Variants in gene CNGB3 with conflicting interpretations "benign" and "likely benign"

Submission 1 (benign) minimum review status:		Submission 1 (benign) method:
Submission 2 (likely benign) minimum review status:		Submission 2 (likely benign) method:
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants with conflicting interpretations: 12

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_019098.5(CNGB3):c.80A>G (p.Asn27Ser)	rs35807406	0.01728
NM_019098.5(CNGB3):c.354G>T (p.Pro118=)	rs75858066	0.01037
NM_019098.5(CNGB3):c.2420C>G (p.Ala807Gly)	rs142846289	0.00300
NM_019098.5(CNGB3):c.1405T>G (p.Tyr469Asp)	rs35365413	0.00248
NM_019098.5(CNGB3):c.1208G>A (p.Arg403Gln)	rs147876778	0.00119
NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val)	rs146062161	0.00086
NM_019098.5(CNGB3):c.1368C>T (p.Arg456=)	rs141934736	0.00054
NM_019098.5(CNGB3):c.912C>T (p.Val304=)	rs117806701	0.00029
NM_019098.5(CNGB3):c.2415A>C (p.Glu805Asp)	rs186448979	0.00025
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1])	rs746549330
NM_019098.5(CNGB3):c.339-10dup	rs200792506
NM_019098.5(CNGB3):c.494-11dup	rs36008065

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.