ClinVar Miner

List of variants in gene TTN reported as uncertain significance by Genomic Research Center, Shahid Beheshti University of Medical Sciences

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 14
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990 0.00032
NM_001267550.2(TTN):c.42851G>A (p.Arg14284His) rs368572799 0.00004
NM_001267550.2(TTN):c.46771T>C (p.Tyr15591His) rs775496863 0.00001
NM_001267550.2(TTN):c.57970C>T (p.Arg19324Trp) rs1203435642 0.00001
NM_001267550.2(TTN):c.106925G>A (p.Gly35642Asp) rs1553480410
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.23633A>T (p.Glu7878Val) rs1553906392
NM_001267550.2(TTN):c.31643C>T (p.Pro10548Leu) rs753460621
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[3] (p.11363VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.39379+2T>G rs1560102141
NM_001267550.2(TTN):c.69328T>C (p.Tyr23110His) rs1553616495
NM_001267550.2(TTN):c.91363G>A (p.Val30455Met) rs766444853
NM_001267550.2(TTN):c.94906G>A (p.Asp31636Asn) rs776793953
NM_133379.5(TTN):c.11016T>A (p.Tyr3672Ter) rs762962308

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.