ClinVar Miner

Variants in gene CDKN2A with conflicting interpretations "likely pathogenic" and "pathogenic"

Submission 1 (likely pathogenic) minimum review status: Submission 1 (likely pathogenic) method:
Submission 2 (pathogenic) minimum review status: Submission 2 (pathogenic) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 8
Download table as spreadsheet
NM_000077.4(CDKN2A):c.159G>A (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.335_337dup (p.Arg112dup) rs768966657
NM_000077.4(CDKN2A):c.47T>G (p.Leu16Arg) rs864622263
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000077.4(CDKN2A):c.95T>C (p.Leu32Pro) rs878853650
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.