ClinVar Miner

Variants in gene CDKN2A with conflicting interpretations "likely pathogenic" and "risk factor"

Submission 1 (likely pathogenic) minimum review status: Submission 1 (likely pathogenic) method:
Submission 2 (risk factor) minimum review status: Submission 2 (risk factor) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 2
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly) rs104894099

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.