ClinVar Miner

Variants with conflicting interpretations studied for Hereditary cutaneous melanoma

Coded as:
Minimum review status of the submission for Hereditary cutaneous melanoma: Y axis collection method of the submission for Hereditary cutaneous melanoma:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
214 173 1 18 27 10 15 58

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All conditions
Hereditary cutaneous melanoma pathogenic likely pathogenic uncertain significance likely benign benign association drug response risk factor
pathogenic 0 9 3 1 1 1 1 7
likely pathogenic 3 0 1 0 0 0 0 1
uncertain significance 1 11 1 16 1 0 0 1
likely benign 0 0 9 0 2 0 0 0
benign 0 0 2 5 0 0 0 0

Condition to condition summary #

Total conditions: 188
Download table as spreadsheet
Condition Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
Hereditary cancer-predisposing syndrome 0 157 0 10 18 0 11 38
not provided 0 82 1 4 6 0 3 13
not specified 0 30 0 5 5 0 2 11
Melanoma-pancreatic cancer syndrome 0 23 0 5 5 0 1 10
Cutaneous malignant melanoma 2 0 8 0 1 0 8 0 9
Malignant melanoma of skin 0 0 0 1 0 0 3 4
Squamous cell carcinoma of the head and neck 0 0 0 1 0 0 3 4
Cutaneous malignant melanoma 3 0 8 0 0 2 1 0 3
Squamous cell carcinoma of the skin 0 0 0 0 0 0 3 3
Adenocarcinoma of stomach 0 0 0 0 0 0 2 2
Lung adenocarcinoma 0 0 0 1 0 0 1 2
Neoplasm 0 0 0 1 0 0 1 2
Pancreatic adenocarcinoma 0 0 0 0 0 0 2 2
Squamous cell lung carcinoma 0 0 0 0 0 0 2 2
11q partial monosomy syndrome 0 0 0 1 0 0 0 1
1p13.3 deletion syndrome 0 0 0 1 0 0 0 1
Abnormal bleeding 0 0 0 1 0 0 1 1
Abnormal thrombosis; Reduced protein S activity 0 0 0 1 0 0 0 1
Abnormality of the eye 0 0 0 1 0 0 0 1
Acrodysostosis 2, with or without hormone resistance 0 0 0 0 0 0 1 1
Adams-Oliver syndrome 5 0 0 0 1 0 0 0 1
Anomalous pulmonary venous return 0 0 0 0 0 0 1 1
Aortic aneurysm, familial thoracic 4 0 0 0 0 0 0 1 1
Arrhythmogenic right ventricular dysplasia, familial, 13 0 0 0 0 0 0 1 1
Ataxia-telangiectasia-like disorder 1 0 0 0 1 0 0 0 1
Autism spectrum disorder 0 0 0 1 0 1 1 1
Autism spectrum disorder; Epilepsy 0 0 0 1 0 0 1 1
Autistic behavior; Absent speech 0 0 0 0 0 0 1 1
Autistic behavior; Moderate global developmental delay 0 0 0 1 0 0 0 1
Autistic behavior; Severe global developmental delay 0 0 0 1 0 0 0 1
Autistic disorder of childhood onset 0 0 0 1 0 0 1 1
Autistic disorder of childhood onset; Schizophrenia 0 0 0 1 0 0 0 1
Behavioral abnormality; Low-set ears; Prominent nasal bridge; Underdeveloped nasal alae; Intellectual disability, mild; Postnatal microcephaly 0 0 0 0 0 0 1 1
Behavioral abnormality; Moderate global developmental delay 0 0 0 0 0 0 1 1
Bethlem myopathy 1 0 0 0 0 0 0 1 1
Biotin-thiamine-responsive basal ganglia disease 0 0 0 0 0 0 1 1
Biotinidase deficiency 0 0 0 0 0 0 1 1
Birk-Barel Intellectual Disability Dysmorphism Syndrome 0 0 0 0 0 0 1 1
Bosch-Boonstra-Schaaf optic atrophy syndrome 0 0 0 1 0 0 0 1
Branched-chain keto acid dehydrogenase kinase deficiency 0 0 0 0 0 0 1 1
Breast-ovarian cancer, familial 1 0 0 0 1 0 0 1 1
Brown-Vialetto-Van Laere syndrome 1 0 0 0 0 0 0 1 1
CHARGE association 0 0 0 0 0 0 1 1
Cerebellar ataxia, nonprogressive, with mental retardation 0 0 0 0 0 0 1 1
Cerebral cavernous malformation 0 0 0 1 0 0 0 1
Charcot-Marie-Tooth disease 0 0 0 1 0 0 1 1
Charcot-Marie-Tooth disease type 2K 0 0 0 0 0 0 1 1
Charcot-Marie-Tooth disease, demyelinating, type 1b 0 0 0 1 0 0 0 1
Chromosome Xq26.3 duplication syndrome 0 0 0 1 0 0 0 1
Ciliary dyskinesia, primary, 3 0 0 0 1 0 0 0 1
Collagen VI-related myopathy 0 0 0 0 0 0 1 1
Combined oxidative phosphorylation deficiency 14 0 0 0 0 0 0 1 1
Combined oxidative phosphorylation deficiency 31 0 0 0 1 0 0 0 1
Cone/cone-rod dystrophy 0 0 0 1 0 0 0 1
Congenital contractural arachnodactyly 0 0 0 0 0 0 1 1
Cornelia de Lange syndrome 1 0 0 0 1 0 0 0 1
Currarino triad 0 0 0 1 0 0 0 1
Cutaneous melanoma 0 1 0 0 0 0 1 1
Cystinuria 0 0 0 1 0 0 0 1
Deafness, autosomal dominant 56 0 0 0 0 0 0 1 1
Deep venous thrombosis 0 0 0 1 0 0 0 1
Dilated Cardiomyopathy, Dominant 0 0 0 0 0 0 1 1
Dilated cardiomyopathy 1G 0 0 0 1 0 0 0 1
Dilated cardiomyopathy 1W; Familial hypertrophic cardiomyopathy 15 0 0 0 0 0 0 1 1
Duchenne muscular dystrophy 0 0 0 1 0 0 1 1
Ductal breast carcinoma 0 0 0 0 0 0 1 1
Early infantile epileptic encephalopathy 0 0 0 1 0 0 1 1
Ehlers-Danlos syndrome, classic type 0 0 0 0 0 0 1 1
Encephalopathy 0 0 0 0 0 0 1 1
Epilepsy 0 0 0 0 0 0 1 1
Epilepsy, childhood absence 2; Familial febrile seizures 8 0 0 0 1 0 0 0 1
Epilepsy, focal, with speech disorder and with or without mental retardation 0 0 0 0 0 0 1 1
Epilepsy, progressive myoclonic 3 0 0 0 0 0 0 1 1
Epileptic encephalopathy, early infantile, 1; Spinocerebellar ataxia, autosomal recessive 12 0 0 0 1 0 0 0 1
Factor X deficiency 0 0 0 1 0 0 0 1
Failure to thrive in infancy; Attention deficit hyperactivity disorder 0 0 0 0 0 0 1 1
Familial adenomatous polyposis 1 0 0 0 1 0 0 0 1
Familial cancer of breast 0 0 0 1 0 0 1 1
Familial colorectal cancer 0 0 0 0 0 0 1 1
Familial hypercholesterolemia 1 0 0 0 1 0 0 1 1
Familial hypertrophic cardiomyopathy 16 0 0 0 0 0 0 1 1
Familial hypokalemia-hypomagnesemia 0 0 0 1 0 0 0 1
Fanconi anemia 0 0 0 0 0 0 1 1
Fanconi anemia, complementation group A 0 0 0 1 0 0 0 1
Focal seizures 0 0 0 1 0 0 0 1
Galactosylceramide beta-galactosidase deficiency 0 0 0 0 0 0 1 1
Gingival bleeding; Impaired epinephrine-induced platelet aggregation; Impaired collagen-induced platelet aggregation; Impaired arachidonic acid-induced platelet aggregation; Impaired ristocetin-induced platelet aggregation; Impaired thrombin-induced platelet aggregation; Impaired thromboxane A2 agonist-induced platelet aggregation 0 0 0 1 0 0 0 1
Glioma 0 0 0 1 0 0 0 1
Global developmental delay 0 0 0 0 0 0 1 1
Global developmental delay; Hypoplasia of the corpus callosum; Abnormality of the cerebral white matter; Periventricular leukomalacia; Delayed myelination; Muscular hypotonia 0 0 0 1 0 0 0 1
Global developmental delay; Microcephaly; Abnormality of the cerebellum 0 0 0 1 0 0 0 1
Global developmental delay; Seizures; Hypotelorism; Short philtrum; Infantile muscular hypotonia 0 0 0 0 0 0 1 1
Global developmental delay; Seizures; Intellectual disability 0 0 0 1 0 0 0 1
Growth abnormality 0 0 0 0 0 0 1 1
Hepatocellular carcinoma 0 0 0 0 0 0 1 1
Hereditary Paraganglioma-Pheochromocytoma Syndromes 0 0 0 0 0 0 1 1
Hereditary breast and ovarian cancer syndrome 0 0 0 1 0 0 0 1
Hereditary cutaneous melanoma 443 1 0 1 0 0 0 1
Hereditary factor IX deficiency disease 0 0 0 1 0 0 0 1
Hereditary factor XI deficiency disease 0 0 0 1 0 0 0 1
Hereditary nonpolyposis colon cancer 0 0 0 1 0 0 1 1
Hereditary pancreatitis 0 0 0 0 0 0 1 1
Hereditary sensory and autonomic neuropathy type IIA; Generalized epilepsy with febrile seizures plus, type 7 0 0 0 0 0 0 1 1
Hereditary sensory and autonomic neuropathy type IIB 0 0 0 0 0 0 1 1
Hypertrophic cardiomyopathy 0 0 0 0 0 0 1 1
Idiopathic basal ganglia calcification 1 0 0 0 1 0 0 0 1
Idiopathic fibrosing alveolitis, chronic form; Dyskeratosis congenita, autosomal dominant, 2 0 0 0 0 0 0 1 1
Imatinib response 0 0 0 0 0 1 0 1
Infantile nephronophthisis 0 0 0 1 0 0 0 1
Intellectual disability 0 0 0 1 0 0 0 1
Intellectual disability, mild 0 0 0 0 0 0 1 1
Internal malformations 0 0 0 0 0 0 1 1
Intestinal malrotation 0 0 0 1 0 0 1 1
Joubert syndrome 20; Meckel syndrome, type 11 0 0 0 0 0 0 1 1
Juvenile myopathy, encephalopathy, lactic acidosis AND stroke 0 0 0 0 0 0 1 1
Juvenile polyposis syndrome 0 0 0 0 0 0 1 1
Kallmann syndrome 1 0 0 0 0 0 0 1 1
Keratoconus 0 0 0 0 0 0 1 1
Kidney Disease; Tooth agenesis 0 0 0 0 0 0 1 1
Kleefstra syndrome 2 0 0 0 1 0 0 0 1
Leber congenital amaurosis 0 0 0 1 0 0 0 1
Left ventricular noncompaction cardiomyopathy 0 0 0 0 0 0 1 1
Leri Weill dyschondrosteosis 0 0 0 0 0 0 1 1
Limb-girdle muscular dystrophy, type 2A 0 0 0 1 0 0 0 1
Macrocephaly, macrosomia, facial dysmorphism syndrome 0 0 0 0 0 0 1 1
Macrothrombocytopenia 0 0 0 1 0 0 0 1
Majeed syndrome 0 0 0 1 0 0 0 1
Marfanoid habitus and intellectual disability 0 0 0 1 0 0 0 1
Melanoma, cutaneous malignant, susceptibility to, 10 0 0 0 0 0 0 1 1
Mental retardation, autosomal dominant 18 0 0 0 1 0 0 0 1
Mental retardation, autosomal dominant 26 0 0 0 0 0 0 1 1
Mesangiocapillary glomerulonephritis 0 0 0 1 0 0 0 1
Midface hypoplasia, hearing impairment, elliptocytosis, and nephrocalcinosis 0 0 0 0 0 0 1 1
Mirror movements 1 0 0 0 0 0 0 1 1
Mitochondrial complex I deficiency 0 0 0 0 0 0 1 1
Multiple myeloma 0 0 0 1 0 0 0 1
Myofibrillar myopathy, filamin C-related; Myopathy, distal, 4; Cardiomyopathy, familial hypertrophic, 26; Dilated Cardiomyopathy, Dominant 0 0 0 0 0 0 1 1
Myopathy, distal, 1 0 0 0 0 0 0 1 1
Myosclerosis 0 0 0 0 0 0 1 1
Myosin storage myopathy 0 0 0 0 0 0 1 1
Nemaline myopathy 6 0 0 0 1 0 0 0 1
Neoplasm of the large intestine 0 0 0 0 0 0 1 1
Nephronophthisis 0 0 0 0 0 0 1 1
Neuroblastoma 3 0 0 0 0 0 0 1 1
Neurodevelopmental disorder 0 0 0 1 0 0 1 1
Neurofibromatosis, type 2 0 0 0 0 0 0 1 1
Neuronopathy, distal hereditary motor, type viia; Myasthenic syndrome, congenital, 20, presynaptic 0 0 0 0 0 0 1 1
Neuropathy, hereditary motor and sensory, Okinawa type; Spastic paraplegia 57, autosomal recessive 0 0 0 0 0 0 1 1
Parkinson disease 2 0 0 0 1 0 0 0 1
Pediatric metastatic thyroid tumour 0 0 0 1 0 0 0 1
Peripheral neuropathy 0 0 0 0 0 0 1 1
Pigmented nodular adrenocortical disease, primary, 2 0 0 0 0 0 0 1 1
Plasminogen activator inhibitor type 1 deficiency 0 0 0 0 0 0 1 1
Premature ovarian failure 0 0 0 0 0 0 1 1
Primary amenorrhea 0 0 0 0 0 0 1 1
Primary ciliary dyskinesia 0 0 0 1 0 0 1 1
Primary hyperoxaluria, type I 0 0 0 0 0 0 1 1
Progressive familial heart block type 1B 0 0 0 0 0 0 1 1
Progressive myoclonus epilepsy with ataxia 0 0 0 1 0 0 0 1
Pulmonary arterial hypertension 0 0 0 1 0 0 0 1
Reduced antithrombin III activity 0 0 0 1 0 0 0 1
Reduced protein S activity 0 0 0 1 0 0 0 1
Renal transitional cell carcinoma 0 0 0 1 0 0 0 1
Retinal dystrophy 0 0 0 1 0 0 0 1
Retinitis pigmentosa 0 0 0 1 0 0 0 1
Robin sequence; Intellectual disability, mild; Bilateral conductive hearing impairment; Abnormality of esophagus physiology 0 0 0 1 0 0 0 1
Rod-cone dystrophy; Hypomagnesemia 0 0 0 1 0 0 0 1
Scapuloperoneal myopathy 0 0 0 0 0 0 1 1
Schizophrenia 0 0 0 1 0 0 0 1
Seizures 0 0 0 1 0 0 0 1
Seizures; Intellectual disability 0 0 0 1 0 0 0 1
Seizures; Narrow nasal bridge; Mandibular prognathia; Delayed speech and language development; Intrauterine growth retardation 0 0 0 0 0 0 1 1
Short stature; Failure to thrive; Anemia; Strabismus; Splenomegaly; Sparse hair; Neurodevelopmental delay; Thrombocytopenia 0 0 0 1 0 0 0 1
Spastic paraplegia 0 0 0 1 0 0 1 1
Spastic paraplegia 11, autosomal recessive 0 0 0 0 0 0 1 1
Spastic paraplegia 30, autosomal recessive; Hereditary sensory and autonomic neuropathy type IIC; Mental retardation, autosomal dominant 9 0 0 0 0 0 0 1 1
Spinal muscular atrophy, distal, autosomal recessive, 5 0 0 0 0 0 0 1 1
Spinocerebellar ataxia 27 0 0 0 1 0 0 0 1
Stargardt disease 1 0 0 0 1 0 0 0 1
TAX1BP3-related arrhythmogenic right ventricular cardiomyopathy 0 0 0 1 0 0 0 1
Thoracic aortic aneurysm and aortic dissection 0 0 0 1 0 0 1 1
Thrombocytopenia 0 0 0 1 0 0 0 1
Transitional cell carcinoma of the bladder 0 0 0 0 0 0 1 1
Treacher Collins syndrome 1 0 0 0 1 0 0 0 1
Usher syndrome 0 0 0 1 0 0 0 1
Usher syndrome, type 2A; Retinitis pigmentosa 39 0 0 0 0 0 0 1 1
Visceral myopathy 0 0 0 1 0 0 0 1
Witteveen-kolk syndrome 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 58
Download table as spreadsheet
HGVS dbSNP
NM_000075.4(CDK4):c.122A>G (p.Asn41Ser) rs144890720
NM_000075.4(CDK4):c.632+9C>T rs1192976748
NM_000075.4(CDK4):c.661G>A (p.Asp221Asn) rs587778187
NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000075.4(CDK4):c.776C>T (p.Ser259Leu) rs201617914
NM_000075.4(CDK4):c.779T>A (p.Val260Glu) rs200215596
NM_000077.4(CDKN2A):c.-14C>T rs764244718
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000077.4(CDKN2A):c.151-4G>C rs529380972
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.4(CDKN2A):c.172C>T (p.Arg58Ter) rs121913387
NM_000077.4(CDKN2A):c.174A>G (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.198C>T (p.His66=) rs374984975
NM_000077.4(CDKN2A):c.203C>T (p.Ala68Val) rs1060501260
NM_000077.4(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098
NM_000077.4(CDKN2A):c.210C>T (p.Pro70=) rs864622570
NM_000077.4(CDKN2A):c.212A>G (p.Asn71Ser) rs559848002
NM_000077.4(CDKN2A):c.225C>G (p.Pro75=) rs762397298
NM_000077.4(CDKN2A):c.236C>T (p.Thr79Ile) rs1034265990
NM_000077.4(CDKN2A):c.246G>A (p.Val82=) rs1060504181
NM_000077.4(CDKN2A):c.247C>T (p.His83Tyr) rs121913385
NM_000077.4(CDKN2A):c.249C>A (p.His83Gln) rs34968276
NM_000077.4(CDKN2A):c.250G>A (p.Asp84Asn) rs11552822
NM_000077.4(CDKN2A):c.251A>C (p.Asp84Ala) rs587782792
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.300C>T (p.Ala100=) rs876660818
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.334C>G (p.Arg112Gly) rs876660436
NM_000077.4(CDKN2A):c.335_337dup (p.Arg112dup) rs768966657
NM_000077.4(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.4(CDKN2A):c.341C>T (p.Pro114Leu) rs121913386
NM_000077.4(CDKN2A):c.342C>G (p.Pro114=) rs878853648
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.457G>T (p.Asp153Tyr) rs45476696
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.4(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000077.4(CDKN2A):c.95T>C (p.Leu32Pro) rs878853650
NM_058195.3(CDKN2A):c.152G>C (p.Arg51Thr) rs1014358179
NM_058195.3(CDKN2A):c.193+5G>A rs587782083
NM_058195.3(CDKN2A):c.48C>T (p.Gly16=) rs786202556
NM_058195.3(CDKN2A):c.69C>T (p.Phe23=) rs374360796
NM_058195.3(CDKN2A):c.92C>G (p.Thr31Arg) rs528789830
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.