ClinVar Miner

List of variants in gene PRNP reported as pathogenic for Gerstmann-Straussler-Scheinker syndrome

Included ClinVar conditions (2):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 16
Download table as spreadsheet
NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln) rs193922906
NM_000311.4(PRNP):c.305C>T (p.Pro102Leu) rs74315401
NM_000311.4(PRNP):c.313C>T (p.Pro105Ser) rs74315414
NM_000311.4(PRNP):c.314C>T (p.Pro105Leu) rs11538758
NM_000311.4(PRNP):c.350C>T (p.Ala117Val) rs74315402
NM_000311.4(PRNP):c.392G>T (p.Gly131Val) rs74315410
NM_000311.4(PRNP):c.398C>T (p.Ala133Val) rs74315415
NM_000311.4(PRNP):c.435T>G (p.Tyr145Ter) rs80356710
NM_000311.4(PRNP):c.478C>T (p.Gln160Ter) rs80356711
NM_000311.4(PRNP):c.489C>G (p.Tyr163Ter)
NM_000311.4(PRNP):c.560A>G (p.His187Arg) rs74315413
NM_000311.4(PRNP):c.593T>C (p.Phe198Ser) rs74315405
NM_000311.4(PRNP):c.633G>C (p.Glu211Asp) rs398122413
NM_000311.4(PRNP):c.650A>G (p.Gln217Arg) rs74315406
NM_000311.4(PRNP):c.678C>A (p.Tyr226Ter) rs398122414
NM_000311.4(PRNP):c.679C>T (p.Gln227Ter) rs17852079

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.