ClinVar Miner

Variants in gene LDB3 with conflicting interpretations "likely benign" and "uncertain significance"

Submission 1 (likely benign) minimum review status: Submission 1 (likely benign) method:
Submission 2 (uncertain significance) minimum review status: Submission 2 (uncertain significance) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 19
Download table as spreadsheet
HGVS dbSNP
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.723C>T (p.Ser241=) rs200580597
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.896+6722G>A rs144445130
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.