Variants in gene MAGEL2 with conflicting interpretations "uncertain significance" and "benign"

Submission 1 (uncertain significance) minimum review status:		Submission 1 (uncertain significance) method:
Submission 2 (benign) minimum review status:		Submission 2 (benign) method:
Gene type: Distinguish antisense genes from sense genes
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants with conflicting interpretations: 14

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu)	rs2233061	0.00353
NM_019066.5(MAGEL2):c.1470G>A (p.Pro490=)	rs771501846	0.00157
NM_019066.5(MAGEL2):c.406G>A (p.Gly136Arg)	rs570335069	0.00131
NM_019066.5(MAGEL2):c.385A>G (p.Met129Val)	rs188762916	0.00109
NM_019066.5(MAGEL2):c.2281G>C (p.Ala761Pro)	rs146970674	0.00083
NM_019066.5(MAGEL2):c.2362A>T (p.Ser788Cys)	rs113329438	0.00083
NM_019066.5(MAGEL2):c.919C>T (p.Pro307Ser)	rs555920534	0.00063
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met)	rs781777662	0.00040
NM_019066.5(MAGEL2):c.434C>T (p.Pro145Leu)	rs372352945	0.00019
NM_019066.5(MAGEL2):c.539T>C (p.Val180Ala)	rs58729661	0.00014
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2])	rs794726941
NM_019066.5(MAGEL2):c.1404CCCACCTGTGATCCGCCAGGC[1] (p.464VIRQAPP[3])	rs1386125417
NM_019066.5(MAGEL2):c.479CCCATCCTCCTCCTCCGGGGACCCCGATGG[1] (p.160AHPPPPGTPM[1])	rs751352401
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1])	rs528108868

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.