ClinVar Miner

Variants in gene CNGB3 with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1124 45 1 31 22 0 6 53

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 19 2 0 0
likely pathogenic 19 0 4 1 0
uncertain significance 2 4 0 17 9
likely benign 0 1 17 1 12
benign 0 0 9 12 0

All variants with conflicting interpretations #

Total variants: 53
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_019098.5(CNGB3):c.80A>G (p.Asn27Ser) rs35807406 0.01728
NM_019098.5(CNGB3):c.354G>T (p.Pro118=) rs75858066 0.01037
NM_019098.5(CNGB3):c.1397T>C (p.Met466Thr) rs35010099 0.00978
NM_019098.5(CNGB3):c.1492T>A (p.Leu498Met) rs115246141 0.00350
NM_019098.5(CNGB3):c.2420C>G (p.Ala807Gly) rs142846289 0.00300
NM_019098.5(CNGB3):c.1405T>G (p.Tyr469Asp) rs35365413 0.00248
NM_019098.5(CNGB3):c.1148del (p.Thr383fs) rs397515360 0.00183
NM_019098.5(CNGB3):c.1208G>A (p.Arg403Gln) rs147876778 0.00119
NM_019098.5(CNGB3):c.2007A>G (p.Lys669=) rs147991883 0.00089
NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val) rs146062161 0.00086
NM_019098.5(CNGB3):c.913G>A (p.Ala305Thr) rs144637286 0.00070
NM_019098.5(CNGB3):c.1510A>G (p.Thr504Ala) rs140286824 0.00065
NM_019098.5(CNGB3):c.319G>A (p.Gly107Arg) rs146688972 0.00057
NM_019098.5(CNGB3):c.1368C>T (p.Arg456=) rs141934736 0.00054
NM_019098.5(CNGB3):c.2308G>T (p.Val770Phe) rs78239264 0.00031
NM_019098.5(CNGB3):c.912C>T (p.Val304=) rs117806701 0.00029
NM_019098.5(CNGB3):c.2415A>C (p.Glu805Asp) rs186448979 0.00025
NM_019098.5(CNGB3):c.2410A>T (p.Lys804Ter) rs151039691 0.00019
NM_019098.5(CNGB3):c.1898A>G (p.Asp633Gly) rs139337746 0.00017
NM_019098.5(CNGB3):c.474C>T (p.Pro158=) rs151230930 0.00016
NM_019098.5(CNGB3):c.1833C>T (p.His611=) rs368787128 0.00013
NM_019098.5(CNGB3):c.2086C>T (p.Arg696Ter) rs192448853 0.00009
NM_019098.5(CNGB3):c.503C>T (p.Thr168Met) rs755130011 0.00009
NM_019098.5(CNGB3):c.1006G>T (p.Glu336Ter) rs373862340 0.00007
NM_019098.5(CNGB3):c.2387A>G (p.Glu796Gly) rs781481819 0.00006
NM_019098.5(CNGB3):c.467C>T (p.Ser156Phe) rs139207764 0.00005
NM_019098.5(CNGB3):c.607C>T (p.Arg203Ter) rs267606739 0.00003
NM_019098.5(CNGB3):c.1320+4A>G rs1026427970 0.00002
NM_019098.5(CNGB3):c.1578+1G>A rs372006750 0.00002
NM_019098.5(CNGB3):c.2103+8G>A rs775059176 0.00002
NM_019098.5(CNGB3):c.646C>T (p.Arg216Ter) rs768345097 0.00002
NM_019098.5(CNGB3):c.1063C>T (p.Arg355Ter) rs764742792 0.00001
NM_019098.5(CNGB3):c.1306A>C (p.Ser436Arg) rs748354081 0.00001
NM_019098.5(CNGB3):c.2T>C (p.Met1Thr) rs1554619514 0.00001
NM_019098.5(CNGB3):c.644-1G>C rs201794629 0.00001
NM_019098.5(CNGB3):c.1098_1101dup (p.Ala368Ter) rs1057518098
NM_019098.5(CNGB3):c.1119G>A (p.Trp373Ter) rs786204762
NM_019098.5(CNGB3):c.112C>T (p.Gln38Ter) rs786204498
NM_019098.5(CNGB3):c.1214T>C (p.Leu405Ser) rs1178528306
NM_019098.5(CNGB3):c.1366del (p.Arg456fs) rs1057516878
NM_019098.5(CNGB3):c.1480+1G>A rs1057516825
NM_019098.5(CNGB3):c.1579-1G>A rs1057516504
NM_019098.5(CNGB3):c.1781+1del rs1554607546
NM_019098.5(CNGB3):c.212-6del rs745969238
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_019098.5(CNGB3):c.2313_2315del (p.Arg772del) rs758914061
NM_019098.5(CNGB3):c.339-10dup rs200792506
NM_019098.5(CNGB3):c.391C>T (p.Gln131Ter) rs786204492
NM_019098.5(CNGB3):c.446_447insT (p.Lys149fs) rs748993388
NM_019098.5(CNGB3):c.494-11dup rs36008065
NM_019098.5(CNGB3):c.843A>G (p.Gly281=) rs1200686449
NM_019098.5(CNGB3):c.886_896delinsT (p.Thr296fs) rs886063161
NM_019098.5(CNGB3):c.991-3T>G rs773372519

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.