List of variants in gene combination ARID1B, LOC115308161 reported as uncertain significance by Gharavi Laboratory, Columbia University

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 3

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[1] (p.Gln207_Gln214del)	rs770869529
NM_001374828.1(ARID1B):c.612_613insG (p.Gln205fs)	rs1554247377
NM_001374828.1(ARID1B):c.615GCA[4] (p.Gln212_Gln214del)	rs587779744

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.