ClinVar Miner

Variants in gene CNGB3 with conflicting interpretations "uncertain significance" and "benign"

Submission 1 (uncertain significance) minimum review status: Submission 1 (uncertain significance) method:
Submission 2 (benign) minimum review status: Submission 2 (benign) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 9
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_019098.5(CNGB3):c.1397T>C (p.Met466Thr) rs35010099 0.00978
NM_019098.5(CNGB3):c.1492T>A (p.Leu498Met) rs115246141 0.00350
NM_019098.5(CNGB3):c.1208G>A (p.Arg403Gln) rs147876778 0.00119
NM_019098.5(CNGB3):c.2007A>G (p.Lys669=) rs147991883 0.00089
NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val) rs146062161 0.00086
NM_019098.5(CNGB3):c.1510A>G (p.Thr504Ala) rs140286824 0.00065
NM_019098.5(CNGB3):c.212-6del rs745969238
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_019098.5(CNGB3):c.339-10dup rs200792506

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.