List of variants in gene MAGEL2 reported as likely benign by Genetic Services Laboratory, University of Chicago

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 15

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_019066.5(MAGEL2):c.3151C>A (p.Leu1051Ile)	rs2233070	0.03565
NM_019066.5(MAGEL2):c.2611G>T (p.Ala871Ser)	rs2233066	0.00969
NM_019066.5(MAGEL2):c.2612C>T (p.Ala871Val)	rs74004212	0.00969
NM_019066.5(MAGEL2):c.3229T>C (p.Leu1077=)	rs2233071	0.00936
NM_019066.5(MAGEL2):c.383T>C (p.Leu128Pro)	rs191559595	0.00841
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser)	rs138628273	0.00437
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu)	rs2233061	0.00353
NM_019066.5(MAGEL2):c.3690G>C (p.Glu1230Asp)	rs34875116	0.00083
NM_019066.5(MAGEL2):c.764C>T (p.Pro255Leu)	rs192154215	0.00006
NM_019066.5(MAGEL2):c.3273C>T (p.Asn1091=)	rs369033422	0.00003
NM_019066.5(MAGEL2):c.789T>C (p.Pro263=)	rs993057859	0.00001
NM_019066.5(MAGEL2):c.474_503del (p.160AHPPPPGTPM[1])	rs754729041
NM_019066.5(MAGEL2):c.579C>A (p.Pro193=)	rs113984257
NM_019066.5(MAGEL2):c.822A>T (p.Ser274=)	rs1555374395
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1])	rs528108868

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.