ClinVar Miner

List of variants reported as risk factor by OMIM

Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 900
Download table as spreadsheet
HGVS dbSNP
ADCY10, 1438+30T-C
ADCY10, 923C-T
AGT, -6A HAPLOTYPE
ALOX5, VARIANT PROMOTER SP1 BINDING
ANXA5, M2 HAPLOTYPE
AQP7, -953, A-G
ARMS2, 443-BP DEL/54-BP INS
ATXN2, (CAG)n EXPANSION, INTERMEDIATE
ATXN8, (CAG)n EXPANSION
CCG haplotype
CCL11, (GAAGGA)n
CD209, -336A-G
CD209, -871G-A
CD36, G1439C, 1-BP DEL, 1444A
CD46, 2-BP DEL, 843AC
CD46, 6-BP DEL
CDKN2A, -34G-T
CDKN2A, 6-BP DEL, NT363
CDKN2A, IVS1BDS, A-G, +1
CDKN2A, IVS2, A-G, -105
CHD8, 1-BP INS, T
CHD8, 2-BP DEL, CT
CHD8, 3-BP DEL, GGT
CHD8, 4-BP DEL, CTTC
CHEK2, 1-BP DEL, 1100C
CHEK2, IVS2DS, G-A, +1
CTRC, 24-BP DEL, NT738
CX3CR1:c.[841G>A;935C>T] (p.Val294Ile;Thr280Met)
CYP3A5, 6986A-G
DISC1, HAPLOTYPE, HEP3
DRD4, 120-BP INS
DRD5, (CA)n MARKER
DRD5, (CT/GT/GA)n
ECE1, -338C-A
ECE1, -839T-G
EIF4E, 1-BP INS, -25C
ENPP1, IVS20AS, 1-BP DEL, T, -11
ESR1, 594G-A
ESR1, IVS1, T-C, -401
F7, 10-BP INS, NT-323
FOXD3, -639G-T
GABABR2, HAPLOTYPE, TATA (rs1435252, rs3780422, rs2779562, rs3750344)
GCLC, -129C-T
GCLM, -588C-T
GNB3, 825C-T
GP1BA, 92-BP DUP, SER399-THR411 DUP, VARIABLE REPEATS
HLA-B*15:02
HLA-B*57:01
HLA-B, HLA-B*5801
HLA-B, HLA-B27
HLA-C, HLA-Cw6
HLA-DRB1, DRB1*1501
HLA-DRB1, HLA-DRB1*1101
HMGA1, 1-BP INS, IVS5, -13
HMOX1, (GT)n REPEAT
HS6ST1, ARG296GLN
HS6ST1, ARG296TRP
HS6ST1, ARG313GLN
HS6ST1, ARG372TRP
HS6ST1, MET394VAL
HTR2A, -1438G-A
HTR2A, 102T-C
IFNGR1, -56C-T
IL13, -1112C-T, PROMOTER
IL1RN, IVS2, 86-BP DUP
IL6, -174G-C
IRF5, 5-BP INS, PROMOTER REGION
ITIH4, IVS17, +8, C-T
LMNB2, TYR232HIS
LPL, -39T-C, PROMOTER
LPL, -93T-G, PROMOTER
MECP2, 41-BP DEL, NT1157
MIAT, HAPLOTYPE, TAAAAT
MIF, -173G-C
MMP3, -1171 5A/6A
MPO, -463G-A
Multiple alleles
NC_000001.10:g.(196722206_?)_(?_196808505)del
NC_000002.12:g.240603286C>T rs5030952
NC_000003.11:g.123774078T>G rs9289231
NC_000005.10:g.162537506_162537507insTGTTTACTAAACAAAAAGAAAGAGC rs587777363
NC_000006.12:g.31306603T>C rs9264942
NC_000020.11:g.7125642T>C rs1884302
NC_000022.10:g.(?_18893735)_(18924066_?)del
NC_000023.11:g.(155524633_155545096)_(155545276_155612791)del
NEK1, ARG261HIS
NFKBIL1, -62T-A
NG_011479.1:g.2846C>A rs3788853
NG_012123.1:g.2493A>G rs1024611
NM_000014.5(A2M):c.2126-6_2126-2del rs1799759
NM_000014.5(A2M):c.2998A>G (p.Ile1000Val) rs669
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000024.5(ADRB2):c.46A>G (p.Arg16Gly) rs1042713
NM_000025.3(ADRB3):c.190T>C (p.Trp64Arg) rs4994
NM_000029.4(AGT):c.803T>C (p.Met268Thr) rs699
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000041.3(APOE):c.-83-203T= rs405509
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000064.4(C3):c.1775G>A (p.Arg592Gln) rs121909583
NM_000064.4(C3):c.2562C>G (p.Tyr854Ter) rs121909586
NM_000064.4(C3):c.304C>G (p.Arg102Gly) rs2230199
NM_000064.4(C3):c.3281C>T (p.Ala1094Val) rs121909584
NM_000064.4(C3):c.3343G>A (p.Asp1115Asn) rs121909585
NM_000064.4(C3):c.463A>C (p.Lys155Gln) rs147859257
NM_000069.2(CACNA1S):c.-476G>A rs2281845
NM_000069.3(CACNA1S):c.258+57G>A rs1325310
NM_000069.3(CACNA1S):c.3257G>A (p.Arg1086His) rs1800559
NM_000069.3(CACNA1S):c.3414+67A>G rs28986463
NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000075.4(CDK4):c.71G>A (p.Arg24His) rs104894340
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.226_244del (p.Ala76fs) rs587776716
NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000077.4(CDKN2A):c.265G>A (p.Gly89Ser) rs137854597
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) rs387906410
NM_000077.4(CDKN2A):c.364G>C (p.Gly122Arg) rs113798404
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000098.2(CPT2):c.[1055T>G;1102G>A]
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000113.3(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000115.5(EDNRB):c.-51-949A>T rs267606780
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000131.4(F7):c.1238G>A (p.Arg413Gln) rs6046
NM_000139.5(MS4A2):c.710A>G (p.Glu237Gly) rs569108
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1444G>A (p.Asp482Asn) rs75671029
NM_000157.4(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_000163.5(GHR):c.1630A>C (p.Ile544Leu) rs6180
NM_000186.3(CFH):c.1204= (p.His402=) rs1061170
NM_000186.3(CFH):c.1419G>C (p.Ala473=) rs2274700
NM_000186.3(CFH):c.1507C>G (p.Pro503Ala) rs570523689
NM_000186.3(CFH):c.184G>A (p.Val62Ile) rs800292
NM_000186.3(CFH):c.2237-543= rs1410996
NM_000186.3(CFH):c.2697T>A (p.Tyr899Ter) rs121913057
NM_000186.3(CFH):c.3514G>T (p.Glu1172Ter) rs121913060
NM_000186.3(CFH):c.3566T>G (p.Leu1189Arg) rs121913055
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3592G>T (p.Glu1198Ter) rs121913063
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000186.3(CFH):c.3643C>G (p.Arg1215Gly) rs121913051
NM_000186.3(CFH):c.3677_*4del (p.Pro1226_Ter1232delinsXaa) rs796052136
NM_000186.3(CFH):c.83_86del (p.Arg28fs) rs796052137
NM_000201.3(ICAM1):c.167A>T (p.Lys56Met) rs5491
NM_000204.4(CFI):c.1234G>A (p.Val412Met) rs371432629
NM_000204.4(CFI):c.1420C>T (p.Arg474Ter) rs121964913
NM_000204.4(CFI):c.1555G>A (p.Asp519Asn) rs121964918
NM_000204.4(CFI):c.1571A>T (p.Asp524Val) rs121964914
NM_000204.4(CFI):c.1637G>A (p.Trp546Ter) rs121964915
NM_000204.4(CFI):c.355G>A (p.Gly119Arg) rs141853578
NM_000204.4(CFI):c.949C>T (p.Arg317Trp) rs121964917
NM_000209.4(PDX1):c.176A>T (p.Gln59Leu) rs137852784
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.4(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000209.4(PDX1):c.52T>C (p.Cys18Arg) rs137852785
NM_000209.4(PDX1):c.590G>A (p.Arg197His) rs137852786
NM_000212.2(ITGB3):c.176T>C (p.Leu59Pro) rs5918
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000224.3(KRT18):c.383A>T (p.His128Leu) rs57758506
NM_000236.2(LIPC):c.-293G>A rs2070895
NM_000237.3(LPL):c.106G>A (p.Asp36Asn) rs1801177
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) rs1346551029
NM_000246.3(CIITA):c.-286G= rs3087456
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000254.2(MTR):c.2756A>G (p.Asp919Gly) rs1805087
NM_000256.3(MYBPC3):c.3628-34_3628-10del rs397514444
NM_000311.5(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000335.4(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.4(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000361.2(THBD):c.1483C>T (p.Pro495Ser) rs1800578
NM_000361.2(THBD):c.158A>G (p.Asp53Gly) rs121918667
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000371.3(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000388.4(CASR):c.2693G>A (p.Arg898Gln) rs121909269
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000416.2(IFNGR1):c.260T>C (p.Ile87Thr) rs104893973
NM_000418.4(IL4R):c.1727A>G (p.Gln576Arg) rs1801275
NM_000439.5(PCSK1):c.661A>G (p.Asn221Asp) rs6232
NM_000446.7(PON1):c.163T>A (p.Leu55Met) rs854560
NM_000446.7(PON1):c.575A>G (p.Gln192Arg) rs662
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000506.4(F2):c.*97G>A rs1799963
NM_000514.4(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000514.4(GDNF):c.448G>A (p.Asp150Asn) rs76466003
NM_000514.4(GDNF):c.460A>T (p.Thr154Ser) rs104893891
NM_000514.4(GDNF):c.633C>G (p.Ile211Met) rs121918536
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000540.2(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.2(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.2(RYR1):c.14477C>T (p.Thr4826Ile) rs121918595
NM_000540.2(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.2(RYR1):c.1565A>C (p.Tyr522Ser) rs118192162
NM_000540.2(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.2(RYR1):c.487C>T (p.Arg163Cys) rs118192161
NM_000540.2(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.2(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.2(RYR1):c.6502G>A (p.Val2168Met) rs118192176
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.7039_7041GAG[1] (p.Glu2348del) rs121918596
NM_000540.2(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.2(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.2(RYR1):c.7373G>A (p.Arg2458His) rs121918594
NM_000540.2(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_000540.2(RYR1):c.[8026C>T;8360C>G]
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000545.6(HNF1A):c.955G>A (p.Gly319Ser) rs137853240
NM_000546.5(TP53):c.*1175A>C rs78378222
NM_000546.5(TP53):c.542G>T (p.Arg181Leu) rs397514495
NM_000550.3(TYRP1):c.497C>G (p.Ser166Ter) rs104894130
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000557.5(GDF5):c.-275= rs143383
NM_000576.2(IL1B):c.-118C>T rs1143627
NM_000578.4(SLC11A1):c.1627G>A (p.Asp543Asn) rs17235409
NM_000579.3(CCR5):c.554_585del (p.Ser185fs) rs333
NM_000594.3(TNF):c.-1037C>T rs1799724
NM_000603.5(NOS3):c.-51-762= rs2070744
NM_000603.5(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000619.2(IFNG):c.115-484_115-457CA[12] rs34079299
NM_000628.5(IL10RB):c.139A>G (p.Lys47Glu) rs2834167
NM_000636.4(SOD2):c.47T>C (p.Val16Ala) rs4880
NM_000639.2(FASLG):c.-157-687C= rs763110
NM_000660.7(TGFB1):c.29C>T (p.Pro10Leu) rs1800470
NM_000669.5(ADH1C):c.232G>T (p.Gly78Ter) rs283413
NM_000690.4(ALDH2):c.1510G>A (p.Glu504Lys) rs671
NM_000726.4(CACNB4):c.1444C>T (p.Arg482Ter) rs1805032
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000743.5(CHRNA3):c.645C>T (p.Tyr215=) rs1051730
NM_000745.3(CHRNA5):c.1192G>A (p.Asp398Asn) rs16969968
NM_000754.3(COMT):c.214G>T (p.Ala72Ser) rs6267
NM_000789.3(ACE):c.2306-117_2306-116insAF118569.1:g.14094_14382
NM_000796.5(DRD3):c.25G>A (p.Gly9Ser) rs6280
NM_000799.3(EPO):c.-1306C>A rs1617640
NM_000806.5(GABRA1):c.655G>A (p.Asp219Asn) rs587777364
NM_000807.4(GABRA2):c.188-4371A>T rs279836
NM_000807.4(GABRA2):c.255+4909A>T rs279845
NM_000807.4(GABRA2):c.704-104A>G rs279871
NM_000814.6(GABRB3):c.94G>A (p.Gly32Arg) rs71651682
NM_000815.5(GABRD):c.530A>C (p.Glu177Ala) rs121434580
NM_000815.5(GABRD):c.659G>A (p.Arg220His) rs41307846
NM_000902.4(MME):c.1265C>A (p.Ala422Asp) rs777476150
NM_000902.4(MME):c.467del (p.Pro156fs) rs749320057
NM_000902.4(MME):c.71G>A (p.Trp24Ter) rs886039755
NM_000903.3(NQO1):c.559C>T (p.Pro187Ser) rs1800566
NM_000927.4(ABCB1):c.2677T>G (p.Ser893Ala) rs2032582
NM_000939.4(POMC):c.706C>G (p.Arg236Gly) rs28932472
NM_001001331.4(ATP2B2):c.1891G>A (p.Val631Met) rs61736451
NM_001001547.3(CD36):c.975T>G (p.Tyr325Ter) rs3211938
NM_001002255.2(SUMO4):c.163G>A (p.Val55Met) rs237025
NM_001006658.2(CR2):c.[-71T>C;1776G>A1916G>A]
NM_001008212.2(OPTN):c.293T>A (p.Met98Lys) rs11258194
NM_001012267.3(CENPP):c.564+94884TCA[15]
NM_001025366.3(VEGFA):c.-94C>G rs2010963
NM_001031717.4(CRELD1):c.*165G>A rs121912627
NM_001031717.4(CRELD1):c.484C>G (p.Pro162Ala) rs121912626
NM_001031717.4(CRELD1):c.932C>T (p.Thr311Ile) rs28942092
NM_001031717.4(CRELD1):c.985C>T (p.Arg329Cys) rs28942091
NM_001039569.2(AP1S3):c.11T>G (p.Phe4Cys) rs116107386
NM_001039569.2(AP1S3):c.97C>T (p.Arg33Trp) rs138292988
NM_001039660.2(IL18BP):c.508-19_528del
NM_001045.6(SLC6A4):c.1273A>G (p.Ile425Val) rs28914832
NM_001060.5(TBXA2R):c.179G>T (p.Arg60Leu) rs34377097
NM_001060.5(TBXA2R):c.722T>G (p.Val241Gly) rs397514542
NM_001060.5(TBXA2R):c.910G>A (p.Asp304Asn) rs387906691
NM_001063.4(TF):c.1765C>T (p.Pro589Ser) rs1049296
NM_001065.3(TNFRSF1A):c.625+10A>G rs1800693
NM_001072.4(UGT1A6):c.862-10021T>G rs4124874
NM_001077525.3(MTMR14):c.1007G>A (p.Arg336Gln) rs121434509
NM_001077525.3(MTMR14):c.1385A>G (p.Tyr462Cys) rs121434510
NM_001080432.3(FTO):c.46-43098T>C rs1421085
NM_001080512.3(BICC1):c.259C>T (p.Gln87Ter) rs387907123
NM_001080512.3(BICC1):c.2795A>G (p.Glu932Gly) rs387907124
NM_001098486.2(SLC17A3):c.202A>C (p.Asn68His) rs387907257
NM_001098629.3(IRF5):c.*128T>C rs2070197
NM_001098629.3(IRF5):c.*555G>A rs10954213
NM_001099667.3(ARMS2):c.205G>T (p.Ala69Ser) rs10490924
NM_001110.4(ADAM10):c.510G>C (p.Gln170His)
NM_001110.4(ADAM10):c.541A>G (p.Arg181Gly) rs145518263
NM_001110792.2(MECP2):c.916C>T (p.Arg306Ter) rs61751362
NM_001122659.3(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_001122659.3(EDNRB):c.824G>A (p.Trp275Ter) rs104894389
NM_001122659.3(EDNRB):c.828G>T (p.Trp276Cys) rs104894387
NM_001122659.3(EDNRB):c.877dup (p.Tyr293fs) rs769735757
NM_001122659.3(EDNRB):c.914G>A (p.Ser305Asn) rs5352
NM_001127500.3(MET):c.3065_3082+9del rs869320706
NM_001127500.3(MET):c.3082+1G>T rs869320707
NM_001127644.2(GABRA1):c.965C>A (p.Ala322Asp) rs121434579
NM_001127644.2(GABRA1):c.975del (p.Ser326fs)
NM_001130065.2(MYO9B):c.4879-123G>A rs2305764
NM_001130969.1(NSMF):c.1132-23_1132-15del rs606231136
NM_001130969.1(NSMF):c.1438A>G (p.Thr480Ala) rs121918340
NM_001134771.2(SLC12A5):c.2924G>A (p.Arg975His) rs142740233
NM_001134771.2(SLC12A5):c.3214C>T (p.Arg1072Cys) rs548424453
NM_001141945.2(ACTA2):c.-24+1440C>T rs2234767
NM_001145466.1(NCR3):c.-412G>C rs2736191
NM_001145661.2(GATA2):c.1061C>T (p.Thr354Met) rs387906631
NM_001145661.2(GATA2):c.1065_1067del (p.Thr358del)
NM_001145775.2(FKBP5):c.106-2636= rs1360780
NM_001146274.2(TCF7L2):c.450+33966C>T rs7903146
NM_001146274.2(TCF7L2):c.552+7162G>C rs11196205
NM_001146274.2(TCF7L2):c.552+9017G>T rs12255372
NM_001159740.2(LTA):c.-10+62= rs2239704
NM_001159740.2(LTA):c.-9-198A>G rs909253
NM_001159740.2(LTA):c.179C>A (p.Thr60Asn) rs1041981
NM_001161352.2(KCNMA1):c.3158A>G (p.Asn1053Ser) rs886039469
NM_001166108.2(PALLD):c.1965-12616C>T rs121908291
NM_001166598.2(APOA5):c.*158C>T rs2266788
NM_001166598.2(APOA5):c.553G>T (p.Gly185Cys) rs2075291
NM_001166598.2(APOA5):c.56C>G (p.Ser19Trp) rs3135506
NM_001172813.2(SLC30A8):c.826C>T (p.Arg276Trp) rs13266634
NM_001194958.2(KCNJ18):c.1061C>T (p.Thr354Met) rs527236158
NM_001194958.2(KCNJ18):c.1097A>G (p.Lys366Arg) rs527236159
NM_001194958.2(KCNJ18):c.429del (p.Ile144fs) rs527236153
NM_001194958.2(KCNJ18):c.614G>A (p.Arg205His) rs672601244
NM_001195263.2(PDZD7):c.166dup (p.Arg56fs) rs587776894
NM_001199397.2(NEK1):c.1648C>T (p.Arg550Ter) rs371575563
NM_001199397.2(NEK1):c.2434A>T (p.Arg812Ter) rs749428135
NM_001242758.1(HLA-A):c.*66A>T rs1061235
NM_001243926.1(MAPKAPK3):c.-436A>T rs414171
NM_001256071.3(RNF213):c.12037G>A (p.Asp4013Asn) rs397514563
NM_001256071.3(RNF213):c.14429G>A (p.Arg4810Lys) rs112735431
NM_001256849.1(POLD1):c.1421T>C (p.Leu474Pro) rs587777627
NM_001256849.1(POLD1):c.1433G>A (p.Ser478Asn) rs397514632
NM_001256849.1(POLD1):c.980C>T (p.Pro327Leu) rs397514633
NM_001276.2(CHI3L1):c.-131C>G rs4950928
NM_001277059.1(ERCC6):c.-76C>G rs3793784
NM_001278293.3(ARL6):c.506G>C (p.Gly169Ala) rs104893679
NM_001304561.1(BTNL2):c.1078= (p.Ser360=) rs2076530
NM_001322101.2(CENPO):c.*693_*695AAG[2] rs750852737
NM_001322101.2(CENPO):c.*737del rs1553329804
NM_001330078.2(NRXN1):c.4291_4294dup (p.Gly1432fs) rs1558507406
NM_001351.4(DAZL):c.160A>G (p.Thr54Ala) rs121918346
NM_001362873.1(PPARA):c.484C>G (p.Leu162Val) rs1800206
NM_001366110.1(PAX4):c.133C>T (p.Arg45Trp) rs35155575
NM_001366110.1(PAX4):c.421C>T (p.Arg141Trp) rs2233578
NM_001463.4(FRZB):c.598C>T (p.Arg200Trp) rs288326
NM_001463.4(FRZB):c.970C>G (p.Arg324Gly) rs7775
NM_001571.6(IRF3):c.829G>A (p.Ala277Thr) rs143769046
NM_001571.6(IRF3):c.854G>A (p.Arg285Gln) rs750526659
NM_001709.5(BDNF):c.196G>A (p.Val66Met) rs6265
NM_001710.5(CFB):c.858C>G (p.Phe286Leu) rs117905900
NM_001710.5(CFB):c.967A>G (p.Lys323Glu) rs121909748
NM_001737.5(C9):c.499C>T (p.Pro167Ser) rs34882957
NM_001742.4(CALCR):c.1340T>C (p.Leu447Pro) rs1801197
NM_001818.4(AKR1C4):c.85-106G>T rs398122815
NM_001845.6(COL4A1):c.1055C>T (p.Pro352Leu) rs200786329
NM_001845.6(COL4A1):c.1612C>G (p.Arg538Gly) rs397514624
NM_001846.4(COL4A2):c.3368A>G (p.Glu1123Gly) rs117412802
NM_001846.4(COL4A2):c.3448C>A (p.Gln1150Lys) rs62621875
NM_001846.4(COL4A2):c.5068G>A (p.Ala1690Thr) rs201105747
NM_001853.4(COL9A3):c.307C>T (p.Arg103Trp) rs61734651
NM_001854.4(COL11A1):c.4603T>C (p.Ser1535Pro) rs1676486
NM_001875.5(CPS1):c.4196A>C (p.Asn1399Thr) rs121912594
NM_001943.5(DSG2):c.166G>A (p.Val56Met) rs121913013
NM_001946.4(DUSP6):c.1037C>T (p.Thr346Met) rs146089505
NM_001946.4(DUSP6):c.545C>T (p.Ser182Phe) rs139318648
NM_001979.6(EPHX2):c.860G>A (p.Arg287Gln) rs751141
NM_001982.3(ERBB3):c.4009G>A (p.Ala1337Thr) rs755855285
NM_001994.2(F13B):c.344G>A (p.Arg115His) rs6003
NM_002016.1(FLG):c.1501C>T (p.Arg501Ter) rs61816761
NM_002016.1(FLG):c.2278_2281CAGT[1] (p.Ser761fs) rs558269137
NM_002016.1(FLG):c.3321del (p.Gly1109fs) rs200519781
NM_002016.1(FLG):c.7661C>G (p.Ser2554Ter) rs121909626
NM_002087.3(GRN):c.*78C>T rs5848
NM_002121.6(HLA-DPB1):c.292A>G (p.Lys98Glu) rs1042140
NM_002188.3(IL13):c.431A>G (p.Gln144Arg) rs20541
NM_002253.3(KDR):c.1444T>C (p.Cys482Arg) rs34231037
NM_002273.4(KRT8):c.184G>T (p.Gly62Cys) rs11554495
NM_002381.5(MATN3):c.908C>T (p.Thr303Met) rs77245812
NM_002382.5(MAX):c.187del (p.Ile63fs) rs1566600827
NM_002382.5(MAX):c.1A>G (p.Met1Val) rs387906649
NM_002382.5(MAX):c.223C>T (p.Arg75Ter) rs387906650
NM_002382.5(MAX):c.295+1G>A rs786203385
NM_002382.5(MAX):c.97C>T (p.Arg33Ter) rs387906651
NM_002386.3(MC1R):c.252C>A (p.Asp84Glu) rs1805006
NM_002386.3(MC1R):c.437_439TCT[1] (p.Phe147del) rs1310082996
NM_002386.3(MC1R):c.451C>T (p.Arg151Cys) rs1805007
NM_002386.3(MC1R):c.470C>T (p.Thr157Ile) rs104894524
NM_002386.3(MC1R):c.475C>A (p.Pro159Thr) rs104894523
NM_002386.3(MC1R):c.478C>T (p.Arg160Trp) rs1805008
NM_002389.4(CD46):c.104G>A (p.Cys35Tyr) rs121909591
NM_002389.4(CD46):c.175C>T (p.Arg59Ter) rs121909590
NM_002389.4(CD46):c.718T>C (p.Ser240Pro) rs121909589
NM_002389.4(CD46):c.98-1G>C
NM_002392.5(MDM2):c.14+309T>G rs2279744
NM_002421.3(MMP1):c.-1673G=
NM_002438.4(MRC1):c.1186G>A (p.Gly396Ser) rs606231248
NM_002443.3(MSMB):c.-89T= rs10993994
NM_002447.4(MST1R):c.917G>A (p.Arg306His) rs200046052
NM_002454.3(MTRR):c.66A>G (p.Ile22Met) rs1801394
NM_002458.2(MUC5B):c.-3133G>T rs35705950
NM_002471.3(MYH6):c.2161C>T (p.Arg721Trp) rs387906656
NM_002485.4(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.4(NBN):c.657_661del (p.Lys219fs) rs587776650
NM_002543.4(OLR1):c.*188= rs12316150
NM_002543.4(OLR1):c.501G>C (p.Lys167Asn) rs11053646
NM_002658.5(PLAU):c.422C>T (p.Pro141Leu) rs2227564
NM_002711.4(PPP1R3A):c.2713G>T (p.Asp905Tyr) rs1799999
NM_002775.4(HTRA1):c.-625G>A rs11200638
NM_002791.3(PSMA6):c.-8C>G rs1048990
NM_002827.4(PTPN1):c.*104dup rs16989673
NM_002875.5(RAD51):c.-98G>C rs1801320
NM_002878.3(RAD51D):c.345G>C (p.Gln115His)
NM_002878.3(RAD51D):c.480+1G>A
NM_002878.3(RAD51D):c.556C>T (p.Arg186Ter) rs387906843
NM_002878.3(RAD51D):c.757C>T (p.Arg253Ter) rs137886232
NM_003079.5(SMARCE1):c.237+2T>C rs397509406
NM_003079.5(SMARCE1):c.311G>A (p.Trp104Ter) rs397509407
NM_003079.5(SMARCE1):c.572dup (p.Ala192fs) rs397509408
NM_003079.5(SMARCE1):c.715C>T (p.Arg239Ter) rs397509405
NM_003151.4(STAT4):c.274-23582= rs7574865
NM_003181.3(TBXT):c.1034+79C>T rs3127334
NM_003227.4(TFR2):c.1364G>A (p.Arg455Gln) rs41303501
NM_003235.4(TG):c.-1623A>G rs180195
NM_003235.5(TG):c.2200T>G (p.Ser734Ala) rs180223
NM_003235.5(TG):c.3082A>G (p.Met1028Val) rs853326
NM_003235.5(TG):c.5995C>T (p.Arg1999Trp) rs2076740
NM_003247.3(THBS2):c.1478-8C>T rs9406328
NM_003263.4(TLR1):c.743A>G (p.Asn248Ser) rs4833095
NM_003264.5(TLR2):c.2029C>T (p.Arg677Trp) rs121917864
NM_003264.5(TLR2):c.2258G>A (p.Arg753Gln) rs5743708
NM_003265.2(TLR3):c.1079T>C (p.Leu360Pro) rs768091235
NM_003265.2(TLR3):c.1660C>T (p.Pro554Ser) rs121434431
NM_003265.2(TLR3):c.2236G>T (p.Glu746Ter) rs1554064929
NM_003265.2(TLR3):c.2600G>A (p.Arg867Gln) rs199768900
NM_003265.2(TLR3):c.889C>G (p.Leu297Val) rs35311343
NM_003265.2(TLR3):c.[2228G>A;2432G>T]
NM_003268.6(TLR5):c.1174C>T (p.Arg392Ter) rs5744168
NM_003268.6(TLR5):c.1775A>G (p.Asn592Ser) rs2072493
NM_003355.2(UCP2):c.-1245G>A rs659366
NM_003613.4(CILP):c.1184T>C (p.Ile395Thr) rs2073711
NM_003647.2(DGKE):c.188G>C (p.Arg63Pro) rs312262694
NM_003647.3(DGKE):c.32C>A (p.Ser11Ter) rs148605410
NM_003647.3(DGKE):c.486dup (p.Val163fs) rs312262699
NM_003647.3(DGKE):c.818G>C (p.Arg273Pro) rs312262695
NM_003647.3(DGKE):c.966G>A (p.Trp322Ter) rs138924661
NM_003661.3(APOL1):c.[1024A>G;1152T>G]
NM_003749.3(IRS2):c.1939C>G (p.Leu647Val) rs137852740
NM_003749.3(IRS2):c.3170G>A (p.Gly1057Asp) rs1805097
NM_003867.4(FGF17):c.323T>C (p.Ile108Thr) rs398123024
NM_003924.3(PHOX2B):c.299G>T (p.Arg100Leu) rs104893855
NM_003924.3(PHOX2B):c.590G>A (p.Gly197Asp) rs104893856
NM_004001.4(FCGR2B):c.-386G>C rs3219018
NM_004001.4(FCGR2B):c.695T>C (p.Ile232Thr) rs1050501
NM_004036.5(ADCY3):c.1268del (p.Gly423fs) rs754914420
NM_004036.5(ADCY3):c.2433-1G>A rs1331776405
NM_004036.5(ADCY3):c.2578-1G>A rs1553333167
NM_004075.5(CRY1):c.1657+3A>C rs184039278
NM_004082.4(DCTN1):c.1712T>C (p.Met571Thr) rs121909343
NM_004082.4(DCTN1):c.2353C>T (p.Arg785Trp) rs121909344
NM_004082.4(DCTN1):c.3302G>A (p.Arg1101Lys) rs121909345
NM_004082.4(DCTN1):c.3746C>T (p.Thr1249Ile) rs72466496
NM_004132.5(HABP2):c.1601G>A (p.Gly534Glu) rs7080536
NM_004181.5(UCHL1):c.279C>G (p.Ile93Met) rs121917767
NM_004291.4(CARTPT):c.183G>C (p.Leu61Phe) rs121909065
NM_004304.5(ALK):c.3383G>C (p.Gly1128Ala) rs113994088
NM_004304.5(ALK):c.3452C>T (p.Thr1151Met) rs113994091
NM_004304.5(ALK):c.3575G>C (p.Arg1192Pro) rs113994089
NM_004304.5(ALK):c.3824G>A (p.Arg1275Gln) rs113994087
NM_004310.5(RHOH):c.114C>G (p.Tyr38Ter) rs773779601
NM_004360.4(CDH1):c.-124-161C>A rs16260
NM_004366.6(CLCN2):c.1730G>A (p.Arg577Gln) rs137852682
NM_004366.6(CLCN2):c.704G>A (p.Arg235Gln) rs71318369
NM_004442.7(EPHB2):c.*187A>T rs76826147
NM_004612.4(TGFBR1):c.1240C>T (p.Arg414Ter) rs387906697
NM_004612.4(TGFBR1):c.134A>G (p.Asn45Ser) rs387906696
NM_004612.4(TGFBR1):c.154G>C (p.Gly52Arg) rs587776865
NM_004612.4(TGFBR1):c.806-2A>C rs587776866
NM_004631.5(LRP8):c.2855G>A (p.Arg952Gln) rs5174
NM_004693.3(KRT75):c.481G>A (p.Ala161Thr) rs2232387
NM_004972.3(JAK2):c.1849G>T (p.Val617Phe) rs77375493
NM_004984.4(KIF5A):c.2993-3C>T rs1402429085
NM_004984.4(KIF5A):c.3019A>G (p.Arg1007Gly) rs1555179087
NM_004984.4(KIF5A):c.3020+1G>A rs1555179091
NM_004984.4(KIF5A):c.3020+2T>A rs1218712729
NM_004992.3(MECP2):c.1447G>T (p.Glu483Ter) rs587777421
NM_004993.5(ATXN3):c.892_894CAG(8_36) (p.Gln298_Gln305=) rs193922928
NM_005018.3(PDCD1):c.627+189G>C rs11568821
NM_005084.4(PLA2G7):c.1136T>C (p.Val379Ala) rs1051931
NM_005084.4(PLA2G7):c.593T>C (p.Ile198Thr) rs1805018
NM_005085.4(NUP214):c.112C>T (p.Arg38Cys)
NM_005085.4(NUP214):c.1159C>T (p.Pro387Ser) rs563025075
NM_005085.4(NUP214):c.1574del (p.Pro525fs) rs1210153519
NM_005085.4(NUP214):c.461A>G (p.Asp154Gly) rs1564175808
NM_005142.3(CBLIF):c.68A>G (p.Gln23Arg) rs35211634
NM_005214.5(CTLA4):c.*1148+236G>A rs3087243
NM_005214.5(CTLA4):c.49A>G (p.Thr17Ala) rs231775
NM_005223.3(DNASE1):c.13A>T (p.Lys5Ter) rs121912990
NM_005223.3(DNASE1):c.731G>A (p.Arg244Gln) rs1053874
NM_005373.2(MPL):c.117G>T (p.Lys39Asn) rs17292650
NM_005430.4(WNT1):c.652T>G (p.Cys218Gly) rs397514702
NM_005430.4(WNT1):c.703C>T (p.Arg235Trp) rs387907359
NM_005430.4(WNT1):c.859dup (p.His287fs) rs387907353
NM_005432.4(XRCC3):c.562-14A>G
NM_005432.4(XRCC3):c.722C>T (p.Thr241Met) rs861539
NM_005544.2(IRS1):c.2911G>A (p.Gly971Arg) rs1801278
NM_005576.4(LOXL1):c.1102+1976T>C rs2165241
NM_005576.4(LOXL1):c.422G>T (p.Arg141Leu) rs1048661
NM_005576.4(LOXL1):c.458G>A (p.Gly153Asp) rs3825942
NM_005585.5(SMAD6):c.1034del (p.Arg345fs) rs1085307122
NM_005585.5(SMAD6):c.1393C>T (p.Arg465Cys) rs761888345
NM_005585.5(SMAD6):c.667C>T (p.Gln223Ter) rs1064793003
NM_005612.5(REST):c.773_776del (p.Val258fs) rs869025311
NM_005612.5(REST):c.831_832del (p.Cys278fs) rs869025310
NM_005612.5(REST):c.965A>G (p.His322Arg) rs869025312
NM_005842.4(SPRY2):c.355C>T (p.Arg119Trp) rs869025336
NM_005904.3(SMAD7):c.743-5183= rs4939827
NM_005956.4(MTHFD1):c.1958G>A (p.Arg653Gln) rs2236225
NM_005956.4(MTHFD1):c.878G>A (p.Arg293His) rs34181110
NM_005957.4(MTHFR):c.1286A>C (p.Glu429Ala) rs1801131
NM_005959.3(MTNR1B):c.124G>C (p.Ala42Pro) rs387906779
NM_005959.3(MTNR1B):c.179T>G (p.Leu60Arg) rs141804752
NM_005959.3(MTNR1B):c.284C>T (p.Pro95Leu) rs182349376
NM_005959.3(MTNR1B):c.923A>C (p.Tyr308Ser) rs184917682
NM_006013.4(RPL10):c.616C>A (p.Leu206Met) rs387906727
NM_006013.4(RPL10):c.639C>G (p.His213Gln) rs782521991
NM_006080.3(SEMA3A):c.1303G>A (p.Val435Ile) rs147436181
NM_006208.3(ENPP1):c.*1043A>G rs7754561
NM_006208.3(ENPP1):c.517A>C (p.Lys173Gln) rs1044498
NM_006231.3(POLE):c.1270C>G (p.Leu424Val) rs483352909
NM_006255.4(PRKCH):c.1120G>A (p.Val374Ile) rs2230500
NM_006262.4(PRPH):c.421G>T (p.Asp141Tyr) rs58599399
NM_006267.5(RANBP2):c.1754C>T (p.Thr585Met) rs121434502
NM_006267.5(RANBP2):c.1958C>T (p.Thr653Ile) rs121434503
NM_006267.5(RANBP2):c.1966A>G (p.Ile656Val) rs121434504
NM_006384.4(CIB1):c.214C>T (p.Arg72Ter) rs143773090
NM_006384.4(CIB1):c.248_249del (p.Lys83fs) rs1323557941
NM_006384.4(CIB1):c.465+1dup rs1567068388
NM_006384.4(CIB1):c.52-2A>G rs1567069906
NM_006384.4(CIB1):c.548_549dup (p.Ala184fs) rs1351703532
NM_006416.5(SLC35A1):c.752-157_752-156insCTCA rs10638303
NM_006498.3(LGALS2):c.6+3279C>T
NM_006516.3(SLC2A1):c.1232A>G (p.Asn411Ser) rs398123069
NM_006516.3(SLC2A1):c.1372C>T (p.Arg458Trp) rs13306758
NM_006516.3(SLC2A1):c.668G>C (p.Arg223Pro) rs397514564
NM_006516.3(SLC2A1):c.694C>T (p.Arg232Cys) rs387907313
NM_006548.6(IGF2BP2):c.239+29254C>A rs4402960
NM_006895.3(HNMT):c.314C>T (p.Thr105Ile) rs11558538
NM_006914.4(RORB):c.1249_1251del (p.Thr417del) rs869312972
NM_006914.4(RORB):c.196C>T (p.Arg66Ter) rs1563959514
NM_006914.4(RORB):c.218T>C (p.Leu73Pro) rs869312971
NM_006920.6(SCN1A):c.603-91G>A rs3812718
NM_007122.5(USF1):c.*187C>T rs3737787
NM_007122.5(USF1):c.561-100G>A rs2073658
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961
NM_007199.3(IRAK3):c.227G>A (p.Trp76Ter) rs121912630
NM_007199.3(IRAK3):c.381+1G>T rs150116809
NM_007202.4(AKAP10):c.1936A>G (p.Ile646Val) rs203462
NM_007267.7(TMC6):c.1726G>T (p.Glu576Ter) rs121908328
NM_007267.7(TMC6):c.280C>T (p.Arg94Ter) rs121908327
NM_007267.7(TMC6):c.744C>A (p.Tyr248Ter) rs121908329
NM_007267.7(TMC6):c.892-2A>T rs769471844
NM_007272.3(CTRC):c.164G>A (p.Trp55Ter) rs121909294
NM_007272.3(CTRC):c.760C>T (p.Arg254Trp) rs121909293
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs80357906
NM_007294.3(BRCA1):c.66_67AG[1] (p.Glu23fs) rs80357914
NM_012186.3(FOXE3):c.410G>A (p.Gly137Asp) rs749960549
NM_012186.3(FOXE3):c.457G>C (p.Asp153His) rs367943249
NM_012224.3(NEK1):c.3023C>G (p.Ser1008Ter) rs199947197
NM_013247.4(HTRA2):c.421G>T (p.Ala141Ser) rs72470544
NM_013247.4(HTRA2):c.427C>G (p.Pro143Ala) rs387906942
NM_013254.4(TBK1):c.149A>C (p.Asp50Ala) rs1010930015
NM_013254.4(TBK1):c.476G>C (p.Gly159Ala) rs1555202947
NM_013254.4(TBK1):c.619A>G (p.Ile207Val) rs1555203557
NM_014141.6(CNTNAP2):c.208+18133A>T rs7794745
NM_014141.6(CNTNAP2):c.2099-26267A>G rs2710102
NM_014141.6(CNTNAP2):c.2606T>C (p.Ile869Thr) rs121908445
NM_014246.3(CELSR1):c.5050_5051TG[3] (p.Glu1685fs) rs786201015
NM_014246.3(CELSR1):c.5719_5720TG[2] (p.Val1908fs) rs786201016
NM_014625.3(NPHS2):c.686G>A (p.Arg229Gln) rs61747728
NM_014946.3(SPAST):c.131C>T (p.Ser44Leu) rs121908515
NM_014946.3(SPAST):c.134C>A (p.Pro45Gln) rs121908517
NM_015074.3(KIF1B):c.1937A>T (p.Glu646Val) rs121908161
NM_015074.3(KIF1B):c.2480C>T (p.Thr827Ile) rs121908162
NM_015074.3(KIF1B):c.3649C>T (p.Pro1217Ser) rs121908163
NM_015074.3(KIF1B):c.4442G>A (p.Ser1481Asn) rs121908164
NM_015272.5(RPGRIP1L):c.685G>A (p.Ala229Thr) rs61747071
NM_015450.3(POT1):c.1348G>T (p.Glu450Ter) rs797045169
NM_015450.3(POT1):c.1687-1G>A rs587777473
NM_015450.3(POT1):c.1851_1852del (p.Asp617fs) rs758673417
NM_015450.3(POT1):c.1869G>C (p.Gln623His) rs587777478
NM_015450.3(POT1):c.266A>G (p.Tyr89Cys) rs587777472
NM_015450.3(POT1):c.280C>G (p.Gln94Glu) rs587777474
NM_015450.3(POT1):c.283G>T (p.Gly95Cys) rs797045168
NM_015450.3(POT1):c.410G>A (p.Arg137His) rs587777475
NM_015450.3(POT1):c.670G>A (p.Asp224Asn) rs202187871
NM_015450.3(POT1):c.809G>A (p.Ser270Asn) rs587777477
NM_015450.3(POT1):c.818G>T (p.Arg273Leu) rs587777476
NM_015560.2(OPA1):c.[870+32T>C;870+4T=]
NM_015575.4(GIGYF2):c.1262A>G (p.Lys421Arg) rs115735611
NM_015575.4(GIGYF2):c.1370A>C (p.Asn457Thr) rs116074753
NM_015575.4(GIGYF2):c.167A>G (p.Asn56Ser) rs72554080
NM_015575.4(GIGYF2):c.1818C>G (p.Asp606Glu) rs118203903
NM_015575.4(GIGYF2):c.832A>G (p.Ile278Val) rs118203904
NM_015697.8(COQ2):c.1028T>C (p.Val343Ala) rs397514727
NM_015697.8(COQ2):c.1159C>T (p.Arg387Ter) rs751185256
NM_015697.8(COQ2):c.1160G>A (p.Arg387Gln) rs763562410
NM_015697.8(COQ2):c.382A>G (p.Met128Val) rs778094136
NM_015850.4(FGFR1):c.1964_1965del (p.Thr655fs)
NM_015850.4(FGFR1):c.1990T>A (p.Trp664Arg)
NM_015850.4(FGFR1):c.930G>A (p.Lys310=)
NM_015910.7(WDPCP):c.164G>A (p.Arg55Lys) rs267606693
NM_015910.7(WDPCP):c.624G>C (p.Leu208Phe) rs267606692
NM_015935.5(EEF1AKNMT):c.1631G>A (p.Arg544Gln)
NM_015937.6(PIGT):c.1401-2A>G rs587777028
NM_015967.6(PTPN22):c.-1123C>G rs2488457
NM_015967.7(PTPN22):c.1858C>T (p.Arg620Trp) rs2476601
NM_016038.4(SBDS):c.258+2T>C rs113993993
NM_016169.3(SUFU):c.367C>T (p.Arg123Cys) rs202247756
NM_016222.4(DDX41):c.1187T>C (p.Ile396Thr) rs747072227
NM_016222.4(DDX41):c.1574G>A (p.Arg525His) rs869312828
NM_016222.4(DDX41):c.3G>A (p.Met1Ile) rs141601766
NM_016222.4(DDX41):c.415_418dup (p.Asp140delinsGlyTer) rs762890562
NM_016222.4(DDX41):c.435-2_435-1delinsCA rs869320762
NM_016222.4(DDX41):c.490C>T (p.Arg164Trp) rs142143752
NM_016335.5(PRODH):c.1292G>A (p.Arg431His) rs2904552
NM_016335.5(PRODH):c.1322T>C (p.Leu441Pro) rs2904551
NM_016335.5(PRODH):c.1357C>T (p.Arg453Cys) rs3970559
NM_016335.5(PRODH):c.1363G>T (p.Ala455Ser) rs1807467
NM_016335.5(PRODH):c.1397C>T (p.Thr466Met) rs2870984
NM_016335.5(PRODH):c.1562= (p.Arg521=) rs450046
NM_016335.5(PRODH):c.865T>A (p.Leu289Met) rs137852934
NM_016362.5(GHRL):c.152G>A (p.Arg51Gln) rs34911341
NM_016362.5(GHRL):c.214C>A (p.Leu72Met) rs696217
NM_016362.5(GHRL):c.269A>T (p.Gln90Leu) rs4684677
NM_016382.4(CD244):c.834+526A>G rs3766379
NM_016511.4(CLEC1A):c.77G>C (p.Gly26Ala)
NM_016513.4(CILK1):c.1843G>A (p.Ala615Thr) rs55932059
NM_016513.4(CILK1):c.1894C>T (p.Arg632Ter) rs376111440
NM_016513.4(CILK1):c.658A>G (p.Lys220Glu) rs1554169267
NM_016513.4(CILK1):c.914A>C (p.Lys305Thr) rs765078446
NM_016734.3(PAX5):c.547G>A (p.Gly183Ser) rs398123063
NM_016835.4(MAPT):c.1835_1837ATA[1] (p.Asn613del) rs63751392
NM_016945.3(TAS2R16):c.516T>G (p.Asn172Lys) rs846664
NM_017411.3(SMN2):c.859G>C (p.Gly287Arg) rs121909192
NM_017563.5(IL17RD):c.1136A>G (p.Tyr379Cys) rs369641068
NM_017563.5(IL17RD):c.2204C>T (p.Ala735Val) rs587776979
NM_017672.6(TRPM7):c.4445C>T (p.Thr1482Ile) rs8042919
NM_017849.3(TMEM127):c.149dup (p.Pro51fs) rs121908817
NM_017849.3(TMEM127):c.245-1G>T rs121908821
NM_017849.3(TMEM127):c.410-2A>C rs121908826
NM_017849.3(TMEM127):c.475C>T (p.Gln159Ter) rs121908830
NM_018006.5(TRMU):c.28G>T (p.Ala10Ser) rs11090865
NM_018100.3(EFHC1):c.[229C>A;662G>A]
NM_018100.4(EFHC1):c.520A>G (p.Ile174Val) rs137852779
NM_018100.4(EFHC1):c.628G>A (p.Asp210Asn) rs137852777
NM_018100.4(EFHC1):c.685T>C (p.Phe229Leu) rs137852776
NM_018100.4(EFHC1):c.757G>T (p.Asp253Tyr) rs137852778
NM_018100.4(EFHC1):c.776G>A (p.Cys259Tyr) rs137852780
NM_018100.4(EFHC1):c.883C>T (p.Gln295Ter) rs137852781
NM_018196.4(TMLHE):c.1107G>T (p.Glu369Asp) rs782001959
NM_018196.4(TMLHE):c.229C>T (p.Arg77Ter) rs781889971
NM_018196.4(TMLHE):c.730G>C (p.Asp244His) rs869320708
NM_018196.4(TMLHE):c.959_960AT[1] (p.Ile321fs) rs782624357
NM_018977.4(NLGN3):c.1351C>T (p.Arg451Cys) rs121917893
NM_019112.3(ABCA7):c.2126_2131del (p.Glu709_Gln710del) rs1555685376
NM_019112.3(ABCA7):c.3641G>A (p.Trp1214Ter) rs201060968
NM_019888.3(MC3R):c.437T>A (p.Ile146Asn) rs74315393
NM_019888.3(MC3R):c.893T>G (p.Ile298Ser) rs121913556
NM_020335.3(VANGL2):c.1057C>T (p.Arg353Cys) rs267607167
NM_020335.3(VANGL2):c.1310T>C (p.Phe437Ser) rs267607168
NM_020647.4(JPH1):c.638G>C (p.Arg213Pro) rs201314759
NM_020762.4(SRGAP1):c.1849C>T (p.Arg617Cys) rs114817817
NM_020920.4(CHD8):c.2682-2A>G
NM_020920.4(CHD8):c.2875C>T (p.Gln959Ter) rs397514551
NM_020920.4(CHD8):c.3172C>T (p.Arg1058Ter) rs397514552
NM_020920.4(CHD8):c.6+352C>G rs1331026006
NM_020975.6(RET):c.1179C>A (p.Phe393Leu) rs78098482
NM_020975.6(RET):c.135= (p.Ala45=) rs1800858
NM_020975.6(RET):c.191C>T (p.Pro64Leu) rs77596424
NM_020975.6(RET):c.1941C>T (p.Ile647=) rs75225191
NM_020975.6(RET):c.2293T>C (p.Ser765Pro) rs75075748
NM_020975.6(RET):c.2690G>A (p.Arg897Gln) rs76087194
NM_020975.6(RET):c.2914A>G (p.Arg972Gly) rs76534745
NM_020975.6(RET):c.2944C>T (p.Arg982Cys) rs17158558
NM_020975.6(RET):c.406G>T (p.Glu136Ter) rs79014735
NM_020975.6(RET):c.538C>T (p.Arg180Ter) rs76449634
NM_020975.6(RET):c.692G>A (p.Arg231His) rs79661516
NM_020975.6(RET):c.73+9277T>C rs2435357
NM_020975.6(RET):c.938G>A (p.Arg313Gln) rs77702891
NM_020975.6(RET):c.95C>T (p.Ser32Leu) rs76764689
NM_020975.6(RET):c.989G>A (p.Arg330Gln) rs80236571
NM_021034.3(IFITM3):c.42T>C (p.Ser14=) rs12252
NM_021076.4(NEFH):c.2015_2056CAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG[1] (p.672_685AEAKSPEKAKSPVK[1]) rs606231212
NM_021098.2(CACNA1H):c.[2318G>A;2362C>T]
NM_021098.3(CACNA1H):c.1853C>T (p.Pro618Leu) rs60734921
NM_021098.3(CACNA1H):c.2491G>A (p.Val831Met) rs119454949
NM_021098.3(CACNA1H):c.2626G>A (p.Ala876Thr) rs58173258
NM_021098.3(CACNA1H):c.483C>A (p.Phe161Leu) rs119454947
NM_021098.3(CACNA1H):c.844G>A (p.Glu282Lys) rs119454948
NM_021133.4(RNASEL):c.1385G>A (p.Arg462Gln) rs486907
NM_021175.4(HAMP):c.212G>A (p.Gly71Asp) rs104894696
NM_021642.4(FCGR2A):c.497A>G (p.His166Arg) rs1801274
NM_021871.4(FGA):c.991A>G (p.Thr331Ala) rs6050
NM_021912.5(GABRB3):c.31C>T (p.Pro11Ser) rs25409
NM_021912.5(GABRB3):c.44C>T (p.Ser15Phe) rs121913126
NM_021926.4(ALX4):c.19G>T (p.Val7Phe) rs281865153
NM_021926.4(ALX4):c.631A>G (p.Lys211Glu) rs281865154
NM_022162.3(NOD2):c.2104C>T (p.Arg702Trp) rs2066844
NM_022162.3(NOD2):c.2722G>C (p.Gly908Arg) rs2066845
NM_022162.3(NOD2):c.2798+158C>T rs5743289
NM_022162.3(NOD2):c.3019dup (p.Leu1007fs) rs2066847
NM_022166.4(XYLT1):c.343G>T (p.Ala115Ser) rs61758388
NM_022167.4(XYLT2):c.2402C>G (p.Thr801Arg) rs6504649
NM_023004.6(RTN4R):c.355C>T (p.Arg119Trp) rs74315508
NM_023004.6(RTN4R):c.587G>A (p.Arg196His) rs74315509
NM_023083.4(CAPN10):c.471-176G>A rs3792267
NM_023083.4(CAPN10):c.471-187T>C rs2975760
NM_023083.4(CAPN10):c.997+136_998-148dup rs3842570
NM_023110.2(FGFR1):c.1025T>C (p.Leu342Ser) rs121909638
NM_023110.2(FGFR1):c.1042G>A (p.Gly348Arg) rs886037634
NM_023110.2(FGFR1):c.1097C>T (p.Pro366Leu) rs121909641
NM_023110.2(FGFR1):c.1317_1318del (p.Val441fs) rs587776835
NM_023110.2(FGFR1):c.1409G>T (p.Arg470Leu) rs121909637
NM_023110.2(FGFR1):c.1447C>A (p.Pro483Thr) rs397515444
NM_023110.2(FGFR1):c.1819G>A (p.Val607Met) rs121909629
NM_023110.2(FGFR1):c.1825C>T (p.Arg609Ter) rs121909639
NM_023110.2(FGFR1):c.1864C>T (p.Arg622Ter) rs121909628
NM_023110.2(FGFR1):c.2008G>A (p.Glu670Lys) rs397515446
NM_023110.2(FGFR1):c.2075A>G (p.Glu692Gly) rs397515445
NM_023110.2(FGFR1):c.2302G>T (p.Asp768Tyr) rs121909644
NM_023110.2(FGFR1):c.709G>A (p.Gly237Ser) rs121909635
NM_023110.2(FGFR1):c.749G>A (p.Arg250Gln) rs121909645
NM_023110.2(FGFR1):c.[2165C>A;2172C>G]
NM_024296.4(CCDC28B):c.330C>T (p.Phe110=) rs41263993
NM_024642.5(GALNT12):c.1185C>G (p.Tyr395Ter)
NM_024642.5(GALNT12):c.1472C>T (p.Thr491Met) rs267606840
NM_024642.5(GALNT12):c.3G>A (p.Met1Ile) rs267606839
NM_024675.3(PALB2):c.1027C>T (p.Gln343Ter) rs180177097
NM_024675.3(PALB2):c.1592del (p.Leu531fs) rs180177102
NM_024675.3(PALB2):c.172_175delTTGT rs180177143
NM_024675.3(PALB2):c.2323C>T (p.Gln775Ter) rs180177111
NM_024675.3(PALB2):c.2962C>T (p.Gln988Ter) rs118203999
NM_024675.3(PALB2):c.3113G>A (p.Trp1038Ter) rs180177132
NM_024675.3(PALB2):c.3116del (p.Asn1039fs) rs180177133
NM_024675.3(PALB2):c.3256C>T (p.Arg1086Ter) rs587776527
NM_024675.3(PALB2):c.3549C>G (p.Tyr1183Ter) rs118203998
NM_025129.5(FUZ):c.1060G>T (p.Asp354Tyr) rs139365610
NM_025129.5(FUZ):c.115C>T (p.Pro39Ser) rs387907204
NM_025129.5(FUZ):c.1211G>A (p.Arg404Gln) rs137955120
NM_025194.3(ITPKC):c.1155+9G>C rs28493229
NM_030803.7(ATG16L1):c.898A>G (p.Thr300Ala) rs2241880
NM_030930.4(UNC93B1):c.781G>A (p.Gly261Ser)
NM_030964.4(SPRY4):c.722C>A (p.Ser241Tyr) rs139512218
NM_031850.3(AGTR1):c.*86A>C rs5186
NM_031935.3(HMCN1):c.16034A>G (p.Gln5345Arg) rs121434382
NM_032208.2(ANTXR1):c.976G>A (p.Ala326Thr) rs119475040
NM_032409.3(PINK1):c.1291T>C (p.Tyr431His) rs74315361
NM_032551.5(KISS1R):c.581C>A (p.Ala194Asp) rs397514699
NM_032603.5(LOXL3):c.*908C>T rs72470545
NM_032737.4(LMNB2):c.1279G>A (p.Ala427Thr) rs57521499
NM_032737.4(LMNB2):c.265-6C>T rs267607650
NM_032737.4(LMNB2):c.704G>A (p.Arg235Gln) rs121912497
NM_032782.5(HAVCR2):c.245A>G (p.Tyr82Cys) rs184868814
NM_032782.5(HAVCR2):c.291A>G (p.Ile97Met) rs35960726
NM_032782.5(HAVCR2):c.302C>T (p.Thr101Ile) rs147827860
NM_032834.4(ALG10):c.1339G>A (p.Val447Ile) rs121908850
NM_033004.4(NLRP1):c.464T>A (p.Leu155His) rs12150220
NM_033337.2(CAV3):c.290T>G (p.Phe97Cys) rs104893714
NM_033629.6(TREX1):c.341G>A (p.Arg114His) rs72556554
NM_053056.2(CCND1):c.723G>A (p.Pro241=) rs9344
NM_058195.3(CDKN2A):c.161G>A (p.Arg54His)
NM_058195.3(CDKN2A):c.184_186AGA[3] (p.Arg63dup) rs1563902635
NM_058216.3(RAD51C):c.230del (p.Gly77fs) rs1057519355
NM_058216.3(RAD51C):c.374G>T (p.Gly125Val) rs267606998
NM_058216.3(RAD51C):c.397C>T (p.Gln133Ter) rs387907159
NM_058216.3(RAD51C):c.414G>C (p.Leu138Phe) rs267606999
NM_058216.3(RAD51C):c.837+1G>A rs760235677
NM_058216.3(RAD51C):c.904+5G>T rs587782702
NM_058216.3(RAD51C):c.93del (p.Phe32fs) rs730881942
NM_130810.4(DNAAF4):c.-3G>A rs3743205
NM_130810.4(DNAAF4):c.1249G>T (p.Glu417Ter) rs57809907
NM_138409.4(MRAP2):c.70G>T (p.Glu24Ter) rs587777046
NM_138712.3(PPARG):c.34C>G (p.Pro12Ala) rs1805192
NM_138959.3(VANGL1):c.542G>A (p.Arg181Gln) rs761123443
NM_138959.3(VANGL1):c.821G>A (p.Arg274Gln) rs121918219
NM_138959.3(VANGL1):c.983T>C (p.Met328Thr) rs121918220
NM_144605.5(SEPTIN12):c.266C>T (p.Thr89Met) rs199696526
NM_144605.5(SEPTIN12):c.474G>A (p.Val158=)
NM_144605.5(SEPTIN12):c.589G>A (p.Asp197Asn) rs371195126
NM_144670.6(A2ML1):c.2478_2485dup (p.Ser829fs) rs863224951
NM_144687.3(NLRP12):c.1206C>G (p.Phe402Leu) rs34971363
NM_144696.6(AXDND1):c.3032-1904C>T rs200482683
NM_145343.2(APOL1):c.1212_1217del (p.Asn404_Tyr405del) rs71785313
NM_145725.2(TRAF3):c.352C>T (p.Arg118Trp) rs143813189
NM_147686.4(TRAF3IP2):c.28G>A (p.Asp10Asn) rs33980500
NM_152468.4(TMC8):c.1084G>T (p.Glu362Ter) rs121908330
NM_152468.4(TMC8):c.1127+1G>C rs1567799639
NM_152709.5(STOX1):c.457T>C (p.Tyr153His) rs1341667
NM_153704.5(TMEM67):c.958A>T (p.Ser320Cys) rs111619594
NM_153758.3(IL19):c.-35+1984T>G rs1800872
NM_170601.5(SIAE):c.1211T>C (p.Phe404Ser) rs201877149
NM_170601.5(SIAE):c.265A>G (p.Met89Val) rs78778622
NM_170601.5(SIAE):c.587G>T (p.Cys196Phe) rs143070599
NM_170601.5(SIAE):c.935C>T (p.Thr312Met) rs144510878
NM_170784.2(MKKS):c.973A>C (p.Thr325Pro) rs137853156
NM_172056.2(KCNH2):c.2350C>T (p.Arg784Trp) rs12720441
NM_172201.1(KCNE2):c.25C>G (p.Gln9Glu) rs16991652
NM_173353.4(TPH2):c.1322G>A (p.Arg441His) rs120074175
NM_173353.4(TPH2):c.616C>T (p.Pro206Ser) rs17110563
NM_173353.4(TPH2):c.907C>T (p.Arg303Trp) rs120074176
NM_173495.3(PTCHD1):c.1444del (p.Leu482fs) rs878854361
NM_173495.3(PTCHD1):c.1796dup (p.Asn599fs) rs879255587
NM_173495.3(PTCHD1):c.2128del (p.Leu710fs) rs878854360
NM_173653.4(SLC9A9):c.1267C>T (p.Arg423Ter) rs121912597
NM_176801.2(ADD1):c.1378G>T (p.Gly460Trp) rs4961
NM_178857.6(RP1L1):c.133C>T (p.Arg45Trp) rs267607017
NM_181332.3(NLGN4X):c.1185dup (p.Asp396Ter) rs1569118853
NM_181332.3(NLGN4X):c.1252_1253GA[1] (p.Glu418fs) rs1569118680
NM_181745.4(FFAR4):c.809G>A (p.Arg270His) rs116454156
NM_181798.1(KCNQ1):c.1366C>T (p.Arg456Cys) rs17221854
NM_181840.1(KCNK18):c.410_411CT[2] (p.Phe139fs) rs869025175
NM_182919.3(TICAM1):c.1702G>A (p.Ala568Thr) rs143679494
NM_182919.3(TICAM1):c.421C>T (p.Arg141Ter) rs387907307
NM_182919.3(TICAM1):c.557C>T (p.Ser186Leu) rs146550489
NM_182919.3(TICAM1):c.749C>T (p.Pro250Leu) rs1555730283
NM_197948.3(CLEC7A):c.*25T>G rs16910526
NM_198241.3(EIF4G1):c.1505C>T (p.Ala502Val) rs111290936
NM_198241.3(EIF4G1):c.3614G>A (p.Arg1205His) rs112176450
NM_198253.2(TERT):c.3184G>A (p.Ala1062Thr) rs35719940
NM_198391.3(FLRT3):c.205C>A (p.Gln69Lys) rs398124653
NM_198391.3(FLRT3):c.290A>G (p.Glu97Gly) rs398124651
NM_198391.3(FLRT3):c.431G>T (p.Ser144Ile) rs398124652
NM_198433.3(AURKA):c.91T>A (p.Phe31Ile) rs2273535
NM_198578.4(LRRK2):c.7153G>A (p.Gly2385Arg) rs34778348
NM_198903.2(GABRG2):c.245G>A (p.Arg82Gln) rs121909673
NM_198903.2(GABRG2):c.889+2T>G rs1561645243
NM_199451.3(ZNF365):c.1130-972= rs7076156
NM_207034.3(EDN3):c.262dup (p.Ala88fs) rs1568823467
NM_207034.3(EDN3):c.49G>A (p.Ala17Thr) rs11570255
NM_207034.3(EDN3):c.670G>A (p.Ala224Thr) rs11570351
NM_207172.2(NPSR1):c.320A>T (p.Asn107Ile) rs324981
NM_207585.2(IFNAR2):c.23T>C (p.Phe8Ser) rs2229207
NP_002964.3:p.Gln166(>=33)
NR_034061.1(CASP12):n.629T= rs497116
PALB2:c.2515-1G>T rs587776417
PDX1, 3-BP INS, 243CCG
PHB:c.*729C>T rs112294663
PPP1R17, -1323T-C
PRPH, 1-BP DEL, 228C
PTGDR, HAPLOTYPE CCC
PTGDR, HAPLOTYPE TCT
PTGER2, G-A POLYMORPHISM
PTPRC, 77C-G
RAD51D, 1-BP DEL, 363A
RAD51D, TRP268TER
RET, 1-BP DEL, G1120
RETN, +62G-A
RIL, -3333T-C
RNF213, ARG4859LYS
RORB, 52-KB DEL
SCGB3A2, -112G/A
SEMA3A, 14-BP DEL, NT1613
SEMA3A, 213-KB DEL
SHANK2, 120-KB DEL
SHANK2, 69-KB DEL
SHANK2, ARG462TER
SLC11A1, 274C-T
SLC22A4, IVS1, T-C
TBP, (CAG)n EXPANSION
TBX21, -1993T-C
TERT, -57, T-G
TLR2, IVS2, GT(n) REPEAT POLYMORPHISM
TMC8, 1-BP DEL, 754T
TNF, -308G-A
TNF, -376G-A
UNC93B1, 4-BP DEL, 1034CTTT
XBP1, -116C-G
ZFAT1, IVS9, A-T
m.12397A>G rs1556424100
m.14319T>C rs199476110
m.15497G>A rs199951903
m.15950G>A rs118203890
m.15965A>G rs199474700
m.8393C>T rs1556423442
nsv513775
nsv513783

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.