ClinVar Miner

List of variants in gene NEFH reported by Epithelial Biology; Institute of Medical Biology, Singapore

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 21
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_021076.4(NEFH):c.2784A>G (p.Val928=) rs165625 0.80626
NM_021076.4(NEFH):c.1844C>T (p.Pro615Leu) rs5763269 0.19153
NM_021076.4(NEFH):c.2414A>C (p.Glu805Ala) rs165602 0.14527
NM_021076.4(NEFH):c.1387G>A (p.Glu463Lys) rs59371099 0.06827
NM_021076.4(NEFH):c.745G>A (p.Gly249Ser) rs60825978 0.00590
NM_021076.4(NEFH):c.2368_2370del (p.Lys790del) rs59551486 0.00091
NM_021076.4(NEFH):c.269C>T (p.Ala90Val) rs61556467 0.00030
NM_021076.4(NEFH):c.1138G>A (p.Ala380Thr) rs201416955 0.00025
NM_021076.4(NEFH):c.1629A>G (p.Glu543=) rs58971806 0.00003
NM_021076.4(NEFH):c.1054C>A (p.Arg352Ser) rs149955255
NM_021076.4(NEFH):c.1203T>C (p.Ala401=) rs267607674
NM_021076.4(NEFH):c.1375G>A (p.Glu459Lys) rs59297913
NM_021076.4(NEFH):c.1554A>C (p.Ser518=) rs58260068
NM_021076.4(NEFH):c.1836A>C (p.Ala612=) rs58554387
NM_021076.4(NEFH):c.1878A>C (p.Ala626=) rs58779095
NM_021076.4(NEFH):c.1965_1988del (p.Glu658_Lys665del) rs267607533
NM_021076.4(NEFH):c.1989_2006del (p.Glu664_Pro669del) rs267607534
NM_021076.4(NEFH):c.2015CAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG[1] (p.672AEAKSPEKAKSPVK[1]) rs606231212
NM_021076.4(NEFH):c.2232_2249del (p.746_751SPEKAK[1]) rs59890097
NM_021076.4(NEFH):c.2234A>T (p.Lys745Met) rs57188573
NM_021076.4(NEFH):c.472C>T (p.Leu158=) rs61056527

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.