ClinVar Miner

Variants in gene CDKN2A with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
534 156 4 19 25 0 13 53

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 5 3 0 0
likely pathogenic 5 0 11 0 0
uncertain significance 3 11 2 24 5
likely benign 0 0 24 0 14
benign 0 0 5 14 2

All variants with conflicting interpretations #

Total variants: 53
Download table as spreadsheet
HGVS dbSNP
NM_000077.4(CDKN2A):c.*6C>G rs375628411
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.-19413C>G rs528789830
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.-34G>C rs1800586
NM_000077.4(CDKN2A):c.104G>C (p.Gly35Ala) rs746834149
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.150+12G>A rs1057520264
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000077.4(CDKN2A):c.151-4G>C rs529380972
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.174A>C (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.194T>C (p.Leu65Pro) rs1587332314
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.198C>T (p.His66=) rs374984975
NM_000077.4(CDKN2A):c.203C>T (p.Ala68Val) rs1060501260
NM_000077.4(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098
NM_000077.4(CDKN2A):c.210C>T (p.Pro70=) rs864622570
NM_000077.4(CDKN2A):c.225C>G (p.Pro75=) rs762397298
NM_000077.4(CDKN2A):c.246G>C (p.Val82=) rs1060504181
NM_000077.4(CDKN2A):c.250G>T (p.Asp84Tyr) rs11552822
NM_000077.4(CDKN2A):c.251A>C (p.Asp84Ala) rs587782792
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.272T>A (p.Leu91Gln) rs1563889362
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.322G>A (p.Asp108Asn) rs121913381
NM_000077.4(CDKN2A):c.335_337dup (p.Arg112dup) rs768966657
NM_000077.4(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.4(CDKN2A):c.342C>G (p.Pro114=) rs878853648
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.379G>C (p.Ala127Pro) rs6413464
NM_000077.4(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464
NM_000077.4(CDKN2A):c.384G>A (p.Arg128=) rs199901898
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000077.4(CDKN2A):c.47T>G (p.Leu16Arg) rs864622263
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.4(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.4(CDKN2A):c.95T>C (p.Leu32Pro) rs878853650
NM_058195.3(CDKN2A):c.358C>A (p.Arg120Ser) rs763269347
NM_058195.4(CDKN2A):c.69C>T (p.Phe23=) rs374360796

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.