ClinVar Miner

List of variants in gene COL6A2 studied for Bethlem myopathy

Included ClinVar conditions (6):
Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 283
Download table as spreadsheet
NM_001849.3(COL6A2):c.*56T>G rs148337125
NM_001849.3(COL6A2):c.*5G>A rs377195134
NM_001849.3(COL6A2):c.1000-2A>C rs1555873356
NM_001849.3(COL6A2):c.1000-6C>T rs761428568
NM_001849.3(COL6A2):c.1037_1038delGAinsTT (p.Gly346Val)
NM_001849.3(COL6A2):c.1053+1G>C rs886043187
NM_001849.3(COL6A2):c.1053+2delT rs886044140
NM_001849.3(COL6A2):c.1053+3A>T rs1555873388
NM_001849.3(COL6A2):c.1053+6G>A rs373181368
NM_001849.3(COL6A2):c.1054-2A>G rs886044023
NM_001849.3(COL6A2):c.1055del (p.Gly352Alafs) rs1555873507
NM_001849.3(COL6A2):c.1059delC (p.Asp354Thrfs) rs1555873508
NM_001849.3(COL6A2):c.1070C>G (p.Pro357Arg) rs199929757
NM_001849.3(COL6A2):c.1078G>T (p.Ala360Ser) rs1555873523
NM_001849.3(COL6A2):c.1095G>T (p.Glu365Asp) rs374673302
NM_001849.3(COL6A2):c.1096C>T (p.Arg366Ter) rs387906609
NM_001849.3(COL6A2):c.1111G>A (p.Gly371Ser)
NM_001849.3(COL6A2):c.1129C>T (p.Arg377Cys) rs144801620
NM_001849.3(COL6A2):c.1130G>A (p.Arg377His) rs148552966
NM_001849.3(COL6A2):c.1138C>T (p.Arg380Cys) rs142880107
NM_001849.3(COL6A2):c.1140C>T (p.Arg380=) rs144482400
NM_001849.3(COL6A2):c.115+2T>C rs770842374
NM_001849.3(COL6A2):c.116-6C>T rs761805565
NM_001849.3(COL6A2):c.1161C>T (p.Ile387=) rs140027285
NM_001849.3(COL6A2):c.1181G>C (p.Gly394Ala)
NM_001849.3(COL6A2):c.1199G>T (p.Gly400Val) rs1555873827
NM_001849.3(COL6A2):c.1215T>C (p.Pro405=) rs558981930
NM_001849.3(COL6A2):c.1225G>A (p.Gly409Arg)
NM_001849.3(COL6A2):c.1251C>T (p.Arg417=) rs61735827
NM_001849.3(COL6A2):c.1277_1291delGGGGAGACCCCGGCA (p.Arg426_Gly430del) rs1555873962
NM_001849.3(COL6A2):c.1288G>A (p.Gly430Ser) rs765430501
NM_001849.3(COL6A2):c.1294A>T (p.Lys432Ter)
NM_001849.3(COL6A2):c.129C>T (p.Cys43=) rs755324001
NM_001849.3(COL6A2):c.1333-10C>G rs199513044
NM_001849.3(COL6A2):c.1336G>A (p.Asp446Asn) rs535007570
NM_001849.3(COL6A2):c.1336G>C (p.Asp446His) rs535007570
NM_001849.3(COL6A2):c.1348G>C (p.Glu450Gln) rs757846451
NM_001849.3(COL6A2):c.1356C>T (p.Pro452=) rs886044428
NM_001849.3(COL6A2):c.1357C>T (p.Arg453Cys)
NM_001849.3(COL6A2):c.1358G>A (p.Arg453His) rs878854386
NM_001849.3(COL6A2):c.138C>T (p.His46=) rs201753549
NM_001849.3(COL6A2):c.1402C>T (p.Arg468Ter)
NM_001849.3(COL6A2):c.1437T>C (p.Ala479=) rs149077114
NM_001849.3(COL6A2):c.1458+1G>A rs886044526
NM_001849.3(COL6A2):c.1458+9_1458+14delCAGTGC rs762583937
NM_001849.3(COL6A2):c.1459-2A>G rs749974929
NM_001849.3(COL6A2):c.1466G>A (p.Arg489Gln) rs61735828
NM_001849.3(COL6A2):c.1466G>C (p.Arg489Pro) rs61735828
NM_001849.3(COL6A2):c.1489C>A (p.Pro497Thr) rs75581470
NM_001849.3(COL6A2):c.1493G>A (p.Arg498His) rs267606749
NM_001849.3(COL6A2):c.1496G>A (p.Gly499Glu) rs886042332
NM_001849.3(COL6A2):c.1518C>T (p.Pro506=) rs767192013
NM_001849.3(COL6A2):c.1522-1G>A rs398123646
NM_001849.3(COL6A2):c.1552C>T (p.Pro518Ser) rs141166141
NM_001849.3(COL6A2):c.1572+3G>A rs372414400
NM_001849.3(COL6A2):c.1605C>T (p.Pro535=) rs377476546
NM_001849.3(COL6A2):c.1606G>A (p.Glu536Lys) rs143338050
NM_001849.3(COL6A2):c.1614C>T (p.Gly538=) rs147194375
NM_001849.3(COL6A2):c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA (p.Gly549_Pro557del) rs1555874762
NM_001849.3(COL6A2):c.1666G>A (p.Glu556Lys) rs368878639
NM_001849.3(COL6A2):c.1674G>A (p.Ala558=) rs144334894
NM_001849.3(COL6A2):c.167G>A (p.Ser56Asn) rs1555871311
NM_001849.3(COL6A2):c.1685C>T (p.Pro562Leu) rs370775804
NM_001849.3(COL6A2):c.169G>A (p.Val57Ile) rs768434256
NM_001849.3(COL6A2):c.1751delC (p.Pro584Leufs) rs886044398
NM_001849.3(COL6A2):c.1762G>A (p.Gly588Ser) rs139488626
NM_001849.3(COL6A2):c.1769C>T (p.Thr590Met) rs142709940
NM_001849.3(COL6A2):c.1770+1delG rs886044215
NM_001849.3(COL6A2):c.1770G>A (p.Thr590=) rs150999832
NM_001849.3(COL6A2):c.1792G>A (p.Val598Met) rs149731632
NM_001849.3(COL6A2):c.1806C>A (p.Cys602Ter)
NM_001849.3(COL6A2):c.1816+9C>T rs1456625954
NM_001849.3(COL6A2):c.1817-4_1817-3dupCC rs149954350
NM_001849.3(COL6A2):c.181T>C (p.Ser61Pro) rs990733473
NM_001849.3(COL6A2):c.1836C>T (p.Gly612=) rs141257132
NM_001849.3(COL6A2):c.1845C>T (p.Asp615=) rs908989305
NM_001849.3(COL6A2):c.1861G>A (p.Asp621Asn) rs267606750
NM_001849.3(COL6A2):c.1870G>A (p.Glu624Lys) rs387906607
NM_001849.3(COL6A2):c.1899G>A (p.Leu633=) rs189341312
NM_001849.3(COL6A2):c.1913T>G (p.Val638Gly) rs141919484
NM_001849.3(COL6A2):c.1921G>A (p.Val641Met) rs1032420539
NM_001849.3(COL6A2):c.1925T>C (p.Val642Ala) rs760227367
NM_001849.3(COL6A2):c.1937G>A (p.Gly646Asp)
NM_001849.3(COL6A2):c.1944C>T (p.Ile648=) rs148178994
NM_001849.3(COL6A2):c.1962C>T (p.Ser654=) rs150253422
NM_001849.3(COL6A2):c.1969+10G>C rs201259184
NM_001849.3(COL6A2):c.1970-10C>T rs373369963
NM_001849.3(COL6A2):c.1970-3C>A rs201879417
NM_001849.3(COL6A2):c.1970-9G>A rs747900252
NM_001849.3(COL6A2):c.2002G>T (p.Glu668Ter) rs138948335
NM_001849.3(COL6A2):c.2083G>A (p.Glu695Lys) rs377376395
NM_001849.3(COL6A2):c.2096G>A (p.Gly699Asp) rs863224861
NM_001849.3(COL6A2):c.2136C>T (p.Asp712=) rs114554195
NM_001849.3(COL6A2):c.2153G>A (p.Ser718Asn)
NM_001849.3(COL6A2):c.2160C>G (p.Arg720=) rs61735829
NM_001849.3(COL6A2):c.2163G>A (p.Gln721=) rs16978875
NM_001849.3(COL6A2):c.2170C>T (p.Arg724Cys) rs150098077
NM_001849.3(COL6A2):c.2171G>T (p.Arg724Leu) rs145450812
NM_001849.3(COL6A2):c.2173G>T (p.Val725Leu) rs1555875749
NM_001849.3(COL6A2):c.2181G>A (p.Ala727=)
NM_001849.3(COL6A2):c.2189T>G (p.Ile730Ser) rs1555875759
NM_001849.3(COL6A2):c.2197G>A (p.Gly733Arg) rs886042922
NM_001849.3(COL6A2):c.2220T>C (p.Asp740=) rs61735830
NM_001849.3(COL6A2):c.2235G>T (p.Arg745=) rs773668391
NM_001849.3(COL6A2):c.2237C>T (p.Ala746Val) rs761863452
NM_001849.3(COL6A2):c.2238G>A (p.Ala746=) rs535581551
NM_001849.3(COL6A2):c.2243G>A (p.Cys748Tyr) rs200072495
NM_001849.3(COL6A2):c.2244C>T (p.Cys748=) rs201426778
NM_001849.3(COL6A2):c.2251G>A (p.Asp751Asn) rs375884809
NM_001849.3(COL6A2):c.2278G>A (p.Gly760Arg)
NM_001849.3(COL6A2):c.2284_2285delAT (p.Met762Valfs) rs778129335
NM_001849.3(COL6A2):c.229T>C (p.Phe77Leu) rs199736749
NM_001849.3(COL6A2):c.22G>A (p.Val8Met) rs192476178
NM_001849.3(COL6A2):c.2301C>T (p.His767=) rs138371054
NM_001849.3(COL6A2):c.2312dup (p.Asn771Lysfs) rs886043164
NM_001849.3(COL6A2):c.2319C>T (p.Tyr773=) rs377458657
NM_001849.3(COL6A2):c.2326G>A (p.Ala776Thr) rs759293889
NM_001849.3(COL6A2):c.2329T>C (p.Cys777Arg) rs267606747
NM_001849.3(COL6A2):c.2332G>A (p.Asp778Asn) rs28562813
NM_001849.3(COL6A2):c.2334C>A (p.Asp778Glu) rs764165623
NM_001849.3(COL6A2):c.2351G>A (p.Arg784His) rs75120695
NM_001849.3(COL6A2):c.2371G>A (p.Asp791Asn) rs1273249543
NM_001849.3(COL6A2):c.2375T>C (p.Leu792Pro)
NM_001849.3(COL6A2):c.2386_2388delAAG (p.Lys796del) rs747378168
NM_001849.3(COL6A2):c.2407G>A (p.Asp803Asn) rs761913437
NM_001849.3(COL6A2):c.2410G>A (p.Val804Ile) rs199896699
NM_001849.3(COL6A2):c.2422+6C>T rs371950486
NM_001849.3(COL6A2):c.2435T>C (p.Val812Ala) rs886044025
NM_001849.3(COL6A2):c.2454C>T (p.Cys818=) rs199499499
NM_001849.3(COL6A2):c.2462-5C>T rs760890154
NM_001849.3(COL6A2):c.2462-5dupC rs797044699
NM_001849.3(COL6A2):c.2470G>A (p.Val824Met) rs758758266
NM_001849.3(COL6A2):c.2471T>C (p.Val824Ala) rs1259128571
NM_001849.3(COL6A2):c.2483C>T (p.Thr828Met) rs755782924
NM_001849.3(COL6A2):c.2484G>A (p.Thr828=) rs147199350
NM_001849.3(COL6A2):c.2503G>A (p.Val835Ile) rs117668143
NM_001849.3(COL6A2):c.2508C>A (p.Phe836Leu) rs727502835
NM_001849.3(COL6A2):c.2517C>T (p.Asp839=) rs113002150
NM_001849.3(COL6A2):c.2524G>A (p.Glu842Lys) rs571051982
NM_001849.3(COL6A2):c.2528G>A (p.Arg843Gln) rs201736323
NM_001849.3(COL6A2):c.2558G>A (p.Arg853Gln) rs144830948
NM_001849.3(COL6A2):c.2565C>T (p.Phe855=) rs774805224
NM_001849.3(COL6A2):c.2572C>T (p.Gln858Ter) rs1555877252
NM_001849.3(COL6A2):c.2580G>A (p.Ala860=) rs146420786
NM_001849.3(COL6A2):c.2584C>T (p.Arg862Trp) rs777822883
NM_001849.3(COL6A2):c.2599C>A (p.Arg867=) rs144484744
NM_001849.3(COL6A2):c.2599C>T (p.Arg867Trp) rs144484744
NM_001849.3(COL6A2):c.2600G>A (p.Arg867Gln) rs61735831
NM_001849.3(COL6A2):c.2605G>A (p.Asp869Asn) rs141021828
NM_001849.3(COL6A2):c.2605G>T (p.Asp869Tyr) rs141021828
NM_001849.3(COL6A2):c.2607C>T (p.Asp869=) rs150219725
NM_001849.3(COL6A2):c.2610C>T (p.Asp870=) rs116817879
NM_001849.3(COL6A2):c.2611G>A (p.Asp871Asn) rs387906610
NM_001849.3(COL6A2):c.2623G>A (p.Ala875Thr) rs199606147
NM_001849.3(COL6A2):c.2627G>A (p.Arg876His) rs1012567148
NM_001849.3(COL6A2):c.2628C>T (p.Arg876=)
NM_001849.3(COL6A2):c.2629G>A (p.Val877Met) rs369396198
NM_001849.3(COL6A2):c.2633C>T (p.Ala878Val) rs774521989
NM_001849.3(COL6A2):c.2634G>A (p.Ala878=) rs143749884
NM_001849.3(COL6A2):c.2656G>A (p.Gly886Ser) rs571488000
NM_001849.3(COL6A2):c.2661G>A (p.Glu887=) rs148249892
NM_001849.3(COL6A2):c.267G>C (p.Gln89His)
NM_001849.3(COL6A2):c.2683A>C (p.Ser895Arg) rs141233891
NM_001849.3(COL6A2):c.2697G>A (p.Thr899=) rs11554669
NM_001849.3(COL6A2):c.2711C>T (p.Ala904Val) rs376665722
NM_001849.3(COL6A2):c.2713C>T (p.Leu905=) rs753611948
NM_001849.3(COL6A2):c.2738_2740delCCT (p.Ser913del) rs777696289
NM_001849.3(COL6A2):c.2749G>A (p.Val917Met) rs145381639
NM_001849.3(COL6A2):c.2751G>T (p.Val917=) rs111341650
NM_001849.3(COL6A2):c.2766G>A (p.Val922=) rs557446829
NM_001849.3(COL6A2):c.2769C>T (p.His923=) rs140419176
NM_001849.3(COL6A2):c.2770G>A (p.Ala924Thr) rs771749652
NM_001849.3(COL6A2):c.2773A>C (p.Ile925Leu) rs772894756
NM_001849.3(COL6A2):c.2784C>T (p.Ile928=) rs199501232
NM_001849.3(COL6A2):c.2785G>A (p.Val929Met) rs145527336
NM_001849.3(COL6A2):c.2788C>T (p.Arg930Cys) rs886057168
NM_001849.3(COL6A2):c.2795C>T (p.Pro932Leu) rs117725825
NM_001849.3(COL6A2):c.2796G>A (p.Pro932=) rs373274913
NM_001849.3(COL6A2):c.2798G>A (p.Arg933His) rs374384263
NM_001849.3(COL6A2):c.2802C>T (p.Gly934=) rs151295731
NM_001849.3(COL6A2):c.2804G>A (p.Gly935Glu)
NM_001849.3(COL6A2):c.2809C>T (p.Arg937Trp) rs755352246
NM_001849.3(COL6A2):c.2810G>A (p.Arg937Gln) rs777354703
NM_001849.3(COL6A2):c.2843C>G (p.Thr948Arg) rs367980010
NM_001849.3(COL6A2):c.2850C>T (p.Gly950=) rs751192681
NM_001849.3(COL6A2):c.2856G>A (p.Thr952=) rs138074469
NM_001849.3(COL6A2):c.2871G>A (p.Leu957=) rs548194162
NM_001849.3(COL6A2):c.2877G>T (p.Glu959Asp)
NM_001849.3(COL6A2):c.2880G>A (p.Ser960=) rs375430758
NM_001849.3(COL6A2):c.2886C>T (p.His962=) rs115970356
NM_001849.3(COL6A2):c.288C>T (p.Tyr96=) rs61735833
NM_001849.3(COL6A2):c.2893C>T (p.Arg965Cys) rs201188174
NM_001849.3(COL6A2):c.2894G>C (p.Arg965Pro) rs201854898
NM_001849.3(COL6A2):c.289G>A (p.Gly97Ser) rs750027302
NM_001849.3(COL6A2):c.2902_2934dup (p.Ser978_Asp979insAsnValValProThrValLeuAlaLeuGlySer)
NM_001849.3(COL6A2):c.2905G>A (p.Val969Met) rs763443381
NM_001849.3(COL6A2):c.2917G>A (p.Val973Met) rs145959270
NM_001849.3(COL6A2):c.2927T>C (p.Leu976Ser) rs200200671
NM_001849.3(COL6A2):c.2935G>A (p.Asp979Asn) rs141579198
NM_001849.3(COL6A2):c.2937C>T (p.Asp979=) rs150716220
NM_001849.3(COL6A2):c.2944A>G (p.Met982Val) rs190664941
NM_001849.3(COL6A2):c.2960C>T (p.Thr987Met) rs199955442
NM_001849.3(COL6A2):c.2982C>T (p.Ala994=) rs145460820
NM_001849.3(COL6A2):c.2983G>A (p.Ala995Thr) rs35139588
NM_001849.3(COL6A2):c.2986G>A (p.Val996Met) rs142432514
NM_001849.3(COL6A2):c.2988dup (p.Phe997Valfs) rs1555877364
NM_001849.3(COL6A2):c.2994C>T (p.His998=) rs376362856
NM_001849.3(COL6A2):c.2997G>A (p.Glu999=) rs751494076
NM_001849.3(COL6A2):c.3004T>C (p.Tyr1002His) rs527236952
NM_001849.3(COL6A2):c.3026G>T (p.Gly1009Val)
NM_001849.3(COL6A2):c.3029T>G (p.Phe1010Cys) rs1051148162
NM_001849.3(COL6A2):c.3047G>A (p.Arg1016His) rs376368468
NM_001849.3(COL6A2):c.316G>A (p.Glu106Lys) rs141703710
NM_001849.3(COL6A2):c.333G>A (p.Pro111=) rs370531466
NM_001849.3(COL6A2):c.340G>A (p.Asp114Asn) rs969934621
NM_001849.3(COL6A2):c.344G>A (p.Arg115Gln) rs145352569
NM_001849.3(COL6A2):c.422T>C (p.Met141Thr)
NM_001849.3(COL6A2):c.426G>A (p.Thr142=) rs149480738
NM_001849.3(COL6A2):c.483C>T (p.Thr161=) rs138312213
NM_001849.3(COL6A2):c.487G>A (p.Gly163Ser) rs769456044
NM_001849.3(COL6A2):c.492C>T (p.His164=) rs140929054
NM_001849.3(COL6A2):c.499G>A (p.Gly167Ser) rs115957676
NM_001849.3(COL6A2):c.510C>T (p.Cys170=) rs142328765
NM_001849.3(COL6A2):c.511G>A (p.Gly171Arg) rs200710788
NM_001849.3(COL6A2):c.528G>A (p.Gln176=) rs377585812
NM_001849.3(COL6A2):c.544G>A (p.Glu182Lys)
NM_001849.3(COL6A2):c.557G>A (p.Arg186Gln)
NM_001849.3(COL6A2):c.581A>G (p.Gln194Arg) rs113509166
NM_001849.3(COL6A2):c.623C>T (p.Pro208Leu)
NM_001849.3(COL6A2):c.624G>A (p.Pro208=) rs146333253
NM_001849.3(COL6A2):c.628G>A (p.Glu210Lys) rs113017484
NM_001849.3(COL6A2):c.638G>A (p.Arg213His) rs368064647
NM_001849.3(COL6A2):c.641_645delACGAC (p.Asn214Ilefs) rs1375040481
NM_001849.3(COL6A2):c.643G>A (p.Asp215Asn) rs563449281
NM_001849.3(COL6A2):c.672C>T (p.Thr224=) rs759388890
NM_001849.3(COL6A2):c.679G>A (p.Asp227Asn) rs35881321
NM_001849.3(COL6A2):c.679G>C (p.Asp227His) rs35881321
NM_001849.3(COL6A2):c.697C>T (p.Arg233Cys) rs1379543505
NM_001849.3(COL6A2):c.698G>A (p.Arg233His) rs146742517
NM_001849.3(COL6A2):c.714+10G>A rs777394169
NM_001849.3(COL6A2):c.714+9C>T rs78822624
NM_001849.3(COL6A2):c.735+7G>A rs575365107
NM_001849.3(COL6A2):c.736-7_739delGTTTCAGTGCT rs1555872143
NM_001849.3(COL6A2):c.759A>G (p.Glu253=) rs140404854
NM_001849.3(COL6A2):c.785G>A (p.Gly262Asp) rs886042943
NM_001849.3(COL6A2):c.790C>T (p.Arg264Cys) rs760263812
NM_001849.3(COL6A2):c.791G>A (p.Arg264His) rs148029276
NM_001849.3(COL6A2):c.801+1G>A rs794727715
NM_001849.3(COL6A2):c.802-2A>G rs886044399
NM_001849.3(COL6A2):c.803G>A (p.Gly268Asp) rs397515333
NM_001849.3(COL6A2):c.811G>A (p.Gly271Ser) rs121912940
NM_001849.3(COL6A2):c.812G>A (p.Gly271Asp) rs794727788
NM_001849.3(COL6A2):c.812G>T (p.Gly271Val) rs794727788
NM_001849.3(COL6A2):c.81G>A (p.Ser27=) rs111639540
NM_001849.3(COL6A2):c.827C>T (p.Pro276Leu) rs757488307
NM_001849.3(COL6A2):c.828G>A (p.Pro276=) rs140790797
NM_001849.3(COL6A2):c.832G>A (p.Glu278Lys) rs61735835
NM_001849.3(COL6A2):c.838G>C (p.Gly280Arg) rs886043323
NM_001849.3(COL6A2):c.839G>A (p.Gly280Asp)
NM_001849.3(COL6A2):c.848G>A (p.Gly283Glu) rs886044088
NM_001849.3(COL6A2):c.856-2A>C rs886044466
NM_001849.3(COL6A2):c.857G>A (p.Gly286Glu) rs727502827
NM_001849.3(COL6A2):c.863C>T (p.Pro288Leu) rs745566911
NM_001849.3(COL6A2):c.865G>T (p.Gly289Cys) rs886043270
NM_001849.3(COL6A2):c.874G>C (p.Gly292Arg) rs727502828
NM_001849.3(COL6A2):c.875G>T (p.Gly292Val) rs794727855
NM_001849.3(COL6A2):c.881T>C (p.Ile294Thr)
NM_001849.3(COL6A2):c.900+1G>C rs886044261
NM_001849.3(COL6A2):c.911G>T (p.Gly304Val) rs727502832
NM_001849.3(COL6A2):c.942C>T (p.Ala314=) rs531713008
NM_001849.3(COL6A2):c.954G>T (p.Lys318Asn) rs878854362
NM_001849.3(COL6A2):c.955-1G>A rs886044265
NM_001849.3(COL6A2):c.978G>A (p.Lys326=) rs1480541163
NM_001849.3(COL6A2):c.981C>T (p.Asn327=) rs768836349
NM_001849.3(COL6A2):c.987C>T (p.Thr329=) rs748215430
NM_001849.3(COL6A2):c.988G>A (p.Asp330Asn) rs139399166
NM_001849.3(COL6A2):c.999+7G>A rs199783099
NM_058175.2(COL6A2):c.148G>A (p.Val50Met) rs727502826

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.