ClinVar Miner

List of variants reported as likely pathogenic by Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics

Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 73
Download table as spreadsheet
HGVS dbSNP
NG_029832.1(RNU4ATAC):g.[5030G>A];[5040C>T]
NM_000046.5(ARSB):c.290A>G (p.Gln97Arg) rs886039914
NM_000132.3(F8):c.4767_4768insATAACCAA (p.Tyr1590fs) rs886039906
NM_000138.4(FBN1):c.6004C>T (p.Pro2002Ser) rs1057519320
NM_000181.4(GUSB):c.893C>T (p.Ala298Val) rs1451709678
NM_000199.5(SGSH):c.1375C>T (p.Gln459Ter) rs1567914459
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000368.4(TSC1):c.2269G>T (p.Glu757Ter) rs1057519319
NM_000426.3(LAMA2):c.6993_7155del163 (p.Ser2331Argfs) rs1554301637
NM_000466.3(PEX1):c.1670+1G>A rs1057517490
NM_000540.2(RYR1):c.4481T>C (p.Val1494Ala) rs767928113
NM_000540.2(RYR1):c.5628_5630GGA[2] (p.Glu1878del) rs371047178
NM_000789.4(ACE):c.2642-1G>A rs778390161
NM_001031717.4(CRELD1):c.820_821TG[1] (p.Ala275fs)
NM_001130690.2(PDE10A):c.1001T>G (p.Phe334Cys) rs1554258695
NM_001164405.1(BHLHA9):c.220_221delinsTT (p.Glu74Leu) rs886037856
NM_001184880.2(PCDH19):c.462C>G (p.Tyr154Ter) rs1569315876
NM_001205254.2(OCLN):c.252del (p.Ser85fs) rs863225128
NM_001354636.2(ERI1):c.282del (p.Lys94_Val95insTer) rs1563322318
NM_001849.3(COL6A2):c.2040dup (p.Ile681fs) rs886039905
NM_001999.4(FBN2):c.2945G>T (p.Cys982Phe) rs1057519321
NM_002485.4(NBN):c.935T>A (p.Leu312Ter) rs371480039
NM_002860.4(ALDH18A1):c.1273C>T (p.Arg425Cys) rs762742204
NM_003632.3(CNTNAP1):c.2444C>A (p.Thr815Asn) rs746361190
NM_003688.3(CASK):c.2546T>C (p.Val849Ala) rs1569283243
NM_003922.4(HERC1):c.4906-2A>C rs797045141
NM_004181.5(UCHL1):c.459+2T>C rs1554004931
NM_004369.3(COL6A3):c.6283-2A>C rs797044988
NM_004484.3(GPC3):c.1692del (p.Leu565fs) rs886039908
NM_005450.5(NOG):c.611G>A (p.Arg204Gln) rs104894610
NM_005529.7(HSPG2):c.4740+5G>A rs886039909
NM_005787.6(ALG3):c.221A>G (p.Tyr74Cys) rs1028791709
NM_006192.5(PAX1):c.1169_1173dup (p.Pro392fs) rs1555804780
NM_006208.3(ENPP1):c.1000C>G (p.Pro334Ala) rs1562523328
NM_006371.4(CRTAP):c.634C>T (p.Arg212Ter) rs137853944
NM_006731.2(FKTN):c.1106del (p.Phe369fs) rs750176716
NM_014254.3(RXYLT1):c.390G>A (p.Trp130Ter) rs1565899712
NM_015282.3(CLASP1):c.196-594G>A rs139495292
NM_016580.3(PCDH12):c.2008G>T (p.Glu670Ter) rs531630376
NM_017777.3(MKS1):c.958G>A (p.Val320Ile) rs386834053
NM_019109.4(ALG1):c.652C>T (p.Pro218Ser) rs528261173
NM_020366.3(RPGRIP1):c.900_906+14delTCAAGAGGTGAGTTGCCATCA rs886039911
NM_020435.4(GJC2):c.78del (p.Trp27fs) rs886039904
NM_020964.3(EPG5):c.4665del (p.Glu1555fs) rs1057519318
NM_020975.6(RET):c.1438G>A (p.Glu480Lys) rs537874538
NM_021971.2(GMPPB):c.[1000G>A];[951+1G>A]
NM_024312.4(GNPTAB):c.3449delT (p.Leu1150Argfs) rs1060499684
NM_024312.5(GNPTAB):c.1021_1023del (p.Pro341del) rs1060499679
NM_024312.5(GNPTAB):c.1144A>C (p.Thr382Pro) rs112543062
NM_024312.5(GNPTAB):c.1408+1G>T rs1060499680
NM_024312.5(GNPTAB):c.1600G>A (p.Asp534Asn) rs750240374
NM_024312.5(GNPTAB):c.1613-25del rs546802775
NM_024312.5(GNPTAB):c.2369_2370del (p.Phe790fs) rs1060499685
NM_024312.5(GNPTAB):c.2545_2549GAAAA[1] (p.Lys850fs) rs281864996
NM_024312.5(GNPTAB):c.2545_2549GAAAA[3] (p.Ile852fs) rs281864996
NM_024312.5(GNPTAB):c.2614del (p.Val872fs) rs1060499681
NM_024312.5(GNPTAB):c.2675dup (p.Leu892fs) rs1555269488
NM_024312.5(GNPTAB):c.2947_2954dup (p.Arg986fs) rs1555269154
NM_024312.5(GNPTAB):c.2956C>T (p.Arg986Cys) rs769587233
NM_024312.5(GNPTAB):c.3250-10_3335+112dup rs1555268712
NM_024312.5(GNPTAB):c.3250-1_3250delinsAT rs1060499687
NM_024312.5(GNPTAB):c.3336-1G>A rs397507562
NM_024312.5(GNPTAB):c.3539C>T (p.Ser1180Phe) rs1060499689
NM_024312.5(GNPTAB):c.3575T>C (p.Phe1192Ser) rs1060499688
NM_024312.5(GNPTAB):c.378dup (p.Glu127fs) rs1555271865
NM_024312.5(GNPTAB):c.571G>A (p.Val191Ile) rs751953529
NM_025139.6(ARMC9):c.879G>A (p.Thr293=) rs766572502
NM_032520.5(GNPTG):c.233+5G>A rs1060499691
NM_032520.5(GNPTG):c.324G>A (p.Trp108Ter) rs1060499690
NM_033071.3(SYNE1):c.4520T>A (p.Ile1507Asn) rs746438011
NM_058172.6(ANTXR2):c.1148G>A (p.Gly383Asp) rs886039907
NM_152393.4(KLHL40):c.931C>A (p.Arg311Ser) rs763283033
NR_023343.1:n.30G>A rs374299350

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.