6):c.458-52G>T rs1800934
NM_000179.2(MSH6):c.458-5delT rs587781955
NM_000179.2(MSH6):c.458-6T>C rs1060504740
NM_000179.2(MSH6):c.458-8C>G rs372091232
NM_000179.2(MSH6):c.458-?_3172+?del
NM_000179.2(MSH6):c.458-?_3556+?del
NM_000179.2(MSH6):c.458-?_4001+?del
NM_000179.2(MSH6):c.458-?_627+?del
NM_000179.2(MSH6):c.467C>G (p.Ser156Ter) rs63749873
NM_000179.2(MSH6):c.470A>T (p.Lys157Met) rs1060502923
NM_000179.2(MSH6):c.475G>A (p.Ala159Thr) rs1553411396
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.498C>T (p.Tyr166=) rs587779313
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.511G>C (p.Glu171Gln) rs1558656518
NM_000179.2(MSH6):c.520_521AG[1] (p.Arg174fs) rs267608037
NM_000179.2(MSH6):c.521G>A (p.Arg174Lys) rs863224629
NM_000179.2(MSH6):c.524C>G (p.Ala175Gly) rs1060502929
NM_000179.2(MSH6):c.524C>T (p.Ala175Val) rs1060502929
NM_000179.2(MSH6):c.531A>T (p.Gln177His) rs886056142
NM_000179.2(MSH6):c.533G>A (p.Arg178His) rs786204186
NM_000179.2(MSH6):c.535G>T (p.Ala179Ser) rs587781817
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.542A>C (p.Glu181Ala) rs1558656620
NM_000179.2(MSH6):c.545C>G (p.Ala182Gly)
NM_000179.2(MSH6):c.552T>C (p.Asn184=) rs786203679
NM_000179.2(MSH6):c.553A>G (p.Lys185Glu) rs193922344
NM_000179.2(MSH6):c.556G>T (p.Asp186Tyr) rs1212607928
NM_000179.2(MSH6):c.55del (p.Asp19fs) rs1553408127
NM_000179.2(MSH6):c.583G>T (p.Val195Phe) rs267608038
NM_000179.2(MSH6):c.597del (p.Ser200fs)
NM_000179.2(MSH6):c.599C>A (p.Ser200Ter) rs63751077
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.603G>A (p.Glu201=) rs587779314
NM_000179.2(MSH6):c.60C>T (p.Ala20=) rs878853749
NM_000179.2(MSH6):c.619G>T (p.Glu207Ter)
NM_000179.2(MSH6):c.622A>G (p.Met208Val) rs369058374
NM_000179.2(MSH6):c.627+1200T>C rs3136326
NM_000179.2(MSH6):c.627+26_627+37del rs1558656848
NM_000179.2(MSH6):c.627+9C>T rs373155872
NM_000179.2(MSH6):c.628-12C>T rs752105994
NM_000179.2(MSH6):c.628-56C>T rs1800936
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.628-874C>T rs3136329
NM_000179.2(MSH6):c.62A>G (p.Asn21Ser) rs267608025
NM_000179.2(MSH6):c.637A>C (p.Thr213Pro) rs876659071
NM_000179.2(MSH6):c.642C>A (p.Tyr214Ter) rs1800937
NM_000179.2(MSH6):c.642C>G (p.Tyr214Ter) rs1800937
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.648_649delinsTT (p.Asp217Tyr) rs63750471
NM_000179.2(MSH6):c.650A>G (p.Asp217Gly) rs554012110
NM_000179.2(MSH6):c.651dup (p.Lys218Ter) rs63750955
NM_000179.2(MSH6):c.652A>T (p.Lys218Ter) rs587779315
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.663A>G (p.Glu221=) rs41557217
NM_000179.2(MSH6):c.668A>G (p.Asn223Ser) rs587779316
NM_000179.2(MSH6):c.670G>A (p.Glu224Lys) rs1060502933
NM_000179.2(MSH6):c.677A>G (p.Glu226Gly) rs587781777
NM_000179.2(MSH6):c.680G>T (p.Ser227Ile) rs587779317
NM_000179.2(MSH6):c.682G>A (p.Glu228Lys) rs587779947
NM_000179.2(MSH6):c.68C>G (p.Ala23Gly) rs1060502912
NM_000179.2(MSH6):c.694C>T (p.Gln232Ter) rs587779318
NM_000179.2(MSH6):c.698C>G (p.Pro233Arg) rs142949377
NM_000179.2(MSH6):c.706C>T (p.Gln236Ter) rs63750996
NM_000179.2(MSH6):c.710del (p.Gly237fs) rs587779319
NM_000179.2(MSH6):c.713C>A (p.Ser238Tyr) rs587782510
NM_000179.2(MSH6):c.718C>T (p.Arg240Ter) rs63750019
NM_000179.2(MSH6):c.719G>A (p.Arg240Gln) rs542848931
NM_000179.2(MSH6):c.722G>A (p.Ser241Asn) rs1060502906
NM_000179.2(MSH6):c.725G>C (p.Ser242Thr) rs1060502925
NM_000179.2(MSH6):c.727C>T (p.Arg243Cys) rs377216828
NM_000179.2(MSH6):c.730C>T (p.Gln244Ter) rs267608066
NM_000179.2(MSH6):c.738_739insT (p.Lys247Ter) rs587779320
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.741del (p.Lys247fs) rs267608041
NM_000179.2(MSH6):c.741dup (p.Arg248fs) rs267608041
NM_000179.2(MSH6):c.742C>T (p.Arg248Ter) rs63749980
NM_000179.2(MSH6):c.747G>A (p.Arg249=) rs63750372
NM_000179.2(MSH6):c.749T>C (p.Val250Ala) rs587781275
NM_000179.2(MSH6):c.751A>G (p.Ile251Val) rs554884560
NM_000179.2(MSH6):c.751A>T (p.Ile251Leu) rs554884560
NM_000179.2(MSH6):c.753A>G (p.Ile251Met) rs587779321
NM_000179.2(MSH6):c.755C>G (p.Ser252Ter) rs267608048
NM_000179.2(MSH6):c.762_763del (p.Glu255_Ser256insTer) rs267608072
NM_000179.2(MSH6):c.782C>T (p.Ser261Phe) rs876661250
NM_000179.2(MSH6):c.806C>G (p.Thr269Ser) rs587779322
NM_000179.2(MSH6):c.814G>T (p.Glu272Ter) rs63750552
NM_000179.2(MSH6):c.816A>C (p.Glu272Asp) rs863224631
NM_000179.2(MSH6):c.818G>T (p.Gly273Val) rs769610487
NM_000179.2(MSH6):c.831A>C (p.Glu277Asp) rs374486449
NM_000179.2(MSH6):c.838A>G (p.Ser280Gly) rs1558659442
NM_000179.2(MSH6):c.842G>A (p.Gly281Glu) rs773445382
NM_000179.2(MSH6):c.845dup (p.Asp284fs) rs1553412283
NM_000179.2(MSH6):c.846G>C (p.Val282=) rs573638836
NM_000179.2(MSH6):c.84A>T (p.Ser28=) rs1060504748
NM_000179.2(MSH6):c.854G>T (p.Ser285Ile) rs63750878
NM_000179.2(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.867C>T (p.Gly289=) rs267608047
NM_000179.2(MSH6):c.87C>G (p.Arg29=) rs778354962
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.884A>T (p.Lys295Ile) rs267608051
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000179.2(MSH6):c.893G>A (p.Arg298Gln) rs765237563
NM_000179.2(MSH6):c.900dup (p.Lys301fs) rs863225421
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.905G>C (p.Arg302Thr) rs587781510
NM_000179.2(MSH6):c.908dup (p.Met303fs) rs1057517551
NM_000179.2(MSH6):c.910G>A (p.Val304Met) rs876661207
NM_000179.2(MSH6):c.911T>C (p.Val304Ala) rs1481054050
NM_000179.2(MSH6):c.923G>C (p.Gly308Ala) rs1553412354
NM_000179.2(MSH6):c.927T>C (p.Ser309=) rs771288794
NM_000179.2(MSH6):c.938A>G (p.Lys313Arg) rs753373644
NM_000179.2(MSH6):c.941G>A (p.Ser314Asn) rs760100983
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.94G>T (p.Gly32Cys) rs776859837
NM_000179.2(MSH6):c.958C>T (p.Pro320Ser) rs754879198
NM_000179.2(MSH6):c.971A>G (p.Lys324Arg) rs1558659961
NM_000179.2(MSH6):c.972A>C (p.Lys324Asn) rs876658610
NM_000179.2(MSH6):c.975A>G (p.Gln325=) rs193922345
NM_000179.2(MSH6):c.977C>T (p.Ala326Val) rs587779323
NM_000179.2(MSH6):c.979A>G (p.Thr327Ala) rs730881814
NM_000179.2(MSH6):c.983G>C (p.Ser328Thr) rs1060502879
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.989C>A (p.Ser330Ter) rs786202848
NM_000179.2(MSH6):c.993A>G (p.Ser331=) rs1060504750
NM_000179.2(MSH6):c.997A>G (p.Thr333Ala) rs886056143
NM_000179.2(MSH6):c.998C>G (p.Thr333Ser) rs587781983
NM_000179.2(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000179.2(MSH6):c.999del (p.Lys334fs) rs1060502932
NM_000179.2:c.1-?_260+?del
NM_000179.2:c.1-?_260+?dup
NM_000179.2:c.1-?_3646+?del
NM_000179.2:c.1-?_4083+?del
NM_000249.3(MLH1):c.(?_-198)_(*193_?)del
NM_000249.3(MLH1):c.(?_-198)_116+?del
NM_000249.3(MLH1):c.(?_-198)_116+?dup
NM_000249.3(MLH1):c.(?_-198)_1558+?del
NM_000249.3(MLH1):c.(?_-198)_545+?del
NM_000249.3(MLH1):c.(?_-198)_884+?del
NM_000249.3(MLH1):c.(?_1732)_(2271_?)del
NM_000249.3(MLH1):c.*162_*165delGATT rs796807655
NM_000249.3(MLH1):c.*167T>A rs587778879
NM_000249.3(MLH1):c.*32C>T rs200903126
NM_000249.3(MLH1):c.*32_*34CTT[1] rs193922366
NM_000249.3(MLH1):c.*3A>G rs587778880
NM_000249.3(MLH1):c.-101C>G rs772482820
NM_000249.3(MLH1):c.-107C>G rs587778886
NM_000249.3(MLH1):c.-114T>C rs886058380
NM_000249.3(MLH1):c.-117G>T rs565891017
NM_000249.3(MLH1):c.-22C>T rs771060933
NM_000249.3(MLH1):c.-269C>G rs35032294
NM_000249.3(MLH1):c.-27C>A rs587779001
NM_000249.3(MLH1):c.-27C>T rs587779001
NM_000249.3(MLH1):c.-28A>G rs56198082
NM_000249.3(MLH1):c.-28A>T rs56198082
NM_000249.3(MLH1):c.-381_207+606del
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.-53G>T rs587779020
NM_000249.3(MLH1):c.-54519_1731+2263del
NM_000249.3(MLH1):c.-64G>T rs587779030
NM_000249.3(MLH1):c.-73960_*46597del
NM_000249.3(MLH1):c.-7C>T rs104894994
NM_000249.3(MLH1):c.-86G>A rs558051715
NM_000249.3(MLH1):c.-93G>A rs1800734
NM_000249.3(MLH1):c.1003C>T (p.Leu335=) rs267607812
NM_000249.3(MLH1):c.1005G>A (p.Leu335=) rs1060504008
NM_000249.3(MLH1):c.1007G>A (p.Gly336Asp) rs587781750
NM_000249.3(MLH1):c.1007del (p.Gly336fs) rs63750434
NM_000249.3(MLH1):c.1008C>A (p.Gly336=) rs863224338
NM_000249.3(MLH1):c.100G>A (p.Glu34Lys) rs1559500884
NM_000249.3(MLH1):c.100_101GA[1] (p.Glu34fs) rs63749813
NM_000249.3(MLH1):c.1010C>G (p.Ser337Cys) rs763847201
NM_000249.3(MLH1):c.1011del (p.Asn338fs) rs63750677
NM_000249.3(MLH1):c.1011dup (p.Asn338fs) rs63750677
NM_000249.3(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.3(MLH1):c.1017del (p.Ser340fs) rs63750339
NM_000249.3(MLH1):c.1023del (p.Met342fs) rs63749837
NM_000249.3(MLH1):c.1024_1038+1delATGTACTTCACCCAGG rs1553648201
NM_000249.3(MLH1):c.1026G>A (p.Met342Ile) rs1060500704
NM_000249.3(MLH1):c.1026dup (p.Tyr343fs) rs587778881
NM_000249.3(MLH1):c.1032del (p.Phe344fs) rs1553648225
NM_000249.3(MLH1):c.1035C>T (p.Thr345=) rs758668630
NM_000249.3(MLH1):c.1037A>G (p.Gln346Arg) rs63751609
NM_000249.3(MLH1):c.1038+1005G>T rs3774338
NM_000249.3(MLH1):c.1038+15C>T rs886058382
NM_000249.3(MLH1):c.1038+19C>T rs267607818
NM_000249.3(MLH1):c.1038+1G>C rs267607816
NM_000249.3(MLH1):c.1038+4A>C rs1251478879
NM_000249.3(MLH1):c.1038+51C>T rs55986674
NM_000249.3(MLH1):c.1038+86T>C rs2286939
NM_000249.3(MLH1):c.1038+8C>T rs751872237
NM_000249.3(MLH1):c.1038G>A (p.Gln346=) rs63751715
NM_000249.3(MLH1):c.1038G>C (p.Gln346His) rs63751715
NM_000249.3(MLH1):c.1038G>T (p.Gln346His) rs63751715
NM_000249.3(MLH1):c.1039-10_1039-8dupTTT rs57509953
NM_000249.3(MLH1):c.1039-13_1039-8dupTTTTTT rs57509953
NM_000249.3(MLH1):c.1039-1G>A rs267607819
NM_000249.3(MLH1):c.1039-2329_1409+827del
NM_000249.3(MLH1):c.1039-2A>C rs267607815
NM_000249.3(MLH1):c.1039-2A>G rs267607815
NM_000249.3(MLH1):c.1039-2A>T rs267607815
NM_000249.3(MLH1):c.1039-33_1039-29del rs148615368
NM_000249.3(MLH1):c.1039-3C>G rs730881737
NM_000249.3(MLH1):c.1039-4A>G rs368618417
NM_000249.3(MLH1):c.1039-5T>C rs587782626
NM_000249.3(MLH1):c.1039-675_1409+26del
NM_000249.3(MLH1):c.1039-78A>G rs11129748
NM_000249.3(MLH1):c.1039-8T>A rs193922367
NM_000249.3(MLH1):c.1039-8_1039-7insTTTTAA rs535965616
NM_000249.3(MLH1):c.1039-8_1039-7insTTTTTTTTTTTTTTTTTTTTTTTTA rs535965616
NM_000249.3(MLH1):c.1039-8_1039-7insTTTTTTTTTTTTTTTTTTTTTTTTTTTTA rs535965616
NM_000249.3(MLH1):c.1039-9T>G rs1060504009
NM_000249.3(MLH1):c.1039-?_(*193_?)del
NM_000249.3(MLH1):c.1039-?_1409+?del
NM_000249.3(MLH1):c.1039-?_1558+?del
NM_000249.3(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.3(MLH1):c.1043del (p.Leu348fs) rs1060500703
NM_000249.3(MLH1):c.1046dup (p.Pro350fs) rs267607822
NM_000249.3(MLH1):c.1047dup (p.Pro350fs) rs1060500707
NM_000249.3(MLH1):c.104T>G (p.Met35Arg) rs63749906
NM_000249.3(MLH1):c.104_105delinsAC (p.Met35Asn) rs121912965
NM_000249.3(MLH1):c.104_105insAA (p.Met35fs) rs587778882
NM_000249.3(MLH1):c.1050del (p.Gly351fs) rs587778883
NM_000249.3(MLH1):c.1058C>T (p.Ala353Val) rs63751265
NM_000249.3(MLH1):c.1061del (p.Gly354fs) rs63750472
NM_000249.3(MLH1):c.1071_1078del (p.Gly357_Glu358insTer) rs587778884
NM_000249.3(MLH1):c.1072_1078del (p.Glu358fs) rs1060500692
NM_000249.3(MLH1):c.1072del (p.Glu358fs) rs587778885
NM_000249.3(MLH1):c.1078G>T (p.Val360Phe) rs878853775
NM_000249.3(MLH1):c.107T>A (p.Ile36Asn) rs267607707
NM_000249.3(MLH1):c.1088_1090CAA[1] (p.Thr364del) rs876660192
NM_000249.3(MLH1):c.1090A>G (p.Thr364Ala) rs63749864
NM_000249.3(MLH1):c.109G>A (p.Glu37Lys) rs63751012
NM_000249.3(MLH1):c.109G>C (p.Glu37Gln) rs63751012
NM_000249.3(MLH1):c.109G>T (p.Glu37Ter) rs63751012
NM_000249.3(MLH1):c.1101del (p.Ser368fs) rs63750715
NM_000249.3(MLH1):c.1103C>T (p.Ser368Leu) rs201673334
NM_000249.3(MLH1):c.1104G>A (p.Ser368=) rs769364808
NM_000249.3(MLH1):c.1111A>T (p.Thr371Ser) rs762426947
NM_000249.3(MLH1):c.1117G>A (p.Gly373Arg) rs766904735
NM_000249.3(MLH1):c.1118G>A (p.Gly373Glu) rs774878513
NM_000249.3(MLH1):c.111G>T (p.Glu37Asp) rs864622485
NM_000249.3(MLH1):c.1122T>G (p.Ser374Arg) rs759868546
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.1128_1129dup (p.Lys377fs) rs63750305
NM_000249.3(MLH1):c.112A>C (p.Asn38His) rs63750580
NM_000249.3(MLH1):c.112A>G (p.Asn38Asp) rs63750580
NM_000249.3(MLH1):c.1132_1134delinsA (p.Val378fs) rs587778887
NM_000249.3(MLH1):c.1136A>G (p.Tyr379Cys) rs143009528
NM_000249.3(MLH1):c.113A>C (p.Asn38Thr) rs587778888
NM_000249.3(MLH1):c.113A>G (p.Asn38Ser) rs587778888
NM_000249.3(MLH1):c.1141C>T (p.His381Tyr) rs63750557
NM_000249.3(MLH1):c.1145dup (p.Met383fs) rs587778889
NM_000249.3(MLH1):c.1146G>C (p.Gln382His) rs876658801
NM_000249.3(MLH1):c.1148T>C (p.Met383Thr) rs141344760
NM_000249.3(MLH1):c.114C>A (p.Asn38Lys)
NM_000249.3(MLH1):c.114C>G (p.Asn38Lys) rs267607706
NM_000249.3(MLH1):c.1150del (p.Val384fs) rs63749965
NM_000249.3(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.3(MLH1):c.1153C>T (p.Arg385Cys) rs63750760
NM_000249.3(MLH1):c.1154G>A (p.Arg385His) rs63750430
NM_000249.3(MLH1):c.1154G>C (p.Arg385Pro) rs63750430
NM_000249.3(MLH1):c.115T>C (p.Cys39Arg) rs587778890
NM_000249.3(MLH1):c.116+10_116+12delGAG rs1060504007
NM_000249.3(MLH1):c.116+1G>A rs267607709
NM_000249.3(MLH1):c.116+3A>G rs1553637475
NM_000249.3(MLH1):c.116+56C>G rs587778891
NM_000249.3(MLH1):c.116+5G>A rs267607710
NM_000249.3(MLH1):c.116+5G>C rs267607710
NM_000249.3(MLH1):c.116+63T>G rs587778892
NM_000249.3(MLH1):c.116+8G>A rs904872305
NM_000249.3(MLH1):c.1163_1164ins4
NM_000249.3(MLH1):c.1164C>T (p.Ser388=) rs1060504014
NM_000249.3(MLH1):c.1165C>T (p.Arg389Trp) rs61751644
NM_000249.3(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.3(MLH1):c.116G>A (p.Cys39Tyr) rs63751701
NM_000249.3(MLH1):c.116G>T (p.Cys39Phe) rs63751701
NM_000249.3(MLH1):c.117-11T>A rs267607711
NM_000249.3(MLH1):c.117-1G>T
NM_000249.3(MLH1):c.117-2A>G rs267607712
NM_000249.3(MLH1):c.117-39G>A rs1057517605
NM_000249.3(MLH1):c.117-43_117-39del rs587778895
NM_000249.3(MLH1):c.117-48A>G rs377111182
NM_000249.3(MLH1):c.117-691_306+1011del
NM_000249.3(MLH1):c.117-707_545+1338delinsTCCCGGGTTCAAGCGATTCT
NM_000249.3(MLH1):c.117-9A>G rs1060504004
NM_000249.3(MLH1):c.117-?_207+?del
NM_000249.3(MLH1):c.117-?_306+?dup
NM_000249.3(MLH1):c.117-?_380+?del
NM_000249.3(MLH1):c.117-?_545+?del
NM_000249.3(MLH1):c.1171C>T (p.Gln391Ter) rs587778894
NM_000249.3(MLH1):c.1175A>G (p.Lys392Arg) rs587780678
NM_000249.3(MLH1):c.1178T>C (p.Leu393Pro) rs786203413
NM_000249.3(MLH1):c.1185A>G (p.Ala395=) rs878853774
NM_000249.3(MLH1):c.1190del (p.Leu397fs) rs63750749
NM_000249.3(MLH1):c.1192C>T (p.Gln398Ter) rs63750483
NM_000249.3(MLH1):c.1198C>G (p.Leu400Val) rs63751485
NM_000249.3(MLH1):c.119del (p.Cys39_Leu40insTer) rs587778896
NM_000249.3(MLH1):c.1202G>A (p.Ser401Asn) rs587779951
NM_000249.3(MLH1):c.1207C>T (p.Pro403Ser) rs587778897
NM_000249.3(MLH1):c.1210C>T (p.Leu404=) rs1057517538
NM_000249.3(MLH1):c.1210_1211del (p.Leu404fs) rs63751015
NM_000249.3(MLH1):c.1210dup (p.Leu404fs) rs587778898
NM_000249.3(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.3(MLH1):c.1217_1223dup (p.Gln409fs) rs587778899
NM_000249.3(MLH1):c.1218del (p.Gln407fs) rs587778900
NM_000249.3(MLH1):c.1219C>T (p.Gln407Ter) rs1057517541
NM_000249.3(MLH1):c.121G>C (p.Asp41His) rs267607713
NM_000249.3(MLH1):c.1225C>T (p.Gln409Ter) rs63751153
NM_000249.3(MLH1):c.122A>G (p.Asp41Gly) rs63751094
NM_000249.3(MLH1):c.1232T>G (p.Ile411Ser) rs786201951
NM_000249.3(MLH1):c.1236_1237CA[1] (p.Thr413fs) rs1553651073
NM_000249.3(MLH1):c.1243G>A (p.Asp415Asn) rs373767220
NM_000249.3(MLH1):c.1246A>G (p.Lys416Glu) rs267607823
NM_000249.3(MLH1):c.1246A>T (p.Lys416Ter) rs267607823
NM_000249.3(MLH1):c.1252_1253del (p.Asp418fs) rs63751118
NM_000249.3(MLH1):c.1259C>G (p.Ser420Cys) rs63751179
NM_000249.3(MLH1):c.125C>T (p.Ala42Val) rs587778901
NM_000249.3(MLH1):c.1261A>G (p.Ser421Gly) rs755898663
NM_000249.3(MLH1):c.1261del (p.Ser421fs) rs63750293
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1267A>G (p.Arg423Gly) rs1392665848
NM_000249.3(MLH1):c.1268G>A (p.Arg423Lys) rs370687064
NM_000249.3(MLH1):c.1269G>A (p.Arg423=) rs373076967
NM_000249.3(MLH1):c.1270G>A (p.Ala424Thr) rs377433038
NM_000249.3(MLH1):c.1276C>T (p.Gln426Ter) rs63750316
NM_000249.3(MLH1):c.1278_1279insTG (p.Gln427fs) rs1559553492
NM_000249.3(MLH1):c.1284T>C (p.Asp428=) rs772555970
NM_000249.3(MLH1):c.128_131dup (p.Thr45fs) rs63751431
NM_000249.3(MLH1):c.1297G>C (p.Glu433Gln) rs63750443
NM_000249.3(MLH1):c.1297G>T (p.Glu433Ter) rs63750443
NM_000249.3(MLH1):c.129dup (p.Ser44fs) rs63750867
NM_000249.3(MLH1):c.12G>A (p.Val4=) rs864622700
NM_000249.3(MLH1):c.1304C>T (p.Pro435Leu) rs63751414
NM_000249.3(MLH1):c.1310del (p.Pro437fs) rs63750748
NM_000249.3(MLH1):c.1318G>A (p.Val440Met) rs864622250
NM_000249.3(MLH1):c.131C>A (p.Ser44Tyr) rs63751109
NM_000249.3(MLH1):c.131C>T (p.Ser44Phe) rs63751109
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1325_1346del22ins5
NM_000249.3(MLH1):c.1325_1346delinsATTTT (p.Ala442fs) rs587778903
NM_000249.3(MLH1):c.1327A>C (p.Lys443Gln) rs34213726
NM_000249.3(MLH1):c.1334del (p.Gln445fs) rs63749845
NM_000249.3(MLH1):c.133A>G (p.Thr45Ala) rs876658416
NM_000249.3(MLH1):c.133_139delinsTGTT (p.Thr45_Ile47delinsCysPhe) rs587778904
NM_000249.3(MLH1):c.1343del (p.Glu448fs) rs63749981
NM_000249.3(MLH1):c.1344G>T (p.Glu448Asp) rs587779952
NM_000249.3(MLH1):c.1344_1349del (p.Glu448_Gly449del) rs1060500705
NM_000249.3(MLH1):c.1347_1367delinsTAAA (p.Asp450fs) rs587778905
NM_000249.3(MLH1):c.1348dup (p.Asp450fs) rs587778906
NM_000249.3(MLH1):c.1351A>G (p.Thr451Ala) rs864622145
NM_000249.3(MLH1):c.1354del (p.Thr452fs) rs63750071
NM_000249.3(MLH1):c.1358dup (p.Thr455fs) rs1553651429
NM_000249.3(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.3(MLH1):c.1362del (p.Thr455fs) rs267607821
NM_000249.3(MLH1):c.1362dup (p.Thr455fs) rs267607821
NM_000249.3(MLH1):c.1377del (p.Glu460fs) rs587778908
NM_000249.3(MLH1):c.1377dup (p.Glu460fs) rs63750020
NM_000249.3(MLH1):c.1378G>T (p.Glu460Ter) rs756843954
NM_000249.3(MLH1):c.1378_1379GA[1] (p.Lys461fs) rs587778909
NM_000249.3(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.3(MLH1):c.137G>T (p.Ser46Ile) rs63749833
NM_000249.3(MLH1):c.1381A>T (p.Lys461Ter) rs63750540
NM_000249.3(MLH1):c.1387G>T (p.Gly463Ter) rs1559554339
NM_000249.3(MLH1):c.1392T>C (p.Pro464=) rs63750201
NM_000249.3(MLH1):c.1398del (p.Ser467fs) rs63750713
NM_000249.3(MLH1):c.139A>G (p.Ile47Val) rs1559505924
NM_000249.3(MLH1):c.1401C>T (p.Ser467=) rs587778910
NM_000249.3(MLH1):c.1402A>G (p.Asn468Asp) rs267607820
NM_000249.3(MLH1):c.1407C>G (p.Pro469=) rs1060504002
NM_000249.3(MLH1):c.1407C>T (p.Pro469=) rs1060504002
NM_000249.3(MLH1):c.1409+1127_1558+4255del
NM_000249.3(MLH1):c.1409+1156_1558+1385del
NM_000249.3(MLH1):c.1409+1G>A rs267607825
NM_000249.3(MLH1):c.1409+1G>C rs267607825
NM_000249.3(MLH1):c.1409+1G>T rs267607825
NM_000249.3(MLH1):c.1409+1_1409+6del6 rs1057517617
NM_000249.3(MLH1):c.1409+2T>G rs587778911
NM_000249.3(MLH1):c.1410-23G>T rs267607827
NM_000249.3(MLH1):c.1410-2_1410-1delinsCC rs1559558071
NM_000249.3(MLH1):c.1410-54C>T rs7633154
NM_000249.3(MLH1):c.1410-55G>T rs267607826
NM_000249.3(MLH1):c.1410-8C>T rs1057521668
NM_000249.3(MLH1):c.1410-?_(*193_?)del
NM_000249.3(MLH1):c.1410-?_1558+?del
NM_000249.3(MLH1):c.1410-?_1731+?del
NM_000249.3(MLH1):c.1411_1414delAAGA rs63751592
NM_000249.3(MLH1):c.1412dup (p.Arg472fs) rs63751677
NM_000249.3(MLH1):c.1413G>A (p.Lys471=) rs63750616
NM_000249.3(MLH1):c.1413_1414GA[1] (p.Arg472fs) rs281864936
NM_000249.3(MLH1):c.1413_1416del (p.Lys471fs) rs281864936
NM_000249.3(MLH1):c.1414dup (p.Arg472fs) rs63751468
NM_000249.3(MLH1):c.1415G>T (p.Arg472Ile) rs63750498
NM_000249.3(MLH1):c.1415_1427del (p.Arg472fs) rs587778912
NM_000249.3(MLH1):c.1420C>G (p.Arg474Gly) rs147939838
NM_000249.3(MLH1):c.1420C>T (p.Arg474Trp) rs147939838
NM_000249.3(MLH1):c.1420del (p.Arg474fs) rs63750482
NM_000249.3(MLH1):c.1421G>A (p.Arg474Gln) rs63751083
NM_000249.3(MLH1):c.142C>T (p.Gln48Ter) rs587778913
NM_000249.3(MLH1):c.143A>C (p.Gln48Pro) rs587778914
NM_000249.3(MLH1):c.1441del (p.Met481fs) rs878853777
NM_000249.3(MLH1):c.1449del (p.Asp484fs) rs587778915
NM_000249.3(MLH1):c.144A>C (p.Gln48His) rs147342421
NM_000249.3(MLH1):c.144A>G (p.Gln48=) rs147342421
NM_000249.3(MLH1):c.1450G>T (p.Asp484Tyr) rs730881741
NM_000249.3(MLH1):c.1452T>C (p.Asp484=) rs587778916
NM_000249.3(MLH1):c.1453G>C (p.Asp485His) rs63750314
NM_000249.3(MLH1):c.1453G>T (p.Asp485Tyr)
NM_000249.3(MLH1):c.1455T>A (p.Asp485Glu) rs63750956
NM_000249.3(MLH1):c.1459C>T (p.Arg487Ter) rs63749795
NM_000249.3(MLH1):c.1460G>A (p.Arg487Gln) rs587778917
NM_000249.3(MLH1):c.1460G>T (p.Arg487Leu) rs587778917
NM_000249.3(MLH1):c.1462A>T (p.Lys488Ter) rs587778918
NM_000249.3(MLH1):c.1463del (p.Lys488fs) rs63749876
NM_000249.3(MLH1):c.1464_1468del (p.Lys488fs) rs587778919
NM_000249.3(MLH1):c.146T>A (p.Val49Glu) rs63750098
NM_000249.3(MLH1):c.1470G>C (p.Met490Ile) rs1060500708
NM_000249.3(MLH1):c.1474G>A (p.Ala492Thr) rs63751145
NM_000249.3(MLH1):c.1487C>G (p.Pro496Arg) rs63750226
NM_000249.3(MLH1):c.1487C>T (p.Pro496Leu) rs63750226
NM_000249.3(MLH1):c.1489del (p.Arg497fs) rs63750855
NM_000249.3(MLH1):c.1489dup (p.Arg497fs) rs63750855
NM_000249.3(MLH1):c.1491del (p.Arg498fs) rs63751435
NM_000249.3(MLH1):c.1500_1502del (p.Ile501del) rs587778920
NM_000249.3(MLH1):c.1502T>G (p.Ile501Ser) rs587780679
NM_000249.3(MLH1):c.150dup (p.Val51fs) rs63749956
NM_000249.3(MLH1):c.1514G>A (p.Ser505Asn) rs771044689
NM_000249.3(MLH1):c.1517T>C (p.Val506Ala) rs63749909
NM_000249.3(MLH1):c.1520del (p.Val506_Leu507insTer) rs63749916
NM_000249.3(MLH1):c.1520dup (p.Leu507fs) rs63749916
NM_000249.3(MLH1):c.1521G>C (p.Leu507Phe) rs863224633
NM_000249.3(MLH1):c.1524T>G (p.Ser508Arg) rs886058383
NM_000249.3(MLH1):c.1525C>T (p.Leu509Phe) rs267607829
NM_000249.3(MLH1):c.1528C>T (p.Gln510Ter) rs63749923
NM_000249.3(MLH1):c.1534G>T (p.Glu512Ter) rs63751472
NM_000249.3(MLH1):c.153dup (p.Lys52Ter) rs587778922
NM_000249.3(MLH1):c.1542dup (p.Glu515Ter) rs63750317
NM_000249.3(MLH1):c.1549G>T (p.Gly517Ter) rs63751705
NM_000249.3(MLH1):c.1552_1553insT (p.His518fs) rs587778924
NM_000249.3(MLH1):c.1552del (p.His518fs) rs587778925
NM_000249.3(MLH1):c.1554T>C (p.His518=) rs1060504010
NM_000249.3(MLH1):c.1554dup (p.Glu519Ter) rs63751689
NM_000249.3(MLH1):c.1557_1558insT (p.Val520fs) rs587778926
NM_000249.3(MLH1):c.1558+11G>A rs267607833
NM_000249.3(MLH1):c.1558+13T>A rs267607834
NM_000249.3(MLH1):c.1558+14G>A rs41562513
NM_000249.3(MLH1):c.1558+1G>A rs267607832
NM_000249.3(MLH1):c.1558+1G>T rs267607832
NM_000249.3(MLH1):c.1558+1dup rs1553653237
NM_000249.3(MLH1):c.1558+2204A>C rs3774335
NM_000249.3(MLH1):c.1558+2T>G rs267607831
NM_000249.3(MLH1):c.1558+3232_1558+3692delins2
NM_000249.3(MLH1):c.1558+4245A>G rs3774332
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1558+58G>A rs267607838
NM_000249.3(MLH1):c.1558+5G>A rs199935667
NM_000249.3(MLH1):c.1559-11T>C rs730881750
NM_000249.3(MLH1):c.1559-1322_1668-391del
NM_000249.3(MLH1):c.1559-1G>A rs267607837
NM_000249.3(MLH1):c.1559-1G>C rs267607837
NM_000249.3(MLH1):c.1559-1G>T rs267607837
NM_000249.3(MLH1):c.1559-2A>C rs267607836
NM_000249.3(MLH1):c.1559-2A>G rs267607836
NM_000249.3(MLH1):c.1559-2A>T rs267607836
NM_000249.3(MLH1):c.1559-3171A>G rs4678925
NM_000249.3(MLH1):c.1559-3C>G rs267607830
NM_000249.3(MLH1):c.1559-8T>C rs753196249
NM_000249.3(MLH1):c.1559-?_(*193_?)del
NM_000249.3(MLH1):c.1559-?_1667+?del
NM_000249.3(MLH1):c.1559-?_1731+?del
NM_000249.3(MLH1):c.155_158del (p.Lys52fs) rs587778923
NM_000249.3(MLH1):c.1564C>T (p.Arg522Trp) rs63751703
NM_000249.3(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.156del (p.Glu53fs) rs63750028
NM_000249.3(MLH1):c.156dup (p.Glu53fs) rs63750028
NM_000249.3(MLH1):c.1572G>T (p.Met524Ile) rs587779953
NM_000249.3(MLH1):c.1572_1573del (p.Met524fs) rs587778928
NM_000249.3(MLH1):c.1573_1574del (p.Leu525fs) rs63751613
NM_000249.3(MLH1):c.1574T>A (p.Leu525Ter) rs587778929
NM_000249.3(MLH1):c.157_160GAGG[1] (p.Gly54fs) rs587778932
NM_000249.3(MLH1):c.1588_1590del (p.Phe530del) rs587778930
NM_000249.3(MLH1):c.1591G>A (p.Val531Met) rs764663152
NM_000249.3(MLH1):c.1592_1593del (p.Val531fs) rs587778931
NM_000249.3(MLH1):c.1597del (p.Cys533fs) rs1559575107
NM_000249.3(MLH1):c.159G>A (p.Glu53=) rs1060504012
NM_000249.3(MLH1):c.15_28del (p.Gly6fs) rs63751891
NM_000249.3(MLH1):c.1609C>T (p.Gln537Ter) rs63751277
NM_000249.3(MLH1):c.1612T>G (p.Trp538Gly) rs1559575214
NM_000249.3(MLH1):c.1613G>A (p.Trp538Ter) rs587778933
NM_000249.3(MLH1):c.1614G>A (p.Trp538Ter) rs267607842
NM_000249.3(MLH1):c.1615G>T (p.Ala539Ser) rs1559575256
NM_000249.3(MLH1):c.1616C>A (p.Ala539Asp) rs267607843
NM_000249.3(MLH1):c.161del (p.Gly54fs) rs63751266
NM_000249.3(MLH1):c.1620_1621del (p.Leu540fs) rs63750036
NM_000249.3(MLH1):c.1622del (p.Ala541fs) rs63750824
NM_000249.3(MLH1):c.1624C>T (p.Gln542Ter) rs63750192
NM_000249.3(MLH1):c.1625A>C (p.Gln542Pro) rs63750511
NM_000249.3(MLH1):c.1625A>T (p.Gln542Leu) rs63750511
NM_000249.3(MLH1):c.1628A>G (p.His543Arg) rs730881742
NM_000249.3(MLH1):c.1633A>G (p.Thr545Ala) rs267607840
NM_000249.3(MLH1):c.1633dup (p.Thr545fs) rs1553658104
NM_000249.3(MLH1):c.1636A>G (p.Lys546Glu) rs1046979393
NM_000249.3(MLH1):c.1637A>G (p.Lys546Arg) rs587779954
NM_000249.3(MLH1):c.1639_1643dup (p.Leu549fs) rs587778934
NM_000249.3(MLH1):c.1640T>A (p.Leu547Ter) rs63750300
NM_000249.3(MLH1):c.1644C>G (p.Tyr548Ter) rs63751087
NM_000249.3(MLH1):c.1646T>C (p.Leu549Pro) rs63750289
NM_000249.3(MLH1):c.1647_1649dup (p.Leu550dup) rs587778935
NM_000249.3(MLH1):c.1649T>C (p.Leu550Pro) rs63750193
NM_000249.3(MLH1):c.1652A>C (p.Asn551Thr) rs63750271
NM_000249.3(MLH1):c.1652A>G (p.Asn551Ser) rs63750271
NM_000249.3(MLH1):c.1653C>T (p.Asn551=) rs587778936
NM_000249.3(MLH1):c.1655_1657CCA[1] (p.Thr553del) rs63751641
NM_000249.3(MLH1):c.1664T>C (p.Leu555Pro) rs587778937
NM_000249.3(MLH1):c.1664T>G (p.Leu555Arg) rs587778937
NM_000249.3(MLH1):c.1664_1665insAAGT (p.Ser556_Glu557insTer) rs267607699
NM_000249.3(MLH1):c.1667+1_1667+8delinsATTT rs863223312
NM_000249.3(MLH1):c.1667+2T>C rs878853780
NM_000249.3(MLH1):c.1667+2_1667+8delinsATTT rs587778938
NM_000249.3(MLH1):c.1667G>T (p.Ser556Ile) rs63751596
NM_000249.3(MLH1):c.1668-19A>G rs9876116
NM_000249.3(MLH1):c.1668-1G>A rs267607845
NM_000249.3(MLH1):c.1668-1G>T rs267607845
NM_000249.3(MLH1):c.1668-254C>T rs41552415
NM_000249.3(MLH1):c.1668-3C>A rs267607844
NM_000249.3(MLH1):c.1668-5T>G rs1559578408
NM_000249.3(MLH1):c.1668-885T>C rs748766
NM_000249.3(MLH1):c.1668-?_1731+?del
NM_000249.3(MLH1):c.1668-?_1896+?del
NM_000249.3(MLH1):c.1668-?_2103+?dup
NM_000249.3(MLH1):c.1668del (p.Ser556fs) rs587778939
NM_000249.3(MLH1):c.1669G>T (p.Glu557Ter) rs63751244
NM_000249.3(MLH1):c.1672G>T (p.Glu558Ter) rs63751081
NM_000249.3(MLH1):c.1676T>C (p.Leu559Pro) rs63750059
NM_000249.3(MLH1):c.1676T>G (p.Leu559Arg) rs63750059
NM_000249.3(MLH1):c.1681T>C (p.Tyr561His) rs267607847
NM_000249.3(MLH1):c.1682A>G (p.Tyr561Cys) rs1289807424
NM_000249.3(MLH1):c.1683C>G (p.Tyr561Ter) rs63751393
NM_000249.3(MLH1):c.1684C>T (p.Gln562Ter) rs63751460
NM_000249.3(MLH1):c.1685A>C (p.Gln562Pro) rs1553659377
NM_000249.3(MLH1):c.1689dup (p.Leu564fs) rs63750464
NM_000249.3(MLH1):c.1690C>T (p.Leu564Phe) rs786202693
NM_000249.3(MLH1):c.1690_1693del (p.Leu564fs) rs267607849
NM_000249.3(MLH1):c.1693A>T (p.Ile565Phe) rs63750062
NM_000249.3(MLH1):c.1698T>C (p.Tyr566=) rs876658915
NM_000249.3(MLH1):c.1702T>A (p.Phe568Ile) rs267607848
NM_000249.3(MLH1):c.1709A>G (p.Asn570Ser) rs375853155
NM_000249.3(MLH1):c.1711T>C (p.Phe571Leu) rs267607846
NM_000249.3(MLH1):c.1715_1716GT[1] (p.Val573fs) rs63751709
NM_000249.3(MLH1):c.1721T>C (p.Leu574Pro) rs63751608
NM_000249.3(MLH1):c.1725del (p.Arg575fs) rs63751685
NM_000249.3(MLH1):c.1730C>T (p.Ser577Leu) rs56185292
NM_000249.3(MLH1):c.1731+11A>T rs886058384
NM_000249.3(MLH1):c.1731+14C>G rs745643356
NM_000249.3(MLH1):c.1731+1G>A rs267607853
NM_000249.3(MLH1):c.1731+1G>C rs267607853
NM_000249.3(MLH1):c.1731+1G>T rs267607853
NM_000249.3(MLH1):c.1731+270_1896+73del
NM_000249.3(MLH1):c.1731+2T>C rs267607856
NM_000249.3(MLH1):c.1731+2T>G rs267607856
NM_000249.3(MLH1):c.1731+3A>T rs267607851
NM_000249.3(MLH1):c.1731+5G>A rs267607850
NM_000249.3(MLH1):c.1731+6T>G rs587778940
NM_000249.3(MLH1):c.1731+768_1897-222del
NM_000249.3(MLH1):c.1731+8T>C rs370108219
NM_000249.3(MLH1):c.1731G>A (p.Ser577=) rs63751657
NM_000249.3(MLH1):c.1731G>C (p.Ser577=) rs63751657
NM_000249.3(MLH1):c.1732-19T>A rs77120160
NM_000249.3(MLH1):c.1732-1G>A rs267607854
NM_000249.3(MLH1):c.1732-2243_1896+404del
NM_000249.3(MLH1):c.1732-2A>G rs267607852
NM_000249.3(MLH1):c.1732-2A>T rs267607852
NM_000249.3(MLH1):c.1732-5C>T rs587778941
NM_000249.3(MLH1):c.1732-6T>C rs878853782
NM_000249.3(MLH1):c.1732-9T>C rs267607857
NM_000249.3(MLH1):c.1732-?_(*193_?)del
NM_000249.3(MLH1):c.1732-?_*193dup733
NM_000249.3(MLH1):c.1732-?_1896+?del
NM_000249.3(MLH1):c.1732-?_2103+?del
NM_000249.3(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.3(MLH1):c.1738G>C (p.Ala580Pro) rs864622530
NM_000249.3(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.3(MLH1):c.1743G>A (p.Pro581=) rs567838745
NM_000249.3(MLH1):c.1743G>C (p.Pro581=) rs567838745
NM_000249.3(MLH1):c.1744C>G (p.Leu582Val) rs63751713
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.1745T>C (p.Leu582Pro) rs63751616
NM_000249.3(MLH1):c.1745del (p.Leu582fs) rs587778942
NM_000249.3(MLH1):c.1748_1749del (p.Leu582_Phe583insTer) rs63750309
NM_000249.3(MLH1):c.1749del (p.Phe583fs) rs63750309
NM_000249.3(MLH1):c.174_175delinsT (p.Leu58fs) rs876660860
NM_000249.3(MLH1):c.1754T>G (p.Leu585Arg) rs267607865
NM_000249.3(MLH1):c.1756G>C (p.Ala586Pro) rs63751176
NM_000249.3(MLH1):c.1757C>A (p.Ala586Asp) rs63750587
NM_000249.3(MLH1):c.1758del (p.Met587fs) rs63749863
NM_000249.3(MLH1):c.1758dup (p.Met587fs) rs63749863
NM_000249.3(MLH1):c.175dup (p.Ile59fs) rs587778944
NM_000249.3(MLH1):c.1760T>C (p.Met587Thr) rs587778945
NM_000249.3(MLH1):c.1763T>C (p.Leu588Pro) rs63750575
NM_000249.3(MLH1):c.1764del (p.Ala589fs) rs63751486
NM_000249.3(MLH1):c.1766C>A (p.Ala589Asp) rs63750016
NM_000249.3(MLH1):c.1769T>G (p.Leu590Ter) rs1553662753
NM_000249.3(MLH1):c.1769del (p.Ala589_Leu590insTer) rs63749979
NM_000249.3(MLH1):c.176T>A (p.Ile59Asn) rs1559506199
NM_000249.3(MLH1):c.1772_1775del (p.Asp591fs) rs63749868
NM_000249.3(MLH1):c.1775G>A (p.Ser592Asn) rs587782621
NM_000249.3(MLH1):c.1775G>C (p.Ser592Thr) rs587782621
NM_000249.3(MLH1):c.1778_1779del (p.Pro593fs) rs63750375
NM_000249.3(MLH1):c.1779_1780AG[2] (p.Ser595fs) rs63750035
NM_000249.3(MLH1):c.1790G>A (p.Trp597Ter) rs63750604
NM_000249.3(MLH1):c.1790_1791delinsATCTGGACC (p.Trp597fs) rs863225378
NM_000249.3(MLH1):c.1791G>T (p.Trp597Cys) rs1416171624
NM_000249.3(MLH1):c.1799A>G (p.Glu600Gly) rs267607861
NM_000249.3(MLH1):c.1800_1818del (p.Glu600fs) rs587778946
NM_000249.3(MLH1):c.1802A>G (p.Asp601Gly) rs63750718
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1810A>T (p.Lys604Ter) rs63750386
NM_000249.3(MLH1):c.1812dup (p.Glu605fs) rs63751240
NM_000249.3(MLH1):c.1818A>G (p.Gly606=) rs1057522427
NM_000249.3(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.3(MLH1):c.1821dup (p.Ala608fs) rs587778947
NM_000249.3(MLH1):c.1823C>A (p.Ala608Asp) rs267607864
NM_000249.3(MLH1):c.1824T>A (p.Ala608=) rs876659019
NM_000249.3(MLH1):c.1829_1832dup (p.Val612fs) rs587778948
NM_000249.3(MLH1):c.1831_1832del (p.Ile611fs) rs63750150
NM_000249.3(MLH1):c.1832_1834TTG[1] (p.Val612del) rs63750486
NM_000249.3(MLH1):c.1846_1848AAG[2] (p.Lys618del) rs63751247
NM_000249.3(MLH1):c.184C>A (p.Gln62Lys) rs63751428
NM_000249.3(MLH1):c.184C>T (p.Gln62Ter) rs63751428
NM_000249.3(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.3(MLH1):c.1852A>T (p.Lys618Ter) rs35001569
NM_000249.3(MLH1):c.1852_1853delinsGC (p.Lys618Ala) rs35502531
NM_000249.3(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.3(MLH1):c.1853A>G (p.Lys618Arg) rs63750449
NM_000249.3(MLH1):c.1853A>T (p.Lys618Met) rs63750449
NM_000249.3(MLH1):c.1853delinsTTCTT (p.Lys618fs) rs587778949
NM_000249.3(MLH1):c.1853dup (p.Ala619fs) rs1060500687
NM_000249.3(MLH1):c.1855G>C (p.Ala619Pro) rs267607866
NM_000249.3(MLH1):c.1855del (p.Ala619fs) rs63749986
NM_000249.3(MLH1):c.1864del (p.Ala623fs) rs1559588540
NM_000249.3(MLH1):c.1865T>A (p.Leu622His) rs63750693
NM_000249.3(MLH1):c.1865T>C (p.Leu622Pro) rs63750693
NM_000249.3(MLH1):c.1866del (p.Ala623fs) rs587778950
NM_000249.3(MLH1):c.1867G>T (p.Ala623Ser) rs587778951
NM_000249.3(MLH1):c.186A>G (p.Gln62=) rs1559506261
NM_000249.3(MLH1):c.1872C>T (p.Asp624=) rs145535636
NM_000249.3(MLH1):c.1875T>G (p.Tyr625Ter) rs63751415
NM_000249.3(MLH1):c.1876T>C (p.Phe626Leu) rs377241633
NM_000249.3(MLH1):c.1877T>C (p.Phe626Ser) rs587778952
NM_000249.3(MLH1):c.1877_1883del (p.Phe626fs) rs63751594
NM_000249.3(MLH1):c.1877del (p.Phe626fs) rs63750152
NM_000249.3(MLH1):c.1878C>T (p.Phe626=) rs63751214
NM_000249.3(MLH1):c.1879T>A (p.Ser627Thr) rs63750846
NM_000249.3(MLH1):c.187G>A (p.Asp63Asn) rs63750850
NM_000249.3(MLH1):c.1880_1883del (p.Ser627fs) rs587778953
NM_000249.3(MLH1):c.1884_1888del (p.Leu628fs) rs63751639
NM_000249.3(MLH1):c.1889T>A (p.Ile630Asn) rs1559588836
NM_000249.3(MLH1):c.1892A>C (p.Asp631Ala) rs63750240
NM_000249.3(MLH1):c.1893del (p.Asp631fs) rs587778954
NM_000249.3(MLH1):c.1896+17T>C rs193922368
NM_000249.3(MLH1):c.1896+1G>A rs267607867
NM_000249.3(MLH1):c.1896+1G>T rs267607867
NM_000249.3(MLH1):c.1896+2T>C rs267607869
NM_000249.3(MLH1):c.1896+36T>C rs267607870
NM_000249.3(MLH1):c.1896+5G>A rs759870594
NM_000249.3(MLH1):c.1896+7C>T rs863224339
NM_000249.3(MLH1):c.1896G>A (p.Glu632=) rs63751632
NM_000249.3(MLH1):c.1897-17C>G rs2308316
NM_000249.3(MLH1):c.1897-2A>G rs267607871
NM_000249.3(MLH1):c.1897-7C>T rs373078652
NM_000249.3(MLH1):c.1897-?_1989+?del
NM_000249.3(MLH1):c.189C>A (p.Asp63Glu) rs587778955
NM_000249.3(MLH1):c.18G>A (p.Gly6=) rs786202312
NM_000249.3(MLH1):c.18_34del (p.Val7fs) rs63751892
NM_000249.3(MLH1):c.1902del (p.Asn635fs) rs587778956
NM_000249.3(MLH1):c.1904A>G (p.Asn635Ser) rs63751270
NM_000249.3(MLH1):c.1904dup (p.Asn635fs) rs587778957
NM_000249.3(MLH1):c.1905C>G (p.Asn635Lys) rs63751047
NM_000249.3(MLH1):c.1906C>G (p.Leu636Val) rs864622673
NM_000249.3(MLH1):c.1907T>C (p.Leu636Pro) rs63750825
NM_000249.3(MLH1):c.190_191del (p.Asn64fs) rs63750469
NM_000249.3(MLH1):c.1912G>T (p.Gly638Ter) rs63750549
NM_000249.3(MLH1):c.1913_1926dup (p.Ile643delinsAspTyrProPheTer) rs587778958
NM_000249.3(MLH1):c.1914_1942dup (p.Pro648delinsHisTyrProPheTer) rs587778959
NM_000249.3(MLH1):c.1916dup (p.Leu639fs) rs587778960
NM_000249.3(MLH1):c.1918C>T (p.Pro640Ser) rs63749792
NM_000249.3(MLH1):c.1919C>T (p.Pro640Leu) rs267607875
NM_000249.3(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.3(MLH1):c.191dup (p.Asn64fs) rs63751255
NM_000249.3(MLH1):c.1920_1921insT (p.Leu641fs) rs587778961
NM_000249.3(MLH1):c.1925T>A (p.Leu642Gln) rs1559590916
NM_000249.3(MLH1):c.1930del (p.Asp644fs) rs587778962
NM_000249.3(MLH1):c.1934A>G (p.Asn645Ser) rs587778963
NM_000249.3(MLH1):c.1937A>C (p.Tyr646Ser) rs35045067
NM_000249.3(MLH1):c.1937A>G (p.Tyr646Cys) rs35045067
NM_000249.3(MLH1):c.1939G>A (p.Val647Met) rs63750109
NM_000249.3(MLH1):c.1942C>T (p.Pro648Ser) rs63750899
NM_000249.3(MLH1):c.1943C>T (p.Pro648Leu) rs63750610
NM_000249.3(MLH1):c.1946del (p.Pro649fs) rs281864938
NM_000249.3(MLH1):c.194G>A (p.Gly65Asp) rs63751465
NM_000249.3(MLH1):c.194G>T (p.Gly65Val) rs63751465
NM_000249.3(MLH1):c.1953_1956del (p.Glu651fs) rs63751301
NM_000249.3(MLH1):c.1958T>G (p.Leu653Arg) rs63751202
NM_000249.3(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.3(MLH1):c.195del (p.Thr66fs) rs267607715
NM_000249.3(MLH1):c.1960C>T (p.Pro654Ser) rs1559591314
NM_000249.3(MLH1):c.1961C>T (p.Pro654Leu) rs63750726
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1967T>C (p.Phe656Ser) rs267607876
NM_000249.3(MLH1):c.1971del (p.Leu658fs) rs63750115
NM_000249.3(MLH1):c.1975C>T (p.Arg659Ter) rs63751310
NM_000249.3(MLH1):c.1975_1976del (p.Arg659fs) rs63750131
NM_000249.3(MLH1):c.1976G>A (p.Arg659Gln) rs63749900
NM_000249.3(MLH1):c.1976G>C (p.Arg659Pro) rs63749900
NM_000249.3(MLH1):c.1976G>T (p.Arg659Leu) rs63749900
NM_000249.3(MLH1):c.1976_1977del (p.Arg659fs) rs63751200
NM_000249.3(MLH1):c.1979T>C (p.Leu660Pro) rs1559591546
NM_000249.3(MLH1):c.1983C>T (p.Ala661=) rs1060504001
NM_000249.3(MLH1):c.1984A>C (p.Thr662Pro) rs587778964
NM_000249.3(MLH1):c.1986_1989+1delinsC rs267607873
NM_000249.3(MLH1):c.1988A>C (p.Glu663Ala) rs63751682
NM_000249.3(MLH1):c.1988A>G (p.Glu663Gly) rs63751682
NM_000249.3(MLH1):c.1988del (p.Glu663fs) rs267607877
NM_000249.3(MLH1):c.1989+1G>A rs267607879
NM_000249.3(MLH1):c.1989+1G>C rs267607879
NM_000249.3(MLH1):c.1989+1G>T rs267607879
NM_000249.3(MLH1):c.1989+4A>G rs587778965
NM_000249.3(MLH1):c.1989+5G>C rs267607878
NM_000249.3(MLH1):c.1989G>A (p.Glu663=) rs63751662
NM_000249.3(MLH1):c.1989G>T (p.Glu663Asp) rs63751662
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.198dup (p.Gly67fs) rs587778966
NM_000249.3(MLH1):c.1990-121C>T rs2241031
NM_000249.3(MLH1):c.1990-16_1990-2del rs267607881
NM_000249.3(MLH1):c.1990-1G>A rs267607884
NM_000249.3(MLH1):c.1990-1G>T rs267607884
NM_000249.3(MLH1):c.1990-2A>G rs267607883
NM_000249.3(MLH1):c.1990-3C>G rs267607882
NM_000249.3(MLH1):c.1990-6G>A rs117221851
NM_000249.3(MLH1):c.1990-9T>C rs756846181
NM_000249.3(MLH1):c.1990-?_(*193_?)del
NM_000249.3(MLH1):c.1995T>C (p.Asn665=) rs1060504011
NM_000249.3(MLH1):c.1996T>C (p.Trp666Arg) rs267607887
NM_000249.3(MLH1):c.1997G>C (p.Trp666Ser) rs886039424
NM_000249.3(MLH1):c.1998G>A (p.Trp666Ter) rs63750639
NM_000249.3(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.3(MLH1):c.199G>C (p.Gly67Arg) rs63750206
NM_000249.3(MLH1):c.199G>T (p.Gly67Trp) rs63750206
NM_000249.3(MLH1):c.19_35del (p.Val7fs) rs267607702
NM_000249.3(MLH1):c.1A>G (p.Met1Val) rs587778967
NM_000249.3(MLH1):c.2000dup (p.Asp667fs) rs63750282
NM_000249.3(MLH1):c.2001C>T (p.Asp667=) rs63750014
NM_000249.3(MLH1):c.2006_2010del (p.Glu669fs) rs63750061
NM_000249.3(MLH1):c.2009_2013del (p.Lys670fs) rs1553664353
NM_000249.3(MLH1):c.2009del (p.Lys670fs) rs63750740
NM_000249.3(MLH1):c.200G>A (p.Gly67Glu) rs63749939
NM_000249.3(MLH1):c.2010G>A (p.Lys670=) rs1060504013
NM_000249.3(MLH1):c.2011G>T (p.Glu671Ter) rs63750663
NM_000249.3(MLH1):c.201del (p.Ile68fs) rs587778968
NM_000249.3(MLH1):c.2024G>T (p.Ser675Ile) rs781637991
NM_000249.3(MLH1):c.2027T>C (p.Leu676Pro) rs63750242
NM_000249.3(MLH1):c.2027T>G (p.Leu676Arg) rs63750242
NM_000249.3(MLH1):c.2028C>T (p.Leu676=) rs587778969
NM_000249.3(MLH1):c.2030G>A (p.Ser677Asn) rs587778970
NM_000249.3(MLH1):c.2035G>T (p.Glu679Ter) rs587778971
NM_000249.3(MLH1):c.2038T>C (p.Cys680Arg) rs63750809
NM_000249.3(MLH1):c.2038T>G (p.Cys680Gly) rs63750809
NM_000249.3(MLH1):c.203T>A (p.Ile68Asn) rs63750281
NM_000249.3(MLH1):c.2040C>A (p.Cys680Ter) rs63749867
NM_000249.3(MLH1):c.2040C>T (p.Cys680=) rs63749867
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.2042C>T (p.Ala681Val) rs63750864
NM_000249.3(MLH1):c.2045T>C (p.Met682Thr) rs1060500693
NM_000249.3(MLH1):c.2048T>C (p.Phe683Ser) rs587778972
NM_000249.3(MLH1):c.2048_2050del (p.Phe683del) rs1553664506
NM_000249.3(MLH1):c.204C>G (p.Ile68Met) rs780141938
NM_000249.3(MLH1):c.2051A>G (p.Tyr684Cys) rs267607886
NM_000249.3(MLH1):c.2054C>A (p.Ser685Tyr) rs1064796101
NM_000249.3(MLH1):c.2059C>T (p.Arg687Trp) rs63751275
NM_000249.3(MLH1):c.205del (p.Arg69fs) rs63751704
NM_000249.3(MLH1):c.2065C>A (p.Gln689Lys) rs41542214
NM_000249.3(MLH1):c.2065C>T (p.Gln689Ter) rs41542214
NM_000249.3(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.3(MLH1):c.2067_2073del (p.Gln689fs) rs63750420
NM_000249.3(MLH1):c.207+1245_884+523dup
NM_000249.3(MLH1):c.207+1560_546-871del
NM_000249.3(MLH1):c.207+1G>A rs267607718
NM_000249.3(MLH1):c.207+1G>T rs267607718
NM_000249.3(MLH1):c.207+1_207+2del rs267607719
NM_000249.3(MLH1):c.207+26delA rs1057517621
NM_000249.3(MLH1):c.207+2T>C rs267607722
NM_000249.3(MLH1):c.207+571C>T rs9852378
NM_000249.3(MLH1):c.207+5G>C rs587781518
NM_000249.3(MLH1):c.2070C>T (p.Tyr690=) rs550890395
NM_000249.3(MLH1):c.2070_2071insTT (p.Ile691fs) rs876659681
NM_000249.3(MLH1):c.2074T>C (p.Ser692Pro) rs587779957
NM_000249.3(MLH1):c.2076_2077del (p.Glu693fs) rs63750769
NM_000249.3(MLH1):c.2078_2172del (p.Glu693Alafs*8)
NM_000249.3(MLH1):c.208-15T>C rs587778974
NM_000249.3(MLH1):c.208-1714_306+641delinsACATAGTA
NM_000249.3(MLH1):c.208-1G>A rs267607717
NM_000249.3(MLH1):c.208-1_208del rs587778973
NM_000249.3(MLH1):c.208-2A>G rs267607716
NM_000249.3(MLH1):c.208-3C>G rs267607720
NM_000249.3(MLH1):c.208-3C>T rs267607720
NM_000249.3(MLH1):c.208-9A>G rs1057523558
NM_000249.3(MLH1):c.208-?_306+?del
NM_000249.3(MLH1):c.208-?_306+?dup rs1559511769
NM_000249.3(MLH1):c.208-?_453+?del
NM_000249.3(MLH1):c.208-?_545+?del
NM_000249.3(MLH1):c.208-?_790+?del
NM_000249.3(MLH1):c.2082G>A (p.Glu694=) rs1057521441
NM_000249.3(MLH1):c.2084C>A (p.Ser695Ter) rs63749995
NM_000249.3(MLH1):c.2088C>G (p.Thr696=) rs1060504015
NM_000249.3(MLH1):c.2090_2091TC[1] (p.Ser698fs) rs63750859
NM_000249.3(MLH1):c.2093C>G (p.Ser698Ter) rs587778975
NM_000249.3(MLH1):c.2099_2102del (p.Gln700fs) rs63751652
NM_000249.3(MLH1):c.209_221delAAGAAGATCTGGA (p.Lys70Ilefs) rs1057517543
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2101C>T (p.Gln701Ter) rs63750114
NM_000249.3(MLH1):c.2103+10_2103+14delTGATG rs864622755
NM_000249.3(MLH1):c.2103+1G>A rs267607888
NM_000249.3(MLH1):c.2103+1G>C rs267607888
NM_000249.3(MLH1):c.2103+1G>T rs267607888
NM_000249.3(MLH1):c.2103+3A>G rs587778976
NM_000249.3(MLH1):c.2103G>A (p.Gln701=) rs63750603
NM_000249.3(MLH1):c.2103G>C (p.Gln701His) rs63750603
NM_000249.3(MLH1):c.2104-11G>A rs147984696
NM_000249.3(MLH1):c.2104-11_2104-10delinsA rs587778977
NM_000249.3(MLH1):c.2104-1G>A rs587778978
NM_000249.3(MLH1):c.2104-1G>T rs587778978
NM_000249.3(MLH1):c.2104-22T>C rs267607890
NM_000249.3(MLH1):c.2104-22T>G rs267607890
NM_000249.3(MLH1):c.2104-2A>G rs267607889
NM_000249.3(MLH1):c.2104-2A>T rs267607889
NM_000249.3(MLH1):c.2104-7T>G rs267607891
NM_000249.3(MLH1):c.2104-?_*(193_?)del
NM_000249.3(MLH1):c.2104-?_*(193_?)dup
NM_000249.3(MLH1):c.2104_2105delAG (p.Ser702Terfs) rs63751651
NM_000249.3(MLH1):c.2105_2114del (p.Ser702fs) rs587778979
NM_000249.3(MLH1):c.2107G>A (p.Glu703Lys) rs747727493
NM_000249.3(MLH1):c.210_212AGA[1] (p.Glu71del) rs63751642
NM_000249.3(MLH1):c.210_213delAGAA rs267607723
NM_000249.3(MLH1):c.2111T>G (p.Val704Gly) rs587780682
NM_000249.3(MLH1):c.2111_2117del (p.Val704fs) rs587778980
NM_000249.3(MLH1):c.211G>T (p.Glu71Ter) rs63749829
NM_000249.3(MLH1):c.2134T>A (p.Trp712Arg) rs267607909
NM_000249.3(MLH1):c.2135G>A (p.Trp712Ter) rs63750561
NM_000249.3(MLH1):c.2135G>T (p.Trp712Leu) rs63750561
NM_000249.3(MLH1):c.2136G>A (p.Trp712Ter) rs63750499
NM_000249.3(MLH1):c.2136del (p.Ser711_Trp712insTer) rs1060500706
NM_000249.3(MLH1):c.2138A>C (p.Lys713Thr) rs878853786
NM_000249.3(MLH1):c.2141G>A (p.Trp714Ter) rs63751022
NM_000249.3(MLH1):c.2142G>A (p.Trp714Ter) rs63750978
NM_000249.3(MLH1):c.2145_2146TG[1] (p.Val716fs) rs587778981
NM_000249.3(MLH1):c.2146G>A (p.Val716Met) rs35831931
NM_000249.3(MLH1):c.2149_2195dup (p.His733fs) rs587778982
NM_000249.3(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.3(MLH1):c.2152_2153CA[1] (p.Ile719fs) rs63750971
NM_000249.3(MLH1):c.2152_2153CA[3] (p.Ile719fs) rs63750971
NM_000249.3(MLH1):c.2153A>C (p.His718Pro) rs587778983
NM_000249.3(MLH1):c.2155_2156insATGTGTTCCACA (p.Ile719_Val720insAsnValPheHis) rs281864940
NM_000249.3(MLH1):c.2157dup (p.Val720fs) rs587778984
NM_000249.3(MLH1):c.2159T>G (p.Val720Gly) rs587778985
NM_000249.3(MLH1):c.2161_2166dup (p.Tyr721_Lys722dup) rs63751075
NM_000249.3(MLH1):c.2162A>G (p.Tyr721Cys) rs587778986
NM_000249.3(MLH1):c.2163T>A (p.Tyr721Ter) rs63750484
NM_000249.3(MLH1):c.2170T>A (p.Leu724Met) rs63749875
NM_000249.3(MLH1):c.2172G>A (p.Leu724=) rs780045031
NM_000249.3(MLH1):c.2173C>G (p.Arg725Gly) rs138584384
NM_000249.3(MLH1):c.2173C>T (p.Arg725Cys) rs138584384
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2177C>G (p.Ser726Ter) rs864622457
NM_000249.3(MLH1):c.2177_2178CA[1] (p.His727fs) rs267607898
NM_000249.3(MLH1):c.2177_2178CA[2] (p.Ile728fs) rs267607898
NM_000249.3(MLH1):c.2185C>G (p.Leu729Val) rs1800149
NM_000249.3(MLH1):c.218T>C (p.Leu73Pro) rs397514684
NM_000249.3(MLH1):c.218T>G (p.Leu73Arg) rs397514684
NM_000249.3(MLH1):c.2194A>T (p.Lys732Ter) rs267607906
NM_000249.3(MLH1):c.2195_2198dup (p.His733fs) rs267607903
NM_000249.3(MLH1):c.2197C>T (p.His733Tyr) rs1553665846
NM_000249.3(MLH1):c.219G>A (p.Leu73=) rs587778988
NM_000249.3(MLH1):c.2210A>T (p.Asp737Val) rs267607885
NM_000249.3(MLH1):c.2213G>A (p.Gly738Glu) rs148317871
NM_000249.3(MLH1):c.2218dup (p.Ile740fs) rs587778989
NM_000249.3(MLH1):c.2221_2224delCTGCins30 (p.?)
NM_000249.3(MLH1):c.2223_2233del (p.Gln742fs) rs267607897
NM_000249.3(MLH1):c.2224C>T (p.Gln742Ter) rs587778992
NM_000249.3(MLH1):c.2224_2232del (p.Gln742_Ala744del) rs587778991
NM_000249.3(MLH1):c.2224del (p.Gln742fs) rs267607896
NM_000249.3(MLH1):c.2236_2247del (p.Leu746_Leu749del)
NM_000249.3(MLH1):c.223A>T (p.Ile75Phe) rs1060500701
NM_000249.3(MLH1):c.2246T>C (p.Leu749Pro) rs267607894
NM_000249.3(MLH1):c.2250C>A (p.Tyr750Ter) rs267607893
NM_000249.3(MLH1):c.2250C>G (p.Tyr750Ter) rs267607893
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.2252_2253del (p.Lys751fs) rs267607901
NM_000249.3(MLH1):c.2252_2253dup (p.Val752fs) rs267607901
NM_000249.3(MLH1):c.2258T>C (p.Phe753Ser) rs587778993
NM_000249.3(MLH1):c.2260G>A (p.Glu754Lys) rs864622445
NM_000249.3(MLH1):c.2262del (p.Arg755fs) rs267607904
NM_000249.3(MLH1):c.2263A>G (p.Arg755Gly) rs267607900
NM_000249.3(MLH1):c.2263A>T (p.Arg755Trp) rs267607900
NM_000249.3(MLH1):c.2265G>C (p.Arg755Ser) rs267607895
NM_000249.3(MLH1):c.2266_2269dup (p.Ter757LeuextTer?) rs267607892
NM_000249.3(MLH1):c.2269T>A (p.Ter757Lys) rs587778995
NM_000249.3(MLH1):c.2269dup (p.Ter757LeuextTer?) rs1553666143
NM_000249.3(MLH1):c.226G>A (p.Val76Ile) rs878853788
NM_000249.3(MLH1):c.229T>C (p.Cys77Arg) rs63749859
NM_000249.3(MLH1):c.229_230TG[1] (p.Cys77_Glu78delinsTer) rs63750052
NM_000249.3(MLH1):c.22dup (p.Ile8fs) rs587778996
NM_000249.3(MLH1):c.230G>A (p.Cys77Tyr) rs63750437
NM_000249.3(MLH1):c.232del (p.Glu78fs) rs587778997
NM_000249.3(MLH1):c.238T>G (p.Phe80Val) rs63749990
NM_000249.3(MLH1):c.244A>G (p.Thr82Ala) rs587778998
NM_000249.3(MLH1):c.244dup (p.Thr82fs) rs267607729
NM_000249.3(MLH1):c.245C>T (p.Thr82Ile) rs63750005
NM_000249.3(MLH1):c.248G>T (p.Ser83Ile) rs587778999
NM_000249.3(MLH1):c.250A>G (p.Lys84Glu) rs63750641
NM_000249.3(MLH1):c.256C>T (p.Gln86Ter) rs63751421
NM_000249.3(MLH1):c.25C>T (p.Arg9Trp) rs587779000
NM_000249.3(MLH1):c.25_26delinsTA (p.Arg9Ter) rs869312767
NM_000249.3(MLH1):c.261C>T (p.Ser87=) rs63750923
NM_000249.3(MLH1):c.261del (p.Phe88fs) rs267607728
NM_000249.3(MLH1):c.265G>T (p.Glu89Ter) rs11541859
NM_000249.3(MLH1):c.268del (p.Asp90fs) rs1060500688
NM_000249.3(MLH1):c.274G>C (p.Ala92Pro) rs63750133
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.283T>G (p.Ser95Ala) rs63751070
NM_000249.3(MLH1):c.283del (p.Ser95fs) rs1064795441
NM_000249.3(MLH1):c.290A>G (p.Tyr97Cys) rs773647920
NM_000249.3(MLH1):c.292G>A (p.Gly98Ser) rs267607725
NM_000249.3(MLH1):c.292G>C (p.Gly98Arg) rs267607725
NM_000249.3(MLH1):c.293_304del (p.Gly98_Gly101del) rs63751691
NM_000249.3(MLH1):c.297T>A (p.Phe99Leu) rs267607730
NM_000249.3(MLH1):c.298C>T (p.Arg100Ter) rs63751221
NM_000249.3(MLH1):c.299G>A (p.Arg100Gln) rs63750266
NM_000249.3(MLH1):c.299G>C (p.Arg100Pro) rs63750266
NM_000249.3(MLH1):c.2T>A (p.Met1Lys) rs111052004
NM_000249.3(MLH1):c.2T>C (p.Met1Thr) rs111052004
NM_000249.3(MLH1):c.2T>G (p.Met1Arg) rs111052004
NM_000249.3(MLH1):c.301G>A (p.Gly101Ser) rs267607726
NM_000249.3(MLH1):c.302G>A (p.Gly101Asp) rs267607727
NM_000249.3(MLH1):c.302G>T (p.Gly101Val) rs267607727
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.304G>A (p.Glu102Lys) rs63750453
NM_000249.3(MLH1):c.306+1G>A rs267607734
NM_000249.3(MLH1):c.306+2T>G rs1553640340
NM_000249.3(MLH1):c.306+2dupT rs267607738
NM_000249.3(MLH1):c.306+3A>C rs267607731
NM_000249.3(MLH1):c.306+40G>A rs267607737
NM_000249.3(MLH1):c.306+416A>C rs4647222
NM_000249.3(MLH1):c.306+4A>G rs267607733
NM_000249.3(MLH1):c.306+5G>A rs267607735
NM_000249.3(MLH1):c.306+6C>T rs746641892
NM_000249.3(MLH1):c.306+8A>G rs587779002
NM_000249.3(MLH1):c.306G>A (p.Glu102=) rs63751665
NM_000249.3(MLH1):c.306G>C (p.Glu102Asp) rs63751665
NM_000249.3(MLH1):c.306G>T (p.Glu102Asp) rs63751665
NM_000249.3(MLH1):c.307-10T>C rs572853043
NM_000249.3(MLH1):c.307-1403A>T rs1540354
NM_000249.3(MLH1):c.307-1420_380+624del
NM_000249.3(MLH1):c.307-19A>G rs121909451
NM_000249.3(MLH1):c.307-1G>C rs267607736
NM_000249.3(MLH1):c.307-245_454-365del
NM_000249.3(MLH1):c.307-29C>A rs139620056
NM_000249.3(MLH1):c.307-2A>C rs267607732
NM_000249.3(MLH1):c.307-797_677+1061del
NM_000249.3(MLH1):c.307-820_380+896del
NM_000249.3(MLH1):c.307-?_(*193_?)del
NM_000249.3(MLH1):c.307-?_1667+?dup
NM_000249.3(MLH1):c.307-?_380+?del
NM_000249.3(MLH1):c.307-?_380+?dup rs1559516997
NM_000249.3(MLH1):c.307-?_545+?del
NM_000249.3(MLH1):c.307G>C (p.Ala103Pro) rs587779003
NM_000249.3(MLH1):c.318C>A (p.Ser106Arg) rs63750297
NM_000249.3(MLH1):c.318C>G (p.Ser106Arg) rs63750297
NM_000249.3(MLH1):c.31del (p.Leu11fs) rs63749816
NM_000249.3(MLH1):c.320T>G (p.Ile107Arg) rs63750507
NM_000249.3(MLH1):c.322_335del (p.Ser108fs) rs1553641269
NM_000249.3(MLH1):c.325del (p.His109fs) rs1553641273
NM_000249.3(MLH1):c.326A>C (p.His109Pro) rs587779004
NM_000249.3(MLH1):c.327T>G (p.His109Gln) rs63749803
NM_000249.3(MLH1):c.330G>A (p.Val110=) rs863224340
NM_000249.3(MLH1):c.331G>C (p.Ala111Pro) rs587779005
NM_000249.3(MLH1):c.332C>T (p.Ala111Val) rs63750539
NM_000249.3(MLH1):c.338T>A (p.Val113Asp) rs63750559
NM_000249.3(MLH1):c.341del (p.Thr114fs) rs63750645
NM_000249.3(MLH1):c.346del (p.Thr116fs) rs63750906
NM_000249.3(MLH1):c.346dup (p.Thr116fs) rs267607739
NM_000249.3(MLH1):c.347C>A (p.Thr116Lys) rs63750465
NM_000249.3(MLH1):c.347C>G (p.Thr116Arg) rs63750465
NM_000249.3(MLH1):c.347del (p.Thr116fs) rs876661159
NM_000249.3(MLH1):c.350C>G (p.Thr117Arg) rs63750781
NM_000249.3(MLH1):c.350C>T (p.Thr117Met) rs63750781
NM_000249.3(MLH1):c.354_355dup (p.Thr119fs) rs63750658
NM_000249.3(MLH1):c.359C>T (p.Ala120Val) rs267607740
NM_000249.3(MLH1):c.367A>T (p.Lys123Ter) rs63750542
NM_000249.3(MLH1):c.370_371TG[1] (p.Ala125fs) rs587779006
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.376T>A (p.Tyr126Asn) rs200076893
NM_000249.3(MLH1):c.377A>G (p.Tyr126Cys) rs267607741
NM_000249.3(MLH1):c.378C>G (p.Tyr126Ter) rs63751606
NM_000249.3(MLH1):c.378del (p.Ala125_Tyr126insTer) rs63751607
NM_000249.3(MLH1):c.379A>C (p.Arg127=) rs587779007
NM_000249.3(MLH1):c.37G>A (p.Glu13Lys) rs587779008
NM_000249.3(MLH1):c.37G>T (p.Glu13Ter) rs587779008
NM_000249.3(MLH1):c.37_38GA[3] (p.Thr14fs) rs587779013
NM_000249.3(MLH1):c.37del (p.Glu13fs) rs63750081
NM_000249.3(MLH1):c.380+1G>A rs267607745
NM_000249.3(MLH1):c.380+1G>T rs267607745
NM_000249.3(MLH1):c.380+2T>A rs267607742
NM_000249.3(MLH1):c.380+2T>C rs267607742
NM_000249.3(MLH1):c.380G>A (p.Arg127Lys) rs63751595
NM_000249.3(MLH1):c.381-2A>G rs267607743
NM_000249.3(MLH1):c.381-415_453+733del
NM_000249.3(MLH1):c.381-41A>G rs4647245
NM_000249.3(MLH1):c.381-43C>G rs368847278
NM_000249.3(MLH1):c.381-5A>C rs1060504016
NM_000249.3(MLH1):c.381-?_545+?del
NM_000249.3(MLH1):c.381-?_677+?del
NM_000249.3(MLH1):c.382G>C (p.Ala128Pro) rs63750866
NM_000249.3(MLH1):c.382_402delinsT (p.Ala128fs) rs267607746
NM_000249.3(MLH1):c.382del (p.Ala128fs) rs63750865
NM_000249.3(MLH1):c.385_386delinsGTT (p.Ser129fs) rs63751710
NM_000249.3(MLH1):c.388T>C (p.Tyr130His) rs587779010
NM_000249.3(MLH1):c.388del (p.Tyr130fs) rs587779009
NM_000249.3(MLH1):c.389A>G (p.Tyr130Cys) rs587779011
NM_000249.3(MLH1):c.389del (p.Tyr130fs) rs587779012
NM_000249.3(MLH1):c.38_39insCCCA (p.Glu13fs) rs63750057
NM_000249.3(MLH1):c.38dup (p.Thr14fs) rs63750057
NM_000249.3(MLH1):c.392C>A (p.Ser131Ter) rs63749818
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.397G>T (p.Gly133Ter) rs63751124
NM_000249.3(MLH1):c.3G>A (p.Met1Ile) rs72481822
NM_000249.3(MLH1):c.3G>T (p.Met1Ile) rs72481822
NM_000249.3(MLH1):c.403C>G (p.Leu135Val) rs63751052
NM_000249.3(MLH1):c.404_407del (p.Leu135fs) rs587779014
NM_000249.3(MLH1):c.415C>G (p.Pro139Ala) rs779562531
NM_000249.3(MLH1):c.420del (p.Lys140fs) rs587779015
NM_000249.3(MLH1):c.421C>G (p.Pro141Ala) rs63750977
NM_000249.3(MLH1):c.428dup (p.Gly144fs) rs63751045
NM_000249.3(MLH1):c.42A>G (p.Thr14=) rs369737664
NM_000249.3(MLH1):c.436C>T (p.Gln146Ter) rs63749820
NM_000249.3(MLH1):c.438A>G (p.Gln146=) rs377279035
NM_000249.3(MLH1):c.439G>C (p.Gly147Arg) rs267607747
NM_000249.3(MLH1):c.440G>A (p.Gly147Glu)
NM_000249.3(MLH1):c.440G>C (p.Gly147Ala) rs1060500702
NM_000249.3(MLH1):c.445C>T (p.Gln149Ter) rs63751302
NM_000249.3(MLH1):c.447G>C (p.Gln149His) rs63750638
NM_000249.3(MLH1):c.44dup (p.Val16fs) rs63751131
NM_000249.3(MLH1):c.451_453del (p.Thr151del) rs587779016
NM_000249.3(MLH1):c.453+1G>T rs267607750
NM_000249.3(MLH1):c.453+25A>G rs4647246
NM_000249.3(MLH1):c.453+2T>C rs267607751
NM_000249.3(MLH1):c.453+2T>G rs267607751
NM_000249.3(MLH1):c.453+4A>G rs587779017
NM_000249.3(MLH1):c.453+554C>T rs267607748
NM_000249.3(MLH1):c.453+79A>G rs4234259
NM_000249.3(MLH1):c.453+9G>A rs267607752
NM_000249.3(MLH1):c.453G>A (p.Thr151=) rs369521379
NM_000249.3(MLH1):c.454-13A>G rs267607749
NM_000249.3(MLH1):c.454-1G>A rs193922370
NM_000249.3(MLH1):c.454-1G>C rs193922370
NM_000249.3(MLH1):c.454-1G>T rs193922370
NM_000249.3(MLH1):c.454-2A>G rs267607753
NM_000249.3(MLH1):c.454-432_546-1030del
NM_000249.3(MLH1):c.454-466_546-1062del
NM_000249.3(MLH1):c.454-505_546-1102del
NM_000249.3(MLH1):c.454-51T>C rs4647255
NM_000249.3(MLH1):c.454-665_545+49del rs1553642492
NM_000249.3(MLH1):c.454-?_1409+?dup
NM_000249.3(MLH1):c.454-?_545+?del
NM_000249.3(MLH1):c.454-?_677+?dup
NM_000249.3(MLH1):c.454_545del rs1553642657
NM_000249.3(MLH1):c.464T>G (p.Leu155Arg) rs63750891
NM_000249.3(MLH1):c.466T>C (p.Phe156Leu) rs1060500691
NM_000249.3(MLH1):c.468_469del (p.Phe156fs) rs63751101
NM_000249.3(MLH1):c.469dup (p.Tyr157fs) rs63751101
NM_000249.3(MLH1):c.474C>T (p.Asn158=) rs4647256
NM_000249.3(MLH1):c.479C>T (p.Ala160Val) rs63749924
NM_000249.3(MLH1):c.482C>T (p.Thr161Met) rs763992299
NM_000249.3(MLH1):c.488del (p.Arg163fs) rs267607754
NM_000249.3(MLH1):c.492del (p.Ala165fs) rs1553642698
NM_000249.3(MLH1):c.497T>A (p.Leu166Ter) rs267607755
NM_000249.3(MLH1):c.497del (p.Ala165_Leu166insTer) rs587779018
NM_000249.3(MLH1):c.498A>C (p.Leu166Phe) rs267607757
NM_000249.3(MLH1):c.502_503del (p.Asn168fs) rs63749959
NM_000249.3(MLH1):c.503dup (p.Asn168fs) rs63749959
NM_000249.3(MLH1):c.506C>T (p.Pro169Leu) rs63750834
NM_000249.3(MLH1):c.513del (p.Glu172fs) rs63749944
NM_000249.3(MLH1):c.514G>T (p.Glu172Ter) rs1559524405
NM_000249.3(MLH1):c.524_525insGA (p.Ile176fs) rs587779019
NM_000249.3(MLH1):c.52C>T (p.Arg18Cys) rs367654552
NM_000249.3(MLH1):c.52del (p.Arg18fs) rs63749804
NM_000249.3(MLH1):c.531_532delinsAT (p.Glu178Ter) rs63750903
NM_000249.3(MLH1):c.531_532delinsCT (p.Leu177_Glu178delinsPheTer) rs63750903
NM_000249.3(MLH1):c.539T>G (p.Val180Gly) rs63750102
NM_000249.3(MLH1):c.543C>G (p.Gly181=) rs1481129490
NM_000249.3(MLH1):c.543C>T (p.Gly181=) rs1481129490
NM_000249.3(MLH1):c.544A>G (p.Arg182Gly) rs63750211
NM_000249.3(MLH1):c.545+19G>T rs41285099
NM_000249.3(MLH1):c.545+1G>A rs267607765
NM_000249.3(MLH1):c.545+20A>T rs121909453
NM_000249.3(MLH1):c.545+3A>G rs267607760
NM_000249.3(MLH1):c.545+43C>G rs267607761
NM_000249.3(MLH1):c.545+72T>A rs267607763
NM_000249.3(MLH1):c.545+80T>A rs267607764
NM_000249.3(MLH1):c.545G>A (p.Arg182Lys) rs587779021
NM_000249.3(MLH1):c.545G>C (p.Arg182Thr) rs587779021
NM_000249.3(MLH1):c.546-18T>C rs1057517622
NM_000249.3(MLH1):c.546-1G>A rs587779022
NM_000249.3(MLH1):c.546-2A>C rs267607759
NM_000249.3(MLH1):c.546-2A>G rs267607759
NM_000249.3(MLH1):c.546-361_885-811del
NM_000249.3(MLH1):c.546-5delT rs1553643965
NM_000249.3(MLH1):c.546-9C>G rs878853789
NM_000249.3(MLH1):c.546-?_1409+?dup
NM_000249.3(MLH1):c.546-?_1731+?dup
NM_000249.3(MLH1):c.546-?_677+?del
NM_000249.3(MLH1):c.546-?_790+?del
NM_000249.3(MLH1):c.554T>G (p.Val185Gly) rs63750515
NM_000249.3(MLH1):c.557A>C (p.His186Pro) rs1060500712
NM_000249.3(MLH1):c.558C>T (p.His186=) rs63751050
NM_000249.3(MLH1):c.55A>T (p.Ile19Phe) rs63750648
NM_000249.3(MLH1):c.572G>T (p.Ser191Ile) rs267607766
NM_000249.3(MLH1):c.574_588+2del rs587779023
NM_000249.3(MLH1):c.577T>C (p.Ser193Pro) rs63751021
NM_000249.3(MLH1):c.578C>G (p.Ser193Ter) rs63751480
NM_000249.3(MLH1):c.579A>G (p.Ser193=) rs587781038
NM_000249.3(MLH1):c.586A>T (p.Lys196Ter) rs63750500
NM_000249.3(MLH1):c.588+11G>C rs4647258
NM_000249.3(MLH1):c.588+1G>T rs267607772
NM_000249.3(MLH1):c.588+2T>A rs587779024
NM_000249.3(MLH1):c.588+3_588+6del rs267607769
NM_000249.3(MLH1):c.588+49_588+50del rs587779025
NM_000249.3(MLH1):c.588+5G>A rs267607768
NM_000249.3(MLH1):c.588+5G>C rs267607768
NM_000249.3(MLH1):c.588+8C>A rs1060504005
NM_000249.3(MLH1):c.588del (p.Lys196fs) rs63751653
NM_000249.3(MLH1):c.589-10T>A rs267607770
NM_000249.3(MLH1):c.589-15C>T rs55658850
NM_000249.3(MLH1):c.589-1G>T rs587779027
NM_000249.3(MLH1):c.589-24T>C rs1057517607
NM_000249.3(MLH1):c.589-25G>A rs188146618
NM_000249.3(MLH1):c.589-2A>C rs267607767
NM_000249.3(MLH1):c.589-2A>G rs267607767
NM_000249.3(MLH1):c.589-6T>G rs781244266
NM_000249.3(MLH1):c.589-7T>C rs371767464
NM_000249.3(MLH1):c.589-7_589-4del rs587779028
NM_000249.3(MLH1):c.589-9G>A rs566497442
NM_000249.3(MLH1):c.589-9_589-6delGTTT rs587779026
NM_000249.3(MLH1):c.589C>T (p.Gln197Ter) rs1553644123
NM_000249.3(MLH1):c.593_594GA[2] (p.Glu199fs) rs63751637
NM_000249.3(MLH1):c.595G>C (p.Glu199Gln) rs63749887
NM_000249.3(MLH1):c.5C>A (p.Ser2Ter) rs587779029
NM_000249.3(MLH1):c.5C>T (p.Ser2Leu) rs587779029
NM_000249.3(MLH1):c.601G>C (p.Val201Leu) rs534184145
NM_000249.3(MLH1):c.604del (p.Ala202fs) rs1553644155
NM_000249.3(MLH1):c.61del (p.Ala21fs) rs63750581
NM_000249.3(MLH1):c.621A>G (p.Leu207=) rs770554901
NM_000249.3(MLH1):c.626A>G (p.Asn209Ser) rs150478207
NM_000249.3(MLH1):c.62C>A (p.Ala21Glu) rs63750706
NM_000249.3(MLH1):c.62C>T (p.Ala21Val) rs63750706
NM_000249.3(MLH1):c.632_633insT (p.Thr212fs) rs63750908
NM_000249.3(MLH1):c.636C>T (p.Thr212=) rs138735345
NM_000249.3(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.3(MLH1):c.637G>T (p.Val213Leu) rs2308317
NM_000249.3(MLH1):c.644A>G (p.Asn215Ser) rs267607775
NM_000249.3(MLH1):c.647T>G (p.Ile216Ser) rs267607776
NM_000249.3(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.3(MLH1):c.649del (p.Arg217fs) rs63750380
NM_000249.3(MLH1):c.652T>C (p.Ser218Pro) rs750650349
NM_000249.3(MLH1):c.655A>C (p.Ile219Leu) rs1799977
NM_000249.3(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.3(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.3(MLH1):c.665del (p.Asn222fs) rs63750385
NM_000249.3(MLH1):c.665dup (p.Asn222fs) rs63750385
NM_000249.3(MLH1):c.672del (p.Ser225fs) rs587779031
NM_000249.3(MLH1):c.673_676del (p.Ser225fs) rs267607774
NM_000249.3(MLH1):c.676C>T (p.Arg226Ter) rs63751615
NM_000249.3(MLH1):c.677+1G>A rs267607778
NM_000249.3(MLH1):c.677+1G>T rs267607778
NM_000249.3(MLH1):c.677+3A>C rs267607780
NM_000249.3(MLH1):c.677+3A>G rs267607780
NM_000249.3(MLH1):c.677+5G>A rs587779034
NM_000249.3(MLH1):c.677+7C>T rs556224377
NM_000249.3(MLH1):c.677G>A (p.Arg226Gln) rs63751711
NM_000249.3(MLH1):c.677G>T (p.Arg226Leu) rs63751711
NM_000249.3(MLH1):c.677_677+1delinsAT rs587779032
NM_000249.3(MLH1):c.677_677+1insT rs587779033
NM_000249.3(MLH1):c.678-1G>A rs267607784
NM_000249.3(MLH1):c.678-1G>C rs267607784
NM_000249.3(MLH1):c.678-1G>T rs267607784
NM_000249.3(MLH1):c.678-2A>G rs587779035
NM_000249.3(MLH1):c.678-3T>A rs267607785
NM_000249.3(MLH1):c.678-3_678-2del rs267607783
NM_000249.3(MLH1):c.678-4A>G rs766711342
NM_000249.3(MLH1):c.678-9_693del rs587779036
NM_000249.3(MLH1):c.678-?_1558+?del
NM_000249.3(MLH1):c.678-?_884+?del
NM_000249.3(MLH1):c.67G>A (p.Glu23Lys) rs63750823
NM_000249.3(MLH1):c.67G>T (p.Glu23Ter) rs63750823
NM_000249.3(MLH1):c.67del (p.Glu23fs) rs63750822
NM_000249.3(MLH1):c.682C>A (p.Leu228Met) rs751628735
NM_000249.3(MLH1):c.683dup (p.Ile229fs) rs63751659
NM_000249.3(MLH1):c.693del (p.Ile231fs) rs63750764
NM_000249.3(MLH1):c.699T>A (p.Cys233Ter) rs764085979
NM_000249.3(MLH1):c.69A>G (p.Glu23=) rs63750555
NM_000249.3(MLH1):c.69A>T (p.Glu23Asp) rs63750555
NM_000249.3(MLH1):c.701A>G (p.Glu234Gly) rs63750696
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.3(MLH1):c.705T>C (p.Asp235=) rs876658869
NM_000249.3(MLH1):c.706_725del (p.Lys236fs) rs863224480
NM_000249.3(MLH1):c.70del (p.Val24fs) rs63751396
NM_000249.3(MLH1):c.716C>T (p.Ala239Val) rs1559534371
NM_000249.3(MLH1):c.721A>G (p.Lys241Glu) rs587778447
NM_000249.3(MLH1):c.723_726AATG[1] (p.Asn243fs) rs267607787
NM_000249.3(MLH1):c.731G>A (p.Gly244Asp) rs63750303
NM_000249.3(MLH1):c.731G>T (p.Gly244Val) rs63750303
NM_000249.3(MLH1):c.731_734del (p.Gly244fs) rs587779037
NM_000249.3(MLH1):c.736A>T (p.Ile246Leu) rs750253749
NM_000249.3(MLH1):c.739T>C (p.Ser247Pro) rs63750948
NM_000249.3(MLH1):c.73A>T (p.Ile25Phe) rs63749838
NM_000249.3(MLH1):c.73del (p.Ile25fs) rs63749839
NM_000249.3(MLH1):c.745dup (p.Ala249fs) rs63750819
NM_000249.3(MLH1):c.74T>C (p.Ile25Thr) rs63750514
NM_000249.3(MLH1):c.753_755del (p.Tyr251_Ser252delinsTer) rs1553645256
NM_000249.3(MLH1):c.755C>A (p.Ser252Ter) rs63750198
NM_000249.3(MLH1):c.756A>C (p.Ser252=) rs864622458
NM_000249.3(MLH1):c.76C>T (p.Gln26Ter) rs63749827
NM_000249.3(MLH1):c.76del (p.Gln26fs) rs63749828
NM_000249.3(MLH1):c.776T>C (p.Leu259Ser) rs56250509
NM_000249.3(MLH1):c.778C>T (p.Leu260Phe) rs63750642
NM_000249.3(MLH1):c.779T>A (p.Leu260His) rs63751283
NM_000249.3(MLH1):c.779T>G (p.Leu260Arg) rs63751283
NM_000249.3(MLH1):c.780C>G (p.Leu260=) rs587779038
NM_000249.3(MLH1):c.782_784TCA[1] (p.Ile262del) rs587779039
NM_000249.3(MLH1):c.788A>C (p.Asn263Thr) rs104894997
NM_000249.3(MLH1):c.78del (p.Gln26fs) rs587779040
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.790+17dup rs757064565
NM_000249.3(MLH1):c.790+1G>A rs267607789
NM_000249.3(MLH1):c.790+1G>C rs267607789
NM_000249.3(MLH1):c.790+1delG rs267607798
NM_000249.3(MLH1):c.790+2T>A rs267607790
NM_000249.3(MLH1):c.790+2T>C rs267607790
NM_000249.3(MLH1):c.790+2dupT rs267607791
NM_000249.3(MLH1):c.790+3A>T rs267607792
NM_000249.3(MLH1):c.790+4A>G rs267607786
NM_000249.3(MLH1):c.790+4A>T rs267607786
NM_000249.3(MLH1):c.790+5G>A rs267607771
NM_000249.3(MLH1):c.790+5G>T rs267607771
NM_000249.3(MLH1):c.790+62G>A rs267607796
NM_000249.3(MLH1):c.790+955C>A rs1558528
NM_000249.3(MLH1):c.790C>T (p.His264Tyr) rs63751597
NM_000249.3(MLH1):c.791-1406C>T rs4647269
NM_000249.3(MLH1):c.791-14T>C rs751254837
NM_000249.3(MLH1):c.791-1G>A rs267607795
NM_000249.3(MLH1):c.791-1G>C rs267607795
NM_000249.3(MLH1):c.791-1G>T rs267607795
NM_000249.3(MLH1):c.791-2A>G rs267607794
NM_000249.3(MLH1):c.791-4_795del rs587779041
NM_000249.3(MLH1):c.791-5T>G rs267607788
NM_000249.3(MLH1):c.791-7T>A rs587779042
NM_000249.3(MLH1):c.791-?_1558+?del
NM_000249.3(MLH1):c.791-?_884+?del
NM_000249.3(MLH1):c.791A>G (p.His264Arg) rs63751664
NM_000249.3(MLH1):c.793C>A (p.Arg265Ser) rs63751194
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000249.3(MLH1):c.793_794delinsGT (p.Arg265Val) rs1559539068
NM_000249.3(MLH1):c.794G>A (p.Arg265His) rs63751448
NM_000249.3(MLH1):c.794G>C (p.Arg265Pro) rs63751448
NM_000249.3(MLH1):c.799_800delinsAG (p.Val267Arg) rs1085308058
NM_000249.3(MLH1):c.803A>G (p.Glu268Gly) rs63750650
NM_000249.3(MLH1):c.806C>G (p.Ser269Ter) rs63750691
NM_000249.3(MLH1):c.808A>G (p.Thr270Ala) rs371302926
NM_000249.3(MLH1):c.808_811del (p.Thr270fs) rs267607801
NM_000249.3(MLH1):c.80G>A (p.Arg27Gln) rs138705565
NM_000249.3(MLH1):c.80G>C (p.Arg27Pro) rs138705565
NM_000249.3(MLH1):c.811_815del (p.Ser271fs) rs587779043
NM_000249.3(MLH1):c.814T>G (p.Leu272Val) rs63751252
NM_000249.3(MLH1):c.81G>A (p.Arg27=) rs878853791
NM_000249.3(MLH1):c.821A>G (p.Lys274Arg) rs769958855
NM_000249.3(MLH1):c.821_824dup (p.Ile276fs) rs63751439
NM_000249.3(MLH1):c.826dup (p.Ile276fs) rs878853792
NM_000249.3(MLH1):c.827T>G (p.Ile276Arg) rs1253275403
NM_000249.3(MLH1):c.827_831del (p.Ile276fs) rs1553646669
NM_000249.3(MLH1):c.835G>C (p.Val279Leu) rs1559539382
NM_000249.3(MLH1):c.836T>G (p.Val279Gly) rs1553646683
NM_000249.3(MLH1):c.838T>G (p.Tyr280Asp) rs587779044
NM_000249.3(MLH1):c.83C>T (p.Pro28Leu) rs63750792
NM_000249.3(MLH1):c.840T>A (p.Tyr280Ter) rs63750938
NM_000249.3(MLH1):c.842C>T (p.Ala281Val) rs63749950
NM_000249.3(MLH1):c.844G>A (p.Ala282Thr) rs774689817
NM_000249.3(MLH1):c.845C>G (p.Ala282Gly) rs63750360
NM_000249.3(MLH1):c.84del (p.Ala29fs) rs587779045
NM_000249.3(MLH1):c.851T>A (p.Leu284Ter) rs63750889
NM_000249.3(MLH1):c.856A>C (p.Lys286Gln) rs63750395
NM_000249.3(MLH1):c.856_857insT (p.Lys286fs) rs63750212
NM_000249.3(MLH1):c.859_860del (p.Asn287fs) rs63750034
NM_000249.3(MLH1):c.85G>T (p.Ala29Ser) rs63750656
NM_000249.3(MLH1):c.860_861AC[3] (p.His289fs) rs587779047
NM_000249.3(MLH1):c.860_861AC[5] (p.Pro290fs) rs587779047
NM_000249.3(MLH1):c.860del (p.Asn287fs) rs63750034
NM_000249.3(MLH1):c.860dup (p.Asn287fs) rs63750034
NM_000249.3(MLH1):c.861C>T (p.Asn287=) rs63750421
NM_000249.3(MLH1):c.86C>G (p.Ala29Gly) rs63750216
NM_000249.3(MLH1):c.875T>C (p.Leu292Pro) rs63750517
NM_000249.3(MLH1):c.877T>G (p.Tyr293Asp) rs587779049
NM_000249.3(MLH1):c.882C>G (p.Leu294=) rs63751707
NM_000249.3(MLH1):c.882C>T (p.Leu294=) rs63751707
NM_000249.3(MLH1):c.883A>C (p.Ser295Arg) rs63751598
NM_000249.3(MLH1):c.883A>G (p.Ser295Gly) rs63751598
NM_000249.3(MLH1):c.884+10C>T rs864622424
NM_000249.3(MLH1):c.884+10delC rs878853793
NM_000249.3(MLH1):c.884+15A>G rs372817491
NM_000249.3(MLH1):c.884+16A>G rs377598055
NM_000249.3(MLH1):c.884+2T>C rs267607806
NM_000249.3(MLH1):c.884+39G>A rs370283452
NM_000249.3(MLH1):c.884+3A>G rs267607803
NM_000249.3(MLH1):c.884+4A>G rs267607777
NM_000249.3(MLH1):c.884G>A (p.Ser295Asn) rs63750144
NM_000249.3(MLH1):c.884G>C (p.Ser295Thr) rs63750144
NM_000249.3(MLH1):c.884_884+3del rs587779050
NM_000249.3(MLH1):c.885-1G>A rs1553647894
NM_000249.3(MLH1):c.885-206_997del rs1553647795
NM_000249.3(MLH1):c.885-21TC[2] rs267607804
NM_000249.3(MLH1):c.885-24T>A rs201594027
NM_000249.3(MLH1):c.885-2A>G rs267607805
NM_000249.3(MLH1):c.885-493_1039-372del
NM_000249.3(MLH1):c.885-594_1038+1123del
NM_000249.3(MLH1):c.885-5G>T rs267607802
NM_000249.3(MLH1):c.885-81G>C rs104894999
NM_000249.3(MLH1):c.885-8C>T rs762836160
NM_000249.3(MLH1):c.885-9_887dup rs1553647888
NM_000249.3(MLH1):c.885-?_(*193_?)del
NM_000249.3(MLH1):c.885-?_1038+?del
NM_000249.3(MLH1):c.885-?_1731+?del
NM_000249.3(MLH1):c.887T>C (p.Leu296Ser) rs63750547
NM_000249.3(MLH1):c.887T>G (p.Leu296Ter) rs63750547
NM_000249.3(MLH1):c.887dup (p.Leu296fs) rs63751620
NM_000249.3(MLH1):c.888del (p.Glu297fs) rs267607809
NM_000249.3(MLH1):c.889G>A (p.Glu297Lys) rs63750736
NM_000249.3(MLH1):c.889G>T (p.Glu297Ter) rs63750736
NM_000249.3(MLH1):c.898_908del (p.Pro300fs) rs1553647928
NM_000249.3(MLH1):c.901C>T (p.Gln301Ter) rs63750489
NM_000249.3(MLH1):c.901del (p.Gln301fs) rs587779052
NM_000249.3(MLH1):c.906T>C (p.Asn302=) rs1060504006
NM_000249.3(MLH1):c.906_907TG[1] (p.Val303fs) rs1553647947
NM_000249.3(MLH1):c.908T>A (p.Val303Glu) rs267607813
NM_000249.3(MLH1):c.90T>G (p.Asn30Lys) rs863224637
NM_000249.3(MLH1):c.911A>G (p.Asp304Gly) rs63750993
NM_000249.3(MLH1):c.911A>T (p.Asp304Val) rs63750993
NM_000249.3(MLH1):c.912_923del (p.Val305_His308del) rs1064792918
NM_000249.3(MLH1):c.914_937del (p.Val305_His312del) rs587779053
NM_000249.3(MLH1):c.918T>A (p.Asn306Lys) rs587779054
NM_000249.3(MLH1):c.91G>A (p.Ala31Thr) rs749671520
NM_000249.3(MLH1):c.91_92delinsTG (p.Ala31Cys) rs63749994
NM_000249.3(MLH1):c.920T>C (p.Val307Ala) rs863224638
NM_000249.3(MLH1):c.921_922dup (p.His308fs) rs63750962
NM_000249.3(MLH1):c.923A>C (p.His308Pro) rs1559543768
NM_000249.3(MLH1):c.925C>T (p.Pro309Ser) rs267607808
NM_000249.3(MLH1):c.927C>T (p.Pro309=) rs63749896
NM_000249.3(MLH1):c.927dup (p.Thr310fs) rs1553647995
NM_000249.3(MLH1):c.928del (p.Thr310fs) rs587779055
NM_000249.3(MLH1):c.92C>G (p.Ala31Gly) rs730882127
NM_000249.3(MLH1):c.930A>C (p.Thr310=) rs587779056
NM_000249.3(MLH1):c.931A>G (p.Lys311Glu) rs876658657
NM_000249.3(MLH1):c.935dup (p.His312fs) rs63750319
NM_000249.3(MLH1):c.939A>G (p.Glu313=) rs864622432
NM_000249.3(MLH1):c.939dup (p.Val314fs) rs63751259
NM_000249.3(MLH1):c.940G>T (p.Val314Phe) rs863224639
NM_000249.3(MLH1):c.945C>G (p.His315Gln) rs587779959
NM_000249.3(MLH1):c.949C>A (p.Leu317Met) rs267607814
NM_000249.3(MLH1):c.949del (p.Leu317fs) rs1553648029
NM_000249.3(MLH1):c.94A>G (p.Ile32Val) rs2020872
NM_000249.3(MLH1):c.954C>T (p.His318=) rs146777069
NM_000249.3(MLH1):c.954del (p.His318fs) rs63749926
NM_000249.3(MLH1):c.955G>A (p.Glu319Lys) rs63750796
NM_000249.3(MLH1):c.955G>T (p.Glu319Ter) rs63750796
NM_000249.3(MLH1):c.959_960AG[3] (p.Ser321fs) rs878853794
NM_000249.3(MLH1):c.960G>C (p.Glu320Asp) rs267607811
NM_000249.3(MLH1):c.960_964dup (p.Ile322fs) rs1553648047
NM_000249.3(MLH1):c.962G>T (p.Ser321Ile) rs63750286
NM_000249.3(MLH1):c.963_1014dup (p.Ser339fs) rs1553648058
NM_000249.3(MLH1):c.971dup (p.Arg325fs) rs587781554
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000249.3(MLH1):c.974_982del (p.Arg325_Gln327del) rs587779057
NM_000249.3(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000249.3(MLH1):c.979C>G (p.Gln327Glu) rs587782087
NM_000249.3(MLH1):c.97A>G (p.Lys33Glu) rs878853795
NM_000249.3(MLH1):c.980_983dup (p.His329fs) rs1559544297
NM_000249.3(MLH1):c.982C>T (p.Gln328Ter) rs587779058
NM_000249.3(MLH1):c.985C>A (p.His329Asn) rs267607810
NM_000249.3(MLH1):c.986A>C (p.His329Pro) rs63750710
NM_000249.3(MLH1):c.988_990del (p.Ile330del) rs63751197
NM_000249.3(MLH1):c.994del (p.Ser332fs) rs63750533
NM_000249.3(MLH1):c.9del (p.Phe3fs) rs63750745
NM_000249.3(MLH1):c.[-27C>A;85G>T]
NM_000249.3(MLH1):c.[453+625_545+921delinsTG;545+1271_677+737delinsCA]
NM_000249.3:c.512_513insAlu
NM_000251.1(MSH2):c.(?_-68)_(*272_?)del
NM_000251.1(MSH2):c.-11844_1077-6021delins155
NM_000251.1(MSH2):c.-1753_645+922del
NM_000251.1(MSH2):c.-35298_1276+5697del
NM_000251.1(MSH2):c.-47156_1277-4980del
NM_000251.1(MSH2):c.-4729_367-353del
NM_000251.1(MSH2):c.-75398_1759+1708del
NM_000251.1(MSH2):c.-823_1076+5984del
NM_000251.1(MSH2):c.-956_1077-5607del
NM_000251.1(MSH2):c.1276+232_1386+3798del
NM_000251.1(MSH2):c.1387-3976_1662-364del
NM_000251.1(MSH2):c.1662-374_2458+467del
NM_000251.1(MSH2):c.1759+305_2006-34del
NM_000251.1(MSH2):c.1760-361_2634+838del
NM_000251.1(MSH2):c.211+1566_1277-3954del
NM_000251.1(MSH2):c.2210+116_2562del
NM_000251.1(MSH2):c.645+539_1077-3451del
NM_000251.1(MSH2):c.645+791_1076+4894del
NM_000251.1(MSH2):c.645+967_1076+5075del
NM_000251.1(MSH2):c.943-926_1077-1449del
NM_000251.1(MSH2):c.972_973insNM_002133.2:c.737-1292_737-1109
NM_000251.2(MSH2):c.(?_-1)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?del
NM_000251.2(MSH2):c.(?_-68)_1076+?dup
NM_000251.2(MSH2):c.(?_-68)_1276+?del
NM_000251.2(MSH2):c.(?_-68)_1386+?del
NM_000251.2(MSH2):c.(?_-68)_1661+?del
NM_000251.2(MSH2):c.(?_-68)_1759+?del
NM_000251.2(MSH2):c.(?_-68)_211+?del
NM_000251.2(MSH2):c.(?_-68)_2634+?del
NM_000251.2(MSH2):c.(?_-68)_366+?del
NM_000251.2(MSH2):c.(?_-68)_645+?del
NM_000251.2(MSH2):c.(?_-68)_645+?dup
NM_000251.2(MSH2):c.(?_-68)_792+?del
NM_000251.2(MSH2):c.(?_-68)_942+?del
NM_000251.2(MSH2):c.*129T>C rs587779059
NM_000251.2(MSH2):c.*141T>G rs17225053
NM_000251.2(MSH2):c.*221G>T rs587779060
NM_000251.2(MSH2):c.*226A>G rs17225060
NM_000251.2(MSH2):c.*251+2441A>C rs6544991
NM_000251.2(MSH2):c.*272+4059G>A rs6720549
NM_000251.2(MSH2):c.*52A>T rs886056138
NM_000251.2(MSH2):c.*7C>G rs886056137
NM_000251.2(MSH2):c.*95C>T rs587779062
NM_000251.2(MSH2):c.-118T>C rs2303425
NM_000251.2(MSH2):c.-125_1076+?del
NM_000251.2(MSH2):c.-125_1076+?dup1201
NM_000251.2(MSH2):c.-125_645+?del
NM_000251.2(MSH2):c.-12G>A rs1558450937
NM_000251.2(MSH2):c.-179C>T rs17224094
NM_000251.2(MSH2):c.-181G>A rs786201698
NM_000251.2(MSH2):c.-182C>T rs876658327
NM_000251.2(MSH2):c.-225G>C rs138068023
NM_000251.2(MSH2):c.-29C>T rs199841800
NM_000251.2(MSH2):c.-3G>C rs587779960
NM_000251.2(MSH2):c.-43G>C rs781492698
NM_000251.2(MSH2):c.-68-122C>T rs587779115
NM_000251.2(MSH2):c.-68-365T>G rs1863332
NM_000251.2(MSH2):c.-78_-77del rs587779182
NM_000251.2(MSH2):c.-81dupA rs587779187
NM_000251.2(MSH2):c.-94C>G rs786202841
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1000A>T (p.Lys334Ter) rs587779063
NM_000251.2(MSH2):c.1004C>T (p.Thr335Ile) rs63750602
NM_000251.2(MSH2):c.1006C>A (p.Pro336Thr) rs63751062
NM_000251.2(MSH2):c.1006C>T (p.Pro336Ser) rs63751062
NM_000251.2(MSH2):c.1007del (p.Pro336fs) rs587779064
NM_000251.2(MSH2):c.1008del (p.Gln337fs) rs879253899
NM_000251.2(MSH2):c.1009C>T (p.Gln337Ter) rs63750778
NM_000251.2(MSH2):c.1012G>A (p.Gly338Arg) rs63751004
NM_000251.2(MSH2):c.1013G>A (p.Gly338Glu) rs587779065
NM_000251.2(MSH2):c.1013G>C (p.Gly338Ala) rs587779065
NM_000251.2(MSH2):c.1015C>T (p.Gln339Ter) rs1558466577
NM_000251.2(MSH2):c.1016A>C (p.Gln339Pro) rs1060502006
NM_000251.2(MSH2):c.1017_1018del (p.Arg340fs) rs63750703
NM_000251.2(MSH2):c.1018dup (p.Arg340fs) rs63750703
NM_000251.2(MSH2):c.1021C>G (p.Leu341Val) rs748115066
NM_000251.2(MSH2):c.1022T>C (p.Leu341Pro) rs63751147
NM_000251.2(MSH2):c.1024G>A (p.Val342Ile) rs63749879
NM_000251.2(MSH2):c.1029C>A (p.Asn343Lys) rs1060501995
NM_000251.2(MSH2):c.1030C>A (p.Gln344Lys) rs63750245
NM_000251.2(MSH2):c.1030C>T (p.Gln344Ter) rs63750245
NM_000251.2(MSH2):c.1033T>G (p.Trp345Gly) rs1558466616
NM_000251.2(MSH2):c.1034G>A (p.Trp345Ter) rs63751027
NM_000251.2(MSH2):c.1035G>A (p.Trp345Ter) rs63750396
NM_000251.2(MSH2):c.1037_1038dup (p.Lys347fs) rs63751483
NM_000251.2(MSH2):c.103C>T (p.Arg35Cys) rs1060502034
NM_000251.2(MSH2):c.1043A>G (p.Gln348Arg) rs773177076
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1046C>G (p.Pro349Arg) rs587779067
NM_000251.2(MSH2):c.1046C>T (p.Pro349Leu) rs587779067
NM_000251.2(MSH2):c.1046_1047delinsGC (p.Pro349Arg) rs1558466685
NM_000251.2(MSH2):c.104G>A (p.Arg35His) rs1060502012
NM_000251.2(MSH2):c.1059del (p.Asn354fs) rs587779068
NM_000251.2(MSH2):c.1067T>G (p.Ile356Arg) rs753075410
NM_000251.2(MSH2):c.1069G>C (p.Glu357Gln) rs587779069
NM_000251.2(MSH2):c.1070A>C (p.Glu357Ala) rs150503781
NM_000251.2(MSH2):c.1071G>A (p.Glu357=) rs587781617
NM_000251.2(MSH2):c.1075A>T (p.Arg359Ter) rs587779070
NM_000251.2(MSH2):c.1076+17T>G rs587779071
NM_000251.2(MSH2):c.1076+1G>A rs267607940
NM_000251.2(MSH2):c.1076+1G>T rs267607940
NM_000251.2(MSH2):c.1076+23C>G rs377417056
NM_000251.2(MSH2):c.1076+3400C>T rs4952887
NM_000251.2(MSH2):c.1076+3A>T rs267607941
NM_000251.2(MSH2):c.1076+4T>A rs764606343
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-135_1276+119dup rs1553356484
NM_000251.2(MSH2):c.1077-15G>T rs753277524
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1077-1G>T rs267607944
NM_000251.2(MSH2):c.1077-2037G>T rs13425206
NM_000251.2(MSH2):c.1077-220_1276+6245del
NM_000251.2(MSH2):c.1077-2A>C rs267607943
NM_000251.2(MSH2):c.1077-2A>G rs267607943
NM_000251.2(MSH2):c.1077-2A>T rs267607943
NM_000251.2(MSH2):c.1077-35A>G rs267607942
NM_000251.2(MSH2):c.1077-66_1146del rs193922372
NM_000251.2(MSH2):c.1077-80G>A rs2347794
NM_000251.2(MSH2):c.1077-?_*(272_?)del
NM_000251.2(MSH2):c.1077-?_*279+?del
NM_000251.2(MSH2):c.1077-?_1276+?del
NM_000251.2(MSH2):c.1077-?_1276+?dup
NM_000251.2(MSH2):c.1077-?_1276+?dup200 rs1553356518
NM_000251.2(MSH2):c.1077-?_1386+?del
NM_000251.2(MSH2):c.1077-?_1386+?dup310
NM_000251.2(MSH2):c.1077-?_1661+?del
NM_000251.2(MSH2):c.1077-?_2005+?del
NM_000251.2(MSH2):c.1077A>T (p.Arg359Ser) rs63751617
NM_000251.2(MSH2):c.1077_1078ins173 (p.?)
NM_000251.2(MSH2):c.1077_1276del200 (p.Leu360Lysfs) rs1553356518
NM_000251.2(MSH2):c.1082A>G (p.Asn361Ser) rs587779072
NM_000251.2(MSH2):c.1083T>C (p.Asn361=) rs864622544
NM_000251.2(MSH2):c.1086A>T (p.Leu362Phe) rs63751699
NM_000251.2(MSH2):c.108T>C (p.Leu36=) rs876659034
NM_000251.2(MSH2):c.1097_1098insA (p.Phe366fs) rs267607693
NM_000251.2(MSH2):c.1099del (p.Phe366_Val367insTer) rs587779073
NM_000251.2(MSH2):c.10C>T (p.Gln4Ter)
NM_000251.2(MSH2):c.1108del (p.Ala370fs) rs63749814
NM_000251.2(MSH2):c.110del (p.Phe37fs) rs63751056
NM_000251.2(MSH2):c.1111G>C (p.Glu371Gln) rs1060501994
NM_000251.2(MSH2):c.1114T>C (p.Leu372=) rs770201760
NM_000251.2(MSH2):c.1118G>A (p.Arg373Lys) rs864622254
NM_000251.2(MSH2):c.1119del (p.Arg373fs) rs63750516
NM_000251.2(MSH2):c.1120C>T (p.Gln374Ter) rs63750558
NM_000251.2(MSH2):c.1124C>G (p.Thr375Ser) rs774539871
NM_000251.2(MSH2):c.1127_1128dup (p.Gln377fs) rs63751219
NM_000251.2(MSH2):c.1129C>T (p.Gln377Ter) rs63750267
NM_000251.2(MSH2):c.112G>T (p.Asp38Tyr) rs730881761
NM_000251.2(MSH2):c.1130A>G (p.Gln377Arg) rs776174711
NM_000251.2(MSH2):c.1139del (p.Leu380fs) rs63750039
NM_000251.2(MSH2):c.1144C>T (p.Arg382Cys) rs752373431
NM_000251.2(MSH2):c.1144dup (p.Arg382fs) rs63750496
NM_000251.2(MSH2):c.1145G>A (p.Arg382His) rs267607947
NM_000251.2(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.2(MSH2):c.114C>G (p.Asp38Glu) rs587779074
NM_000251.2(MSH2):c.1154C>T (p.Pro385Leu) rs564736113
NM_000251.2(MSH2):c.1158T>C (p.Asp386=) rs1060504421
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.115_123del (p.Arg39_Asp41del) rs863224831
NM_000251.2(MSH2):c.1165C>T (p.Arg389Ter) rs587779075
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.1171G>A (p.Ala391Thr) rs878853798
NM_000251.2(MSH2):c.1172C>T (p.Ala391Val) rs864622674
NM_000251.2(MSH2):c.1182T>G (p.Phe394Leu) rs374135434
NM_000251.2(MSH2):c.1183C>T (p.Gln395Ter) rs63750302
NM_000251.2(MSH2):c.1189C>T (p.Gln397Ter) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1191A>T (p.Gln397His) rs768694189
NM_000251.2(MSH2):c.1192dup (p.Ala398fs) rs63751169
NM_000251.2(MSH2):c.1193C>T (p.Ala398Val) rs1060502019
NM_000251.2(MSH2):c.1194A>G (p.Ala398=) rs1060504412
NM_000251.2(MSH2):c.1196_1197dup (p.Asn400fs) rs63749850
NM_000251.2(MSH2):c.119del (p.Gly40fs) rs63750984
NM_000251.2(MSH2):c.11A>T (p.Gln4Leu) rs754562075
NM_000251.2(MSH2):c.1201_1202dup (p.Leu401fs) rs869312768
NM_000251.2(MSH2):c.1203dup (p.Gln402fs) rs63750586
NM_000251.2(MSH2):c.1204C>A (p.Gln402Lys) rs63751412
NM_000251.2(MSH2):c.1204C>T (p.Gln402Ter) rs63751412
NM_000251.2(MSH2):c.1204del (p.Gln402fs) rs63751413
NM_000251.2(MSH2):c.1209T>C (p.Asp403=) rs1060504420
NM_000251.2(MSH2):c.1215C>A (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1215C>G (p.Tyr405Ter) rs63751271
NM_000251.2(MSH2):c.1216C>T (p.Arg406Ter) rs63751108
NM_000251.2(MSH2):c.1216_1219dup (p.Leu407fs) rs63751192
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1219_1220CT[1] (p.Tyr408fs) rs587779076
NM_000251.2(MSH2):c.1221C>G (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1221C>T (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1222dup (p.Tyr408fs) rs63751142
NM_000251.2(MSH2):c.1223A>G (p.Tyr408Cys) rs63750379
NM_000251.2(MSH2):c.1223A>T (p.Tyr408Phe) rs63750379
NM_000251.2(MSH2):c.1224T>C (p.Tyr408=) rs63750132
NM_000251.2(MSH2):c.1224T>G (p.Tyr408Ter) rs63750132
NM_000251.2(MSH2):c.1225C>A (p.Gln409Lys) rs151244108
NM_000251.2(MSH2):c.1225C>G (p.Gln409Glu) rs151244108
NM_000251.2(MSH2):c.1226_1227del (p.Gln409fs) rs63750086
NM_000251.2(MSH2):c.1236_1268del (p.Asn412_Glu422del) rs587779077
NM_000251.2(MSH2):c.1238A>C (p.Gln413Pro) rs587779962
NM_000251.2(MSH2):c.123C>G (p.Asp41Glu) rs761960690
NM_000251.2(MSH2):c.1241T>C (p.Leu414Pro) rs587779078
NM_000251.2(MSH2):c.1243_1246del (p.Pro415fs) rs63751206
NM_000251.2(MSH2):c.1249_1253del (p.Val417fs) rs587779079
NM_000251.2(MSH2):c.1249del (p.Val417fs) rs63751059
NM_000251.2(MSH2):c.1251_1268delinsAGTT (p.Ile418fs) rs863225388
NM_000251.2(MSH2):c.1254A>G (p.Ile418Met) rs751431238
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1255C>T (p.Gln419Ter) rs63750006
NM_000251.2(MSH2):c.1261C>A (p.Leu421Met) rs63750228
NM_000251.2(MSH2):c.1262T>C (p.Leu421Pro) rs587779080
NM_000251.2(MSH2):c.1264G>A (p.Glu422Lys) rs63751712
NM_000251.2(MSH2):c.1264G>T (p.Glu422Ter) rs63751712
NM_000251.2(MSH2):c.1269dup (p.His424fs) rs63751667
NM_000251.2(MSH2):c.1271A>G (p.His424Arg) rs200429136
NM_000251.2(MSH2):c.1271dup (p.His424fs) rs587783055
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+10G>A rs374061707
NM_000251.2(MSH2):c.1276+11A>G rs189015988
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+1G>C rs267607950
NM_000251.2(MSH2):c.1276+1G>T rs267607950
NM_000251.2(MSH2):c.1276+23dup rs587779081
NM_000251.2(MSH2):c.1276+2T>A rs267607953
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1276+47T>A rs148018406
NM_000251.2(MSH2):c.1276+51C>A rs17217961
NM_000251.2(MSH2):c.1276+6765G>A rs3771274
NM_000251.2(MSH2):c.1277-118G>A rs1981929
NM_000251.2(MSH2):c.1277-14C>G rs267607951
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1277-1G>A rs267607948
NM_000251.2(MSH2):c.1277-1G>C rs267607948
NM_000251.2(MSH2):c.1277-212T>A rs1981928
NM_000251.2(MSH2):c.1277-2A>C rs267607949
NM_000251.2(MSH2):c.1277-2A>G rs267607949
NM_000251.2(MSH2):c.1277-2A>T rs267607949
NM_000251.2(MSH2):c.1277-4076_1386+1819del
NM_000251.2(MSH2):c.1277-571_1386+2327del
NM_000251.2(MSH2):c.1277-5849T>C rs17036577
NM_000251.2(MSH2):c.1277-6224_1386+4836del
NM_000251.2(MSH2):c.1277-6284_1386+4776del
NM_000251.2(MSH2):c.1277-6990T>G rs13408008
NM_000251.2(MSH2):c.1277-945A>C rs7607312
NM_000251.2(MSH2):c.1277-?_*(272_?)del
NM_000251.2(MSH2):c.1277-?_*(272_?)inv
NM_000251.2(MSH2):c.1277-?_1386+?del
NM_000251.2(MSH2):c.1277-?_1661+?del
NM_000251.2(MSH2):c.1277-?_1759+?del
NM_000251.2(MSH2):c.1277-?_2634+?del
NM_000251.2(MSH2):c.1278_1386+1del110 (p.Lys427Glyfs) rs1553361141
NM_000251.2(MSH2):c.1285C>T (p.Gln429Ter) rs63751693
NM_000251.2(MSH2):c.1286A>C (p.Gln429Pro) rs1558493372
NM_000251.2(MSH2):c.1287dup (p.Lys430fs) rs63751626
NM_000251.2(MSH2):c.1288A>T (p.Lys430Ter) rs63751646
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.1292T>A (p.Leu431Ter) rs63751315
NM_000251.2(MSH2):c.1293dup (p.Leu432fs) rs1553361162
NM_000251.2(MSH2):c.129T>G (p.Tyr43Ter) rs63750894
NM_000251.2(MSH2):c.12G>T (p.Gln4His) rs878853800
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1311_1334del24insNM_000251.1:c.1338_1361inv24 (p.Thr438_Ser445delinsPheSerLysPheGlnGluMetIle)
NM_000251.2(MSH2):c.1313C>T (p.Thr438Ile) rs1553361185
NM_000251.2(MSH2):c.1313_1315CTC[1] (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1316_1317CT[1] (p.Leu440fs) rs587779083
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1319_1326delinsCC (p.Leu440_Asp442delinsPro) rs63749931
NM_000251.2(MSH2):c.131C>T (p.Thr44Met) rs587779085
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1321dup (p.Thr441fs) rs63750807
NM_000251.2(MSH2):c.1331G>T (p.Arg444Leu) rs557339938
NM_000251.2(MSH2):c.1339T>G (p.Phe447Val) rs63751217
NM_000251.2(MSH2):c.1340_1341insGG (p.Phe447fs) rs267607696
NM_000251.2(MSH2):c.1344C>T (p.Ser448=) rs1010360604
NM_000251.2(MSH2):c.1345A>T (p.Lys449Ter) rs63749920
NM_000251.2(MSH2):c.1345_1348del (p.Lys449fs) rs267607955
NM_000251.2(MSH2):c.1347G>C (p.Lys449Asn) rs587781331
NM_000251.2(MSH2):c.134C>T (p.Ala45Val) rs63750285
NM_000251.2(MSH2):c.1352_1353del (p.Gln451fs) rs63750957
NM_000251.2(MSH2):c.1353G>A (p.Gln451=) rs1060504415
NM_000251.2(MSH2):c.1354G>T (p.Glu452Ter) rs267607954
NM_000251.2(MSH2):c.1356A>G (p.Glu452=) rs63751212
NM_000251.2(MSH2):c.1357A>C (p.Met453Leu) rs1558493602
NM_000251.2(MSH2):c.1358T>A (p.Met453Lys) rs63750697
NM_000251.2(MSH2):c.135G>A (p.Ala45=) rs890172773
NM_000251.2(MSH2):c.136_164del (p.His46fs) rs63751482
NM_000251.2(MSH2):c.1373T>G (p.Leu458Ter) rs63750521
NM_000251.2(MSH2):c.1382A>C (p.Asp461Ala) rs730881756
NM_000251.2(MSH2):c.1384C>T (p.Gln462Ter) rs876657701
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1386+1G>C rs267607957
NM_000251.2(MSH2):c.1386+1G>T rs267607957
NM_000251.2(MSH2):c.1386+73G>A rs267607958
NM_000251.2(MSH2):c.1387-1G>T rs267607956
NM_000251.2(MSH2):c.1387-250G>A rs6741393
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1387-9T>A rs587779087
NM_000251.2(MSH2):c.1387-9T>C rs587779087
NM_000251.2(MSH2):c.1387-?_*(272_?)del
NM_000251.2(MSH2):c.1387-?_1510+?del
NM_000251.2(MSH2):c.1387-?_1661+?del
NM_000251.2(MSH2):c.1387-?_1661+?dup275
NM_000251.2(MSH2):c.1387-?_2458+?del
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.1390del (p.Glu464fs) rs587779088
NM_000251.2(MSH2):c.1397A>G (p.His466Arg) rs544265737
NM_000251.2(MSH2):c.1399G>T (p.Glu467Ter) rs587779089
NM_000251.2(MSH2):c.1401del (p.Glu467fs) rs1553365711
NM_000251.2(MSH2):c.1404_1410del (p.Phe468fs) rs878853802
NM_000251.2(MSH2):c.1405del (p.Leu469_Val470insTer) rs1060502027
NM_000251.2(MSH2):c.1408del (p.Leu469_Val470insTer) rs63750384
NM_000251.2(MSH2):c.1409T>A (p.Val470Glu) rs267607959
NM_000251.2(MSH2):c.1418C>G (p.Ser473Ter) rs63751403
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.141C>A (p.Gly47=) rs587779090
NM_000251.2(MSH2):c.141_154del (p.Glu48fs) rs863224481
NM_000251.2(MSH2):c.1429A>C (p.Asn477His) rs587781346
NM_000251.2(MSH2):c.142G>T (p.Glu48Ter) rs63750615
NM_000251.2(MSH2):c.1431_1432TC[3] (p.Glu480fs) rs587779091
NM_000251.2(MSH2):c.1442T>A (p.Leu481Ter) rs786203036
NM_000251.2(MSH2):c.1444A>T (p.Arg482Ter) rs587779092
NM_000251.2(MSH2):c.1444del (p.Arg482fs) rs63750068
NM_000251.2(MSH2):c.1444dup (p.Arg482fs) rs63750068
NM_000251.2(MSH2):c.1445_1446GA[1] (p.Glu483fs) rs63750161
NM_000251.2(MSH2):c.1445_1449del (p.Arg482fs) rs267607961
NM_000251.2(MSH2):c.1447G>T (p.Glu483Ter) rs63749947
NM_000251.2(MSH2):c.1453_1456ATGA[1] (p.Asn486fs) rs1114167806
NM_000251.2(MSH2):c.1457del (p.Asn486fs) rs63750986
NM_000251.2(MSH2):c.145_146del (p.Asp49fs) rs63750334
NM_000251.2(MSH2):c.145del (p.Asp49fs) rs63750644
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1465G>A (p.Glu489Lys) rs876658187
NM_000251.2(MSH2):c.1469A>G (p.Lys490Arg) rs1060502008
NM_000251.2(MSH2):c.146A>T (p.Asp49Val) rs63750335
NM_000251.2(MSH2):c.1470_1473delinsAAA (p.Met492fs) rs1060502029
NM_000251.2(MSH2):c.1476_1477delinsCT (p.Met492_Gln493delinsIleTer) rs63750583
NM_000251.2(MSH2):c.1477C>T (p.Gln493Ter) rs63750936
NM_000251.2(MSH2):c.1487T>A (p.Leu496Ter) rs587779093
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1494dup (p.Ala499fs) rs63750362
NM_000251.2(MSH2):c.1497del (p.Ala500fs) rs63749963
NM_000251.2(MSH2):c.149C>G (p.Ala50Gly) rs876658582
NM_000251.2(MSH2):c.14C>A (p.Pro5Gln) rs56170584
NM_000251.2(MSH2):c.1500dup (p.Arg501fs) rs587779094
NM_000251.2(MSH2):c.1508T>C (p.Leu503Pro) rs587779095
NM_000251.2(MSH2):c.1510+11G>C rs370675562
NM_000251.2(MSH2):c.1510+1G>A rs1114167852
NM_000251.2(MSH2):c.1510+2T>C rs1060502023
NM_000251.2(MSH2):c.1510+6_1510+7delAA rs1060502013
NM_000251.2(MSH2):c.1510G>C (p.Gly504Arg) rs63751600
NM_000251.2(MSH2):c.1511-10G>T rs587779096
NM_000251.2(MSH2):c.1511-10_1511-7delGATT rs864622529
NM_000251.2(MSH2):c.1511-1516C>T rs3771281
NM_000251.2(MSH2):c.1511-1G>A rs267607964
NM_000251.2(MSH2):c.1511-2A>G rs267607962
NM_000251.2(MSH2):c.1511-41G>C rs202215396
NM_000251.2(MSH2):c.1511-91G>T rs3732182
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1511-?_2005+?del
NM_000251.2(MSH2):c.1516G>T (p.Asp506Tyr) rs63750492
NM_000251.2(MSH2):c.1520del (p.Pro507fs) rs1553366510
NM_000251.2(MSH2):c.1522G>A (p.Gly508Ser) rs267607968
NM_000251.2(MSH2):c.1528C>T (p.Gln510Ter) rs587779097
NM_000251.2(MSH2):c.1534_1543del (p.Lys512fs) rs1553366522
NM_000251.2(MSH2):c.1546A>G (p.Ser516Gly) rs878853803
NM_000251.2(MSH2):c.1547G>A (p.Ser516Asn) rs373564353
NM_000251.2(MSH2):c.1547G>T (p.Ser516Ile) rs373564353
NM_000251.2(MSH2):c.154_155insG (p.Leu52fs) rs63750352
NM_000251.2(MSH2):c.1550C>T (p.Ala517Val) rs1060501997
NM_000251.2(MSH2):c.1550_1551CA[1] (p.Gln518fs) rs63749930
NM_000251.2(MSH2):c.1552C>T (p.Gln518Ter) rs63750780
NM_000251.2(MSH2):c.1557del (p.Phe519fs) rs1553366554
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1560dup (p.Tyr521fs) rs1553366561
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1566C>G (p.Tyr522Ter) rs63750224
NM_000251.2(MSH2):c.1567T>A (p.Phe523Ile) rs267607966
NM_000251.2(MSH2):c.156G>A (p.Leu52=) rs750241099
NM_000251.2(MSH2):c.1571G>A (p.Arg524His) rs63751207
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1571G>T (p.Arg524Leu) rs63751207
NM_000251.2(MSH2):c.1576del (p.Thr526fs) rs63750094
NM_000251.2(MSH2):c.1578del (p.Cys527fs) rs63750738
NM_000251.2(MSH2):c.157G>T (p.Ala53Ser) rs755931648
NM_000251.2(MSH2):c.1582A>C (p.Lys528Gln) rs199744440
NM_000251.2(MSH2):c.1587del (p.Glu530fs) rs63750845
NM_000251.2(MSH2):c.1593_1613del (p.Lys531_Lys537del) rs63750510
NM_000251.2(MSH2):c.1594dup (p.Val532fs) rs63750104
NM_000251.2(MSH2):c.1595T>C (p.Val532Ala) rs754778750
NM_000251.2(MSH2):c.1600C>T (p.Arg534Cys) rs63750029
NM_000251.2(MSH2):c.1601G>A (p.Arg534His) rs587778523
NM_000251.2(MSH2):c.1601G>T (p.Arg534Leu) rs587778523
NM_000251.2(MSH2):c.1602T>A (p.Arg534=) rs267607965
NM_000251.2(MSH2):c.1605C>T (p.Asn535=) rs587779098
NM_000251.2(MSH2):c.160G>T (p.Ala54Ser) rs749212640
NM_000251.2(MSH2):c.1627del (p.Asp543fs) rs63750675
NM_000251.2(MSH2):c.1637dup (p.Asn547fs) rs1553366642
NM_000251.2(MSH2):c.1638G>C (p.Lys546Asn) rs372350768
NM_000251.2(MSH2):c.1638_1639dup (p.Asn547fs) rs63750662
NM_000251.2(MSH2):c.163C>T (p.Arg55Trp)