ClinVar Miner

List of variants reported as risk factor for microvascular complications of diabetes, susceptibility

Included ClinVar conditions (10):

Alzheimer disease; Variegate porphyria; Microvascular complications of diabetes, susceptibility to, 7; Hemochromatosis type 1; TRANSFERRIN SERUM LEVEL QUANTITATIVE TRAIT LOCUS 2; Familial porphyria cutanea tarda
Microvascular complications of diabetes, susceptibility to, 1
Microvascular complications of diabetes, susceptibility to, 2
Microvascular complications of diabetes, susceptibility to, 3
Microvascular complications of diabetes, susceptibility to, 3; Hemorrhage, intracerebral, susceptibility to; Renal tubular dysgenesis of genetic origin
Microvascular complications of diabetes, susceptibility to, 4
Microvascular complications of diabetes, susceptibility to, 4; Sterile multifocal osteomyelitis with periostitis and pustulosis; Gastric cancer
Microvascular complications of diabetes, susceptibility to, 5
Microvascular complications of diabetes, susceptibility to, 6
Variegate porphyria; Microvascular complications of diabetes, susceptibility to, 7; Alzheimer disease type 1; Hemochromatosis type 1; TRANSFERRIN SERUM LEVEL QUANTITATIVE TRAIT LOCUS 2; Familial porphyria cutanea tarda

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 6

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_003376.6(VEGFA):c.-94C>G	rs2010963	0.69806
NM_000799.3(EPO):c.-1306C>A	rs1617640	0.62931
NM_000636.4(SOD2):c.47T>C (p.Val16Ala)	rs4880	0.47242
NM_000446.7(PON1):c.163T>A (p.Leu55Met)	rs854560	0.29107
NM_000789.3(ACE):c.2306-117_2306-116insAF118569.1:g.14094_14382
NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2]	rs2234663

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.