ClinVar Miner

Variants in gene CNGB3 with conflicting interpretations "uncertain significance" and "likely benign"

Submission 1 (uncertain significance) minimum review status: Submission 1 (uncertain significance) method:
Submission 2 (likely benign) minimum review status: Submission 2 (likely benign) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 15
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_019098.5(CNGB3):c.1208G>A (p.Arg403Gln) rs147876778 0.00119
NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val) rs146062161 0.00086
NM_019098.5(CNGB3):c.913G>A (p.Ala305Thr) rs144637286 0.00070
NM_019098.5(CNGB3):c.319G>A (p.Gly107Arg) rs146688972 0.00057
NM_019098.5(CNGB3):c.2308G>T (p.Val770Phe) rs78239264 0.00031
NM_019098.5(CNGB3):c.2410A>T (p.Lys804Ter) rs151039691 0.00019
NM_019098.5(CNGB3):c.1898A>G (p.Asp633Gly) rs139337746 0.00017
NM_019098.5(CNGB3):c.474C>T (p.Pro158=) rs151230930 0.00016
NM_019098.5(CNGB3):c.1833C>T (p.His611=) rs368787128 0.00013
NM_019098.5(CNGB3):c.2086C>T (p.Arg696Ter) rs192448853 0.00009
NM_019098.5(CNGB3):c.2387A>G (p.Glu796Gly) rs781481819 0.00006
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_019098.5(CNGB3):c.2313_2315del (p.Arg772del) rs758914061
NM_019098.5(CNGB3):c.339-10dup rs200792506
NM_019098.5(CNGB3):c.843A>G (p.Gly281=) rs1200686449

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.