ClinVar Miner

List of variants in gene CDKN1C reported as benign for Beckwith-Wiedemann syndrome

Included ClinVar conditions (4):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 20
Download table as spreadsheet
HGVS dbSNP
NM_000076.2(CDKN1C):c.-84G>A rs188494894
NM_000076.2(CDKN1C):c.132C>T (p.Arg44=) rs149717696
NM_000076.2(CDKN1C):c.512_523delCTCCGGTCGCGG (p.Ala171_Ala174del) rs565544512
NM_000076.2(CDKN1C):c.549_554delCCCGGC (p.Ala193_Pro194del) rs878853629
NM_000076.2(CDKN1C):c.555T>C (p.Ala185=) rs191294997
NM_000076.2(CDKN1C):c.567_572delTCCGGC (p.Ala193_Pro194del) rs878853632
NM_000076.2(CDKN1C):c.600A>G (p.Pro200=) rs529326848
NM_000076.2(CDKN1C):c.600_605delAGCCCC (p.Ala215_Pro216del) rs1060503860
NM_000076.2(CDKN1C):c.600_611delAGCCCCGGCCCC (p.Ala213_Pro216del) rs878853634
NM_000076.2(CDKN1C):c.600_611dupAGCCCCGGCCCC (p.Pro216_Asp217insAlaProAlaPro) rs878853634
NM_000076.2(CDKN1C):c.600_617delAGCCCCGGCCCCGGCCCC (p.Ala211_Pro216del) rs878853636
NM_000076.2(CDKN1C):c.600_623delAGCCCCGGCCCCGGCCCCGGCCCC (p.Ala209_Pro216del) rs878853637
NM_000076.2(CDKN1C):c.618_629delGGCCCCGGCCCC (p.Ala213_Pro216del) rs759134767
NM_000076.2(CDKN1C):c.624_629delGGCCCC (p.Ala215_Pro216del) rs759134767
NM_000076.2(CDKN1C):c.624_629dupGGCCCC (p.Pro216_Asp217insAlaPro) rs759134767
NM_000076.2(CDKN1C):c.626_649delCCCCCGCCCCGGCCCCGGCCCCGG (p.Ala209_Pro216del) rs778468310
NM_000076.2(CDKN1C):c.669C>T (p.Ser223=) rs540923047
NM_000076.2(CDKN1C):c.708G>A (p.Glu236=) rs3741341
NM_000076.2(CDKN1C):c.72A>G (p.Leu24=) rs3852522
NM_000076.2(CDKN1C):c.735G>A (p.Gly245=) rs556682082

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.