ClinVar Miner

Variants in gene combination ATM, C11orf65 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
1353 728 0 118 88 1 24 210

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign risk factor
pathogenic 0 71 7 0 0 1
likely pathogenic 71 0 21 0 0 1
uncertain significance 7 21 0 87 17 0
likely benign 0 0 87 0 47 0
benign 0 0 17 47 0 0
risk factor 1 1 0 0 0 0

All variants with conflicting interpretations #

Total variants: 210
Download table as spreadsheet
HGVS dbSNP
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5791delGinsCCT (p.Ala1931Profs) rs587779851
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5890A>G (p.Lys1964Glu) rs201963507
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5894_5900dupAAAGTAT (p.Met1967Ilefs) rs1555110517
NM_000051.3(ATM):c.5910delA (p.Glu1971Argfs) rs587782198
NM_000051.3(ATM):c.5961T>G (p.Ser1987=) rs1060504265
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.5982delA (p.Glu1995Lysfs) rs1555111855
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+15T>C rs3212321
NM_000051.3(ATM):c.6095+8G>T rs547072690
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6100C>A (p.Arg2034=) rs532480170
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6108T>C (p.Tyr2036=) rs3092826
NM_000051.3(ATM):c.6114C>T (p.His2038=) rs774993357
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6144A>G (p.Thr2048=) rs1201081443
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6198+1G>A rs778031266
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6246A>G (p.Lys2082=) rs745977589
NM_000051.3(ATM):c.6312G>A (p.Trp2104Ter) rs1555114766
NM_000051.3(ATM):c.6330C>T (p.Asp2110=) rs759029705
NM_000051.3(ATM):c.6333T>C (p.His2111=) rs55756349
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6347+19delT rs58978479
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6347+4A>G rs1342227995
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6385T>G (p.Tyr2129Asp) rs876658542
NM_000051.3(ATM):c.6396A>G (p.Leu2132=) rs370537345
NM_000051.3(ATM):c.6399A>G (p.Gln2133=) rs750614487
NM_000051.3(ATM):c.6404_6405insTT (p.Arg2136Terfs) rs587782554
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.6447T>C (p.Tyr2149=) rs1057519167
NM_000051.3(ATM):c.6452+2T>C rs1064795006
NM_000051.3(ATM):c.6452+5T>A rs533830556
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6486C>T (p.Ser2162=) rs138166710
NM_000051.3(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.3(ATM):c.6552C>T (p.Ser2184=) rs565124064
NM_000051.3(ATM):c.6572+12G>T rs3218677
NM_000051.3(ATM):c.6572+1G>A rs587779856
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6586A>T (p.Arg2196Ter) rs1555119011
NM_000051.3(ATM):c.6700C>T (p.Leu2234=) rs760602228
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.3(ATM):c.6850delG (p.Val2284Leufs) rs876659569
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.6888A>T (p.Ala2296=) rs200735689
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6966C>T (p.Ser2322=) rs864622593
NM_000051.3(ATM):c.6975+13delT rs763287238
NM_000051.3(ATM):c.6975+13dupT rs763287238
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6997dupA (p.Thr2333Asnfs) rs587781299
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.7000_7003delTACA (p.Tyr2334Glnfs) rs786203421
NM_000051.3(ATM):c.7038A>G (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7038A>T (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7294A>T (p.Ile2432Phe) rs587781838
NM_000051.3(ATM):c.7308-10T>C rs745319720
NM_000051.3(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7328G>A (p.Arg2443Gln) rs587782310
NM_000051.3(ATM):c.7358G>A (p.Arg2453His) rs587781361
NM_000051.3(ATM):c.7383C>T (p.Arg2461=) rs1429991894
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7425A>G (p.Leu2475=) rs1555123162
NM_000051.3(ATM):c.7450G>A (p.Val2484Ile) rs587779864
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7515+20A>G rs80124497
NM_000051.3(ATM):c.7516-9delT rs573494809
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7629+12_7629+15delTGAA rs1555124156
NM_000051.3(ATM):c.7629+13G>A rs563651647
NM_000051.3(ATM):c.7629_7629+4delTGTAA rs876660041
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7699_7702delAACA (p.Asn2567Glufs) rs1060501547
NM_000051.3(ATM):c.7705_7706delGA (p.Asp2569Terfs) rs759965045
NM_000051.3(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.3(ATM):c.7757A>G (p.Asn2586Ser) rs587778079
NM_000051.3(ATM):c.7767delA (p.Lys2589Asnfs) rs1057517025
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7838_7839dupGA (p.Pro2614Aspfs) rs730881293
NM_000051.3(ATM):c.7858delG (p.Val2620Leufs) rs1555125349
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7880delA (p.Tyr2627Leufs) rs1057516599
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7921C>T (p.Gln2641Ter) rs769523686
NM_000051.3(ATM):c.7927+10T>C rs730881277
NM_000051.3(ATM):c.7927+5delG rs786204437
NM_000051.3(ATM):c.7927+6dupT rs587781324
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7951C>T (p.Gln2651Ter) rs587781994
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.7985T>A (p.Val2662Asp) rs863224463
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.7989_7991delTGT (p.Val2664del) rs876660743
NM_000051.3(ATM):c.7997C>A (p.Thr2666Asn) rs730881384
NM_000051.3(ATM):c.7998dupT (p.Met2667Tyrfs) rs587779869
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8046T>C (p.Thr2682=) rs876660435
NM_000051.3(ATM):c.8100A>G (p.Lys2700=) rs778601472
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8146G>T (p.Val2716Phe) rs730881385
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8217G>A (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8268+6T>A rs747153940
NM_000051.3(ATM):c.8269-10_8269-9delGT rs587780641
NM_000051.3(ATM):c.8292_8293delTG (p.Ser2764Argfs) rs879254036
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8355T>C (p.Asp2785=) rs372834825
NM_000051.3(ATM):c.8371_8374delTACA (p.Tyr2791Glyfs) rs1064793046
NM_000051.3(ATM):c.8391T>C (p.Ser2797=) rs566485657
NM_000051.3(ATM):c.8395_8404delTTTCAGTGCC (p.Phe2799Lysfs) rs786202800
NM_000051.3(ATM):c.8418+13C>T rs372552946
NM_000051.3(ATM):c.8419-16_8419-13delTATT rs774275044
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8495G>T (p.Arg2832Leu) rs529296539
NM_000051.3(ATM):c.8518T>C (p.Leu2840=) rs794727769
NM_000051.3(ATM):c.8530A>G (p.Ile2844Val) rs756230327
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8562C>T (p.Arg2854=) rs878853550
NM_000051.3(ATM):c.8565T>G (p.Ser2855Arg) rs780905851
NM_000051.3(ATM):c.8578_8580delTCT (p.Ser2860del) rs786203976
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8584+6C>G rs863224300
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8629T>C (p.Leu2877=) rs730881279
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8763G>A (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+20G>C rs56283878
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8793T>A (p.Cys2931Ter) rs1555143494
NM_000051.3(ATM):c.8802delC (p.Met2935Trpfs) rs876660567
NM_000051.3(ATM):c.8814_8824delGAGAAACTCTC (p.Met2938Ilefs) rs758814126
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8876_8879delACTG (p.Asp2959Glyfs) rs786204726
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8987+10A>G rs1060504308
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.8998C>T (p.Gln3000Ter) rs587781698
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.9019G>T (p.Glu3007Ter) rs876660382
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9049C>T (p.Leu3017=) rs876658991
NM_000051.3(ATM):c.9064dupG (p.Glu3022Glyfs) rs1057516282
NM_000051.3(ATM):c.9079dupA (p.Ser3027Lysfs) rs587780645
NM_000051.3(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000051.3(ATM):c.9166G>T (p.Val3056Leu) rs371767164

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.