ClinVar Miner

Variants with conflicting interpretations studied for Seizure

Coded as:
Minimum review status of the submission for Seizure: Collection method of the submission for Seizure:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
247 94 0 19 49 1 15 79

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All conditions
Seizure pathogenic likely pathogenic uncertain significance likely benign benign protective other
pathogenic 0 6 3 0 0 0 0
likely pathogenic 13 0 7 1 1 1 1
uncertain significance 3 3 0 36 12 1 1
likely benign 0 1 7 0 1 0 0
benign 0 0 1 0 0 0 0

Condition to condition summary #

Total conditions: 72
Download table as spreadsheet
Condition Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
not provided 0 84 0 17 38 1 13 65
not specified 0 22 0 2 10 0 1 11
EPM2A-related condition 0 0 0 0 2 0 0 2
Epileptic encephalopathy 0 1 0 2 0 0 1 2
SCN1A-related condition 0 0 0 0 1 0 1 2
Seizure 416 2 0 1 0 0 1 2
16p13.11 recurrent microdeletion syndrome 0 0 0 0 0 0 1 1
16p13.2-p13.13 microduplication syndrome 0 0 0 1 0 0 1 1
1p13.3 deletion syndrome 0 0 0 0 0 0 1 1
1q24q25 microdeletion syndrome 0 0 0 1 0 0 1 1
22q13.3 interstitial deletion 0 0 0 1 0 0 1 1
ARID1B-related condition 0 0 0 0 1 0 0 1
ATAD3 gene cluster related condition 0 0 0 0 0 0 1 1
Abnormal bleeding 0 0 0 0 0 0 1 1
Aminoaciduria 0 0 0 1 0 0 1 1
Anophthalmia-microphthalmia syndrome 0 0 0 0 0 0 1 1
Arthrogryphosis 0 0 0 0 0 0 1 1
Atypical behavior; Low-set ears; Prominent nasal bridge; Underdeveloped nasal alae; Intellectual disability, mild; Secondary microcephaly 0 0 0 0 0 0 1 1
Atypical behavior; Moderate global developmental delay 0 0 0 0 0 0 1 1
Autistic behavior; Absent speech 0 0 0 0 0 0 1 1
Autistic behavior; Moderate global developmental delay 0 0 0 0 0 0 1 1
Autistic behavior; Severe global developmental delay 0 0 0 0 0 0 1 1
Autosomal dominant epilepsy 0 0 0 0 0 0 1 1
D2HGDH-related condition 0 0 0 0 1 0 0 1
Deep venous thrombosis 0 0 0 0 0 0 1 1
Delayed speech and language development 0 0 0 0 0 0 1 1
Ectopic tissue 0 0 0 0 0 0 1 1
Epilepsy, idiopathic generalized, susceptibility to, 11; Familial hyperaldosteronism type II; Leukoencephalopathy with mild cerebellar ataxia and white matter edema 0 0 0 0 1 0 0 1
FOLR1-related condition 0 0 0 0 1 0 0 1
Focal-onset seizure 0 0 0 0 0 0 1 1
Gingival bleeding; Impaired epinephrine-induced platelet aggregation; Impaired collagen-induced platelet aggregation; Impaired arachidonic acid-induced platelet aggregation; Impaired ristocetin-induced platelet aggregation; Impaired thrombin-induced platelet aggregation; Impaired thromboxane A2 agonist-induced platelet aggregation 0 0 0 0 0 0 1 1
Global developmental delay 0 0 0 1 1 0 1 1
Global developmental delay; Expressive language delay; Secondary microcephaly 0 0 0 1 0 0 1 1
Global developmental delay; Seizure; Hypotelorism; Short philtrum; Infantile muscular hypotonia 0 0 0 0 0 0 1 1
Growth abnormality 0 0 0 0 0 0 1 1
Immunodeficiency 33; Ectodermal dysplasia and immunodeficiency 1; Incontinentia pigmenti syndrome; Immunodeficiency 47 0 0 0 1 0 0 1 1
Inherited Immunodeficiency Diseases 0 0 0 0 0 0 1 1
Intellectual disability, mild 0 0 0 1 0 0 1 1
Intellectual disability, severe 0 0 0 1 0 0 1 1
Internal malformations 0 0 0 0 0 0 1 1
Interstitial 6q microdeletion syndrome 0 0 0 1 0 0 1 1
KIF1A-related condition 0 0 0 0 1 0 0 1
LYST-related condition 0 0 0 0 1 0 0 1
MAN1B1-related condition 0 0 0 0 1 0 0 1
MBD5 associated neurodevelopmental disorder 0 0 0 1 0 0 1 1
MKS1-related condition 0 0 0 0 1 0 1 1
Marfanoid habitus and intellectual disability 0 0 0 0 0 0 1 1
Muscle dystrophy 0 0 0 0 0 0 1 1
Neurodevelopmental delay 0 0 0 1 0 0 0 1
PPFIA3-related disorder 0 0 0 0 0 0 1 1
PRRT2 insufficiency 0 0 0 1 0 0 0 1
PRRT2-Associated Paroxysmal Movement Disorders 0 0 0 1 0 0 0 1
PRRT2-Related Disorders 0 0 0 1 0 0 0 1
PRRT2-related condition 0 0 0 1 0 0 0 1
PRRT2-related disorder 0 0 0 1 0 0 0 1
Pediatric metastatic thyroid tumour 0 0 0 0 0 0 1 1
Primary amenorrhea 0 0 0 0 1 0 1 1
RELN-related condition 0 0 0 0 1 0 0 1
RHD DEL 0 0 0 1 0 0 1 1
RORB-related condition 0 0 0 0 0 0 1 1
Renal transitional cell carcinoma 0 0 0 0 0 0 1 1
SCN2A-related disorder 0 1 0 0 0 0 1 1
SLC4A10-related neurodevelopmental disorder 0 0 0 0 0 0 1 1
SZT2-related condition 0 0 0 0 1 0 0 1
See cases 0 1 0 1 1 0 1 1
Seizure; Abnormal facial shape; Intellectual disability, severe 0 0 0 1 0 0 0 1
Silver Russell Syndrome-related disorder 0 0 0 0 0 0 1 1
Spastic paraplegia 0 0 0 0 0 0 1 1
Spinocerebellar ataxia, X-linked 0 0 0 0 0 1 0 1
Splenomegaly; Decreased circulating antibody level 0 0 0 1 0 0 1 1
TAX1BP3-related arrhythmogenic right ventricular cardiomyopathy 0 0 0 0 0 0 1 1
ZNF331 deletion 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 79
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_005670.4(EPM2A):c.722G>A (p.Arg241Gln) rs146321088 0.00197
NM_004366.6(CLCN2):c.1937G>A (p.Arg646Gln) rs115961753 0.00156
NM_000081.4(LYST):c.4337G>A (p.Arg1446Gln) rs111722949 0.00135
NM_016729.3(FOLR1):c.493+2T>C rs144637717 0.00134
NM_001365999.1(SZT2):c.4727G>A (p.Arg1576His) rs143935839 0.00119
NM_016219.5(MAN1B1):c.707C>T (p.Pro236Leu) rs147577332 0.00118
NM_001080.3(ALDH5A1):c.13A>G (p.Ile5Val) rs200398000 0.00096
NM_005883.3(APC2):c.3656C>T (p.Ala1219Val) rs137877386 0.00093
NM_032119.4(ADGRV1):c.1855T>G (p.Leu619Val) rs202064612 0.00083
NM_001270520.2(DAAM1):c.400A>G (p.Ile134Val) rs145787738 0.00081
NM_001165963.4(SCN1A):c.5951C>A (p.Pro1984His) rs146733308 0.00074
NM_001244008.2(KIF1A):c.1208-40G>A rs375833834 0.00073
NM_001365999.1(SZT2):c.6343C>G (p.Pro2115Ala) rs147309177 0.00073
NM_152783.5(D2HGDH):c.1387G>A (p.Glu463Lys) rs143460342 0.00071
NM_003705.5(SLC25A12):c.2015del (p.Ala672fs) rs780650245 0.00058
NM_032119.4(ADGRV1):c.8842G>A (p.Ala2948Thr) rs369777874 0.00045
NM_002907.4(RECQL):c.401C>T (p.Thr134Ile) rs150306543 0.00037
NM_005881.4(BCKDK):c.1066A>T (p.Ser356Cys) rs142542453 0.00035
NM_001379200.1(TBX1):c.1336C>T (p.Pro446Ser) rs201993443 0.00026
NM_001609.4(ACADSB):c.1159G>A (p.Glu387Lys) rs188094280 0.00026
NM_000744.7(CHRNA4):c.1538G>A (p.Arg513His) rs868845088 0.00023
NM_022455.5(NSD1):c.3692G>A (p.Gly1231Glu) rs141065357 0.00020
NM_001127222.2(CACNA1A):c.7327G>A (p.Ala2443Thr) rs533884784 0.00017
NM_005045.4(RELN):c.2015C>T (p.Pro672Leu) rs201044262 0.00016
NM_007118.4(TRIO):c.7922A>C (p.Lys2641Thr) rs200539540 0.00016
NM_001083961.2(WDR62):c.121T>A (p.Cys41Ser) rs761479779 0.00013
NM_018100.4(EFHC1):c.1057C>T (p.Arg353Trp) rs527295360 0.00013
NM_030912.3(TRIM8):c.1456C>G (p.Pro486Ala) rs552806334 0.00011
NM_032119.4(ADGRV1):c.8995C>G (p.Gln2999Glu) rs200503628 0.00009
NM_001374828.1(ARID1B):c.1337C>T (p.Ala446Val) rs748273011 0.00008
NM_001100913.3(PACS2):c.1072C>T (p.Arg358Trp) rs1488845742 0.00004
NM_001134407.3(GRIN2A):c.3961G>C (p.Glu1321Gln) rs370754278 0.00004
NM_001378120.1(MBD5):c.4970C>A (p.Pro1657His) rs775673512 0.00004
NM_000548.5(TSC2):c.538C>G (p.Leu180Val) rs45485591 0.00003
NM_004975.4(KCNB1):c.2442T>G (p.Ile814Met) rs565025643 0.00003
NM_001378120.1(MBD5):c.2789A>C (p.Gln930Pro) rs564759063 0.00002
NM_001037.5(SCN1B):c.373C>T (p.Arg125Cys) rs1135401736 0.00001
NM_001165963.4(SCN1A):c.2576G>A (p.Arg859His) rs398123588 0.00001
NM_006516.4(SLC2A1):c.277C>T (p.Arg93Trp) rs267607061 0.00001
NM_015443.4(KANSL1):c.3019C>T (p.Arg1007Trp) rs1057522661 0.00001
NM_172107.4(KCNQ2):c.88G>A (p.Gly30Ser) rs915805727 0.00001
NM_000368.5(TSC1):c.954GTT[1] (p.Leu320del) rs755655903
NM_001040142.2(SCN2A):c.1399G>T (p.Ala467Ser) rs745774658
NM_001040142.2(SCN2A):c.2567G>A (p.Arg856Gln) rs797045942
NM_001040142.2(SCN2A):c.2654C>T (p.Thr885Ile) rs1699477928
NM_001040142.2(SCN2A):c.4976C>T (p.Ala1659Val) rs1060503101
NM_001040142.2(SCN2A):c.5485C>T (p.Leu1829Phe) rs1553463676
NM_001040142.2(SCN2A):c.5645G>A (p.Arg1882Gln) rs794727444
NM_001069.3(TUBB2A):c.872A>C (p.Gln291Pro) rs863224939
NM_001077350.3(NPRL3):c.980C>T (p.Pro327Leu) rs1898841618
NM_001099922.3(ALG13):c.320A>G (p.Asn107Ser) rs398122394
NM_001126049.2(KLLN):c.-1007C>G rs587780001
NM_001144967.3(NEDD4L):c.1402C>T (p.Arg468Trp) rs1199827684
NM_001161352.2(KCNMA1):c.2572C>T (p.Arg858Trp) rs199681253
NM_001165963.4(SCN1A):c.1129C>T (p.Arg377Ter) rs794726799
NM_001195553.2(DCX):c.557G>A (p.Arg186His) rs587783563
NM_001242896.3(DEPDC5):c.232del (p.Arg78fs) rs2082695884
NM_001271.4(CHD2):c.1934C>T (p.Thr645Met) rs2053619460
NM_001330260.2(SCN8A):c.5630A>G (p.Asn1877Ser) rs587780455
NM_001374828.1(ARID1B):c.506ACCACCACCATGCCCACCACC[1] (p.169HHHHAHH[1]) rs767952510
NM_001376.5(DYNC1H1):c.10030C>T (p.Arg3344Trp) rs2048519381
NM_003072.5(SMARCA4):c.3986G>A (p.Arg1329His) rs1555785361
NM_004519.4(KCNQ3):c.956A>G (p.Tyr319Cys) rs1554627218
NM_005027.4(PIK3R2):c.1669G>T (p.Asp557Tyr) rs372272045
NM_005045.4(RELN):c.9295AAG[1] (p.Lys3100del) rs762015967
NM_005670.4(EPM2A):c.136G>A (p.Ala46Thr) rs374338349
NM_006914.4(RORB):c.1163T>A (p.Ile388Asn)
NM_007325.5(GRIA3):c.1236A>C (p.Gln412His) rs2045454194
NM_007325.5(GRIA3):c.1888G>A (p.Gly630Arg) rs587777361
NM_020137.5(GRIPAP1):c.1669G>A (p.Glu557Lys)
NM_020822.3(KCNT1):c.2849G>A (p.Arg950Gln)
NM_020988.3(GNAO1):c.904G>A (p.Ala302Thr) rs2143704776
NM_145239.3(PRRT2):c.647C>T (p.Pro216Leu) rs76335820
NM_145239.3(PRRT2):c.649dup (p.Arg217fs)
NM_172107.4(KCNQ2):c.1657C>T (p.Arg553Trp) rs759584387
NM_172107.4(KCNQ2):c.701C>T (p.Thr234Ile) rs794727741
NM_172107.4(KCNQ2):c.793G>A (p.Ala265Thr) rs794727740
NM_172362.3(KCNH1):c.1070G>A (p.Arg357Gln) rs886041300
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.