ClinVar Miner

Variants in gene combination ARID1B, LOC115308161 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
117 18 0 13 9 0 0 21

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

uncertain significance likely benign benign
uncertain significance 0 5 5
likely benign 5 0 13
benign 5 13 0

All variants with conflicting interpretations #

Total variants: 21
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001374828.1(ARID1B):c.612A>G (p.Gln204=) rs78253128 0.00509
NM_001374828.1(ARID1B):c.535C>A (p.His179Asn) rs374989034 0.00055
NM_001374828.1(ARID1B):c.501C>G (p.His167Gln) rs372726215 0.00028
NM_001374828.1(ARID1B):c.347C>T (p.Ala116Val) rs1325414473 0.00001
NM_001374828.1(ARID1B):c.514C>T (p.His172Tyr) rs751612160 0.00001
NM_001374828.1(ARID1B):c.352TCC[6] (p.Ser124del) rs770512547
NM_001374828.1(ARID1B):c.352TCC[9] (p.Ser123_Ser124dup) rs770512547
NM_001374828.1(ARID1B):c.373GCGGCGGCA[1] (p.Ala128_Ala130del) rs769480864
NM_001374828.1(ARID1B):c.501CCA[6] (p.His172dup) rs752012879
NM_001374828.1(ARID1B):c.506ACCACCACCATGCCCACCACC[1] (p.169HHHHAHH[1]) rs767952510
NM_001374828.1(ARID1B):c.591GCA[4] (p.Gln212_Gln214del) rs587779743
NM_001374828.1(ARID1B):c.591GCA[8] (p.Gln214dup) rs587779743
NM_001374828.1(ARID1B):c.591GCA[9] (p.Gln213_Gln214dup) rs587779743
NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[1] (p.Gln207_Gln214del) rs770869529
NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln207_Gln214dup) rs770869529
NM_001374828.1(ARID1B):c.615GCA[10] (p.Gln212_Gln214dup) rs587779744
NM_001374828.1(ARID1B):c.615GCA[4] (p.Gln212_Gln214del) rs587779744
NM_001374828.1(ARID1B):c.615GCA[8] (p.Gln214dup) rs587779744
NM_001374828.1(ARID1B):c.615GCA[9] (p.Gln213_Gln214dup) rs587779744
NM_001374828.1(ARID1B):c.633GCAACA[3] (p.Gln213_Gln214dup) rs748838689
NM_001374828.1(ARID1B):c.641_642insGCAGCACCAGCAGCAGCAACAGCA (p.Gln214_His215insGlnHisGlnGlnGlnGlnGlnGln) rs1334776212

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.