ClinVar Miner

List of variants in gene LDB3 reported by Stanford Center for Inherited Cardiovascular Disease, Stanford University

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 9
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619 0.00082
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699 0.00049
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566 0.00026
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007 0.00018
NM_007078.3(LDB3):c.1381T>G (p.Tyr461Asp) rs145655904 0.00002
NM_007078.3(LDB3):c.656G>A (p.Arg219Gln) rs530979771 0.00002
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148 0.00001
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.23C>A (p.Thr8Asn) rs1060501317

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.