ClinVar Miner

Variants in gene CDKN2A with conflicting interpretations "likely benign" and "uncertain significance"

Submission 1 (likely benign) minimum review status: Submission 1 (likely benign) method:
Submission 2 (uncertain significance) minimum review status: Submission 2 (uncertain significance) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 29
Download table as spreadsheet
HGVS dbSNP
NM_000077.4(CDKN2A):c.-19413C>G rs528789830
NM_000077.4(CDKN2A):c.-34G>C rs1800586
NM_000077.4(CDKN2A):c.150+12G>A rs1057520264
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000077.4(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.210C>T (p.Pro70=) rs864622570
NM_000077.4(CDKN2A):c.219C>G (p.Ala73=) rs730881679
NM_000077.4(CDKN2A):c.225C>G (p.Pro75=) rs762397298
NM_000077.4(CDKN2A):c.246G>C (p.Val82=) rs1060504181
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.272T>A (p.Leu91Gln) rs1563889362
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.282G>A (p.Leu94=) rs1064793589
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu) rs763269347
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.4(CDKN2A):c.342C>G (p.Pro114=) rs878853648
NM_000077.4(CDKN2A):c.351G>A (p.Leu117=) rs1060504182
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.434T>C (p.Ile145Thr) rs730881680
NM_000077.4(CDKN2A):c.45G>T (p.Trp15Cys) rs138677674
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) rs587780668
NM_000077.5(CDKN2A):c.151-7C>T

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.