ClinVar Miner

Variants in gene TTN with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
13618 1232 2 1139 1679 1 52 2528

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign drug response protective other
pathogenic 2 61 14 0 0 0 0 0
likely pathogenic 62 0 36 6 1 1 1 1
uncertain significance 15 36 0 1623 397 1 1 1
likely benign 0 5 1622 0 1077 0 0 0
benign 1 1 397 1078 0 1 1 1

All variants with conflicting interpretations #

Total variants: 2528
Download table as spreadsheet
NM_001256850.1(TTN):c.18197-4A>G rs1025136671
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.39893-1G>A rs749705939
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.46387G>A rs200042932
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.*99dup rs11424072
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100058T>C (p.Ile33353Thr) rs138234724
NM_001267550.2(TTN):c.100059T>A (p.Ile33353=) rs56026369
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100116C>T (p.Phe33372=) rs770089807
NM_001267550.2(TTN):c.100167A>G (p.Pro33389=) rs778478048
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.100226G>A (p.Cys33409Tyr) rs201112096
NM_001267550.2(TTN):c.1002C>T (p.Thr334=) rs148094198
NM_001267550.2(TTN):c.100384G>A (p.Glu33462Lys) rs748104690
NM_001267550.2(TTN):c.100397G>A (p.Arg33466His) rs189626540
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100432T>G (p.Trp33478Gly) rs372304158
NM_001267550.2(TTN):c.100447G>C (p.Glu33483Gln) rs368321767
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.100467T>C (p.Ser33489=) rs794727540
NM_001267550.2(TTN):c.10049C>T (p.Pro3350Leu) rs139504522
NM_001267550.2(TTN):c.100534A>T (p.Asn33512Tyr) rs778965506
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.100642T>C (p.Phe33548Leu) rs773561397
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.100766-10del rs749872538
NM_001267550.2(TTN):c.100766-10dupT rs749872538
NM_001267550.2(TTN):c.100766-11_100766-10del rs749872538
NM_001267550.2(TTN):c.100766-9C>T rs77483833
NM_001267550.2(TTN):c.100825C>T (p.Arg33609Ter) rs1057518195
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100982G>A (p.Arg33661Lys) rs201857158
NM_001267550.2(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.10104T>G (p.Val3368=) rs142460433
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.101098delinsCT (p.Asp33700fs) rs794729367
NM_001267550.2(TTN):c.10114+5G>A rs115985443
NM_001267550.2(TTN):c.10115-4G>A rs367648529
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101245G>A (p.Val33749Met) rs201554140
NM_001267550.2(TTN):c.101262A>G (p.Gly33754=) rs374878689
NM_001267550.2(TTN):c.101291C>T (p.Ala33764Val) rs773542514
NM_001267550.2(TTN):c.101376T>C (p.Tyr33792=) rs367732133
NM_001267550.2(TTN):c.101378A>T (p.Asp33793Val) rs200675195
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101506T>A (p.Cys33836Ser) rs766439271
NM_001267550.2(TTN):c.101613G>A (p.Arg33871=) rs797046068
NM_001267550.2(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101708G>A (p.Arg33903His) rs72629782
NM_001267550.2(TTN):c.101728G>A (p.Glu33910Lys) rs943777958
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101890C>A (p.Arg33964Ser) rs779064623
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.102024A>G (p.Leu34008=) rs727504677
NM_001267550.2(TTN):c.102025T>C (p.Leu34009=) rs794727543
NM_001267550.2(TTN):c.102103G>A (p.Asp34035Asn) rs144963736
NM_001267550.2(TTN):c.102156G>T (p.Arg34052=) rs376894729
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102275G>A (p.Arg34092His) rs757918924
NM_001267550.2(TTN):c.102428T>C (p.Met34143Thr) rs397517786
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102524G>A (p.Arg34175Gln) rs201954720
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102562G>A (p.Glu34188Lys) rs577667352
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102827G>A (p.Arg34276Gln) rs199932621
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102885T>C (p.Gly34295=) rs886039175
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.10303+2T>C rs371596417
NM_001267550.2(TTN):c.103053C>T (p.Thr34351=) rs3731753
NM_001267550.2(TTN):c.103104A>G (p.Leu34368=) rs371535721
NM_001267550.2(TTN):c.103113T>C (p.Asn34371=) rs886042668
NM_001267550.2(TTN):c.103132C>T (p.Gln34378Ter)
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103207C>T (p.Leu34403=) rs773892755
NM_001267550.2(TTN):c.103246T>C (p.Leu34416=) rs1553492053
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103360del (p.Glu34454fs) rs760768093
NM_001267550.2(TTN):c.103363C>T (p.Arg34455Cys) rs72629785
NM_001267550.2(TTN):c.103365C>T (p.Arg34455=) rs398124462
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103524C>T (p.Val34508=) rs587780985
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103636C>T (p.Arg34546Cys) rs777626473
NM_001267550.2(TTN):c.103658T>C (p.Ile34553Thr) rs727505196
NM_001267550.2(TTN):c.103659AGA[2] (p.Glu34555del) rs759860918
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103781G>A (p.Arg34594His) rs3829747
NM_001267550.2(TTN):c.10378C>G (p.Pro3460Ala) rs201735487
NM_001267550.2(TTN):c.103859G>A (p.Arg34620His) rs367927066
NM_001267550.2(TTN):c.103909C>T (p.Arg34637Trp) rs200716930
NM_001267550.2(TTN):c.103912C>T (p.Arg34638Cys) rs374444254
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.103946G>A (p.Arg34649Gln) rs397517788
NM_001267550.2(TTN):c.103974C>T (p.Ile34658=) rs199714102
NM_001267550.2(TTN):c.104000T>C (p.Ile34667Thr) rs727504476
NM_001267550.2(TTN):c.104015C>T (p.Ala34672Val) rs79666048
NM_001267550.2(TTN):c.104082A>G (p.Ser34694=)
NM_001267550.2(TTN):c.104125C>T (p.Arg34709Cys) rs530959653
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104298T>C (p.Ala34766=) rs751788327
NM_001267550.2(TTN):c.104347C>T (p.Leu34783Phe) rs539735520
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104365G>A (p.Glu34789Lys) rs190565627
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104399del (p.Arg34800fs) rs747662439
NM_001267550.2(TTN):c.104413C>T (p.Arg34805Ter) rs750519430
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104457C>T (p.Tyr34819=) rs548677252
NM_001267550.2(TTN):c.104519G>A (p.Arg34840Gln) rs199710082
NM_001267550.2(TTN):c.104522G>A (p.Arg34841His) rs373709706
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104581C>T (p.Arg34861Cys) rs398124463
NM_001267550.2(TTN):c.104592G>A (p.Pro34864=) rs144094650
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104640G>A (p.Glu34880=) rs373134178
NM_001267550.2(TTN):c.104769A>C (p.Thr34923=) rs56375087
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104943A>G (p.Glu34981=) rs372312805
NM_001267550.2(TTN):c.104978C>T (p.Thr34993Met) rs368945564
NM_001267550.2(TTN):c.105049A>G (p.Thr35017Ala) rs368779151
NM_001267550.2(TTN):c.105090C>T (p.Asp35030=) rs72629789
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105127C>T (p.Arg35043Cys) rs200378865
NM_001267550.2(TTN):c.105128G>A (p.Arg35043His) rs370137295
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105182C>T (p.Ala35061Val) rs762136167
NM_001267550.2(TTN):c.105183G>A (p.Ala35061=) rs371075036
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105374C>T (p.Thr35125Met) rs747161494
NM_001267550.2(TTN):c.105383C>T (p.Ala35128Val) rs758458467
NM_001267550.2(TTN):c.105391A>G (p.Ile35131Val) rs779464128
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys) rs765274398
NM_001267550.2(TTN):c.105428del (p.Gly35143fs) rs886042825
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105485G>A (p.Trp35162Ter) rs886042795
NM_001267550.2(TTN):c.105491G>A (p.Arg35164His) rs768358201
NM_001267550.2(TTN):c.105514_105516del (p.Ser35172del) rs573843615
NM_001267550.2(TTN):c.105528_105535del (p.Gln35176fs) rs199469665
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105608T>C (p.Val35203Ala) rs771136390
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105754C>T (p.Arg35252Ter) rs886043924
NM_001267550.2(TTN):c.105757G>A (p.Val35253Met) rs373655492
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105787_105788delinsTT (p.Ala35263Phe) rs794729250
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.105805del (p.Thr35269fs) rs752787097
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.105940G>A (p.Ala35314Thr) rs377171054
NM_001267550.2(TTN):c.105999G>A (p.Gln35333=) rs764231632
NM_001267550.2(TTN):c.106044C>A (p.Asn35348Lys) rs145560044
NM_001267550.2(TTN):c.106100C>T (p.Thr35367Met) rs377056111
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106275G>C (p.Gly35425=) rs56207956
NM_001267550.2(TTN):c.106343G>A (p.Arg35448Gln) rs369703073
NM_001267550.2(TTN):c.106375-2A>G rs1553482872
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106468T>C (p.Tyr35490His) rs199663911
NM_001267550.2(TTN):c.106476T>C (p.Cys35492=) rs6725673
NM_001267550.2(TTN):c.106511G>C (p.Ser35504Thr) rs575070622
NM_001267550.2(TTN):c.106537A>G (p.Lys35513Glu) rs551063889
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106638G>A (p.Arg35546=) rs56324602
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106787C>T (p.Thr35596Ile) rs55842557
NM_001267550.2(TTN):c.106788A>T (p.Thr35596=) rs369896045
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106827T>G (p.Ile35609Met) rs727504540
NM_001267550.2(TTN):c.10682A>G (p.Gln3561Arg) rs727503676
NM_001267550.2(TTN):c.106837T>G (p.Ser35613Ala) rs374405802
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.1068G>A (p.Glu356=) rs144716589
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.106927G>A (p.Val35643Ile) rs754459138
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.10700G>A (p.Ser3567Asn) rs72955213
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107105C>T (p.Pro35702Leu) rs772957495
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107200G>A (p.Glu35734Lys) rs374992991
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107254C>T (p.Arg35752Cys) rs528535076
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.107301C>A (p.Ser35767Arg) rs1558965303
NM_001267550.2(TTN):c.107377+14C>T rs367908657
NM_001267550.2(TTN):c.107384T>C (p.Val35795Ala) rs549598246
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107517T>G (p.Ser35839Arg) rs776981475
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.107593G>A (p.Glu35865Lys) rs372841288
NM_001267550.2(TTN):c.107605A>G (p.Ser35869Gly) rs201835888
NM_001267550.2(TTN):c.107635C>T (p.Gln35879Ter) rs757082154
NM_001267550.2(TTN):c.107647T>G (p.Ser35883Ala) rs1553477432
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107766T>C (p.Gly35922=) rs147293964
NM_001267550.2(TTN):c.107915G>T (p.Ser35972Ile) rs397517478
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.10850C>T (p.Ser3617Phe) rs57389274
NM_001267550.2(TTN):c.1089G>A (p.Thr363=)
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.10931G>A (p.Ser3644Asn) rs78535378
NM_001267550.2(TTN):c.11019C>T (p.Cys3673=) rs72955212
NM_001267550.2(TTN):c.11183dup (p.Leu3729fs) rs778172350
NM_001267550.2(TTN):c.11254+2T>C rs199565715
NM_001267550.2(TTN):c.11311+1079_11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1080del rs58651353
NM_001267550.2(TTN):c.11311+1283C>T rs189445085
NM_001267550.2(TTN):c.11311+1341T>C rs200284932
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+1372C>T rs141407971
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+1644T>C rs142585268
NM_001267550.2(TTN):c.11311+1799G>C rs147314430
NM_001267550.2(TTN):c.11311+1893G>A rs145004106
NM_001267550.2(TTN):c.11311+1978T>A rs144209883
NM_001267550.2(TTN):c.11311+2007G>C rs200816462
NM_001267550.2(TTN):c.11311+2298A>G rs751724481
NM_001267550.2(TTN):c.11311+2465C>G rs116593093
NM_001267550.2(TTN):c.11311+2530C>A rs147087155
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2664T>C rs923904530
NM_001267550.2(TTN):c.11311+2791G>A rs143253411
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3248C>A rs72647899
NM_001267550.2(TTN):c.11311+3274G>T rs145460295
NM_001267550.2(TTN):c.11311+3423T>C rs185931752
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3703A>G rs144226338
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+3889G>A rs72648903
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4200C>T rs72648904
NM_001267550.2(TTN):c.11311+4313T>G rs200066725
NM_001267550.2(TTN):c.11311+4332C>T rs72648905
NM_001267550.2(TTN):c.11311+4338A>C rs139344272
NM_001267550.2(TTN):c.11311+4470A>G rs201945197
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4583A>C rs139172299
NM_001267550.2(TTN):c.11311+4587G>A rs77419653
NM_001267550.2(TTN):c.11311+4593T>G rs72648906
NM_001267550.2(TTN):c.11311+4660A>G rs140909116
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4739C>T rs551658963
NM_001267550.2(TTN):c.11311+4779A>G rs1466986172
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+4938C>T rs147513899
NM_001267550.2(TTN):c.11311+4968T>C rs139669372
NM_001267550.2(TTN):c.11311+5051T>C rs142132973
NM_001267550.2(TTN):c.11311+5213A>G rs144905085
NM_001267550.2(TTN):c.11311+5216G>A rs150615457
NM_001267550.2(TTN):c.11311+5250T>A rs776361113
NM_001267550.2(TTN):c.11311+5340C>T rs148105798
NM_001267550.2(TTN):c.11311+5478T>G rs72648908
NM_001267550.2(TTN):c.11311+5530A>T rs72648909
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11312-3866G>A rs145932311
NM_001267550.2(TTN):c.11312-3971G>C rs16866489
NM_001267550.2(TTN):c.11312-4085G>A rs148147002
NM_001267550.2(TTN):c.11312-4151T>C rs145183384
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-4404A>G rs372044281
NM_001267550.2(TTN):c.11312-4459T>C rs200378944
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.11312-4498G>A rs186841908
NM_001267550.2(TTN):c.11312-4711T>A rs138826545
NM_001267550.2(TTN):c.11312-4904G>A rs62179016
NM_001267550.2(TTN):c.11312-5166C>A rs376396183
NM_001267550.2(TTN):c.11312-5177A>G rs142973956
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.11312-5252C>T rs201137248
NM_001267550.2(TTN):c.11312-5286C>T rs200953966
NM_001267550.2(TTN):c.11312-8C>A rs374893678
NM_001267550.2(TTN):c.11337C>T (p.Ala3779=) rs375603989
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11370A>G (p.Gln3790=) rs72648918
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11614G>A (p.Gly3872Ser) rs754936734
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11788G>A (p.Glu3930Lys) rs186624523
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.11910A>T (p.Thr3970=) rs727503660
NM_001267550.2(TTN):c.11959A>G (p.Ile3987Val) rs551387805
NM_001267550.2(TTN):c.11969C>T (p.Pro3990Leu) rs33971253
NM_001267550.2(TTN):c.11991T>C (p.Ile3997=) rs565546452
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12016_12019dup (p.Gly4007fs) rs1553940935
NM_001267550.2(TTN):c.12117C>T (p.Pro4039=) rs55895721
NM_001267550.2(TTN):c.1213G>A (p.Ala405Thr) rs112266780
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12235A>G (p.Ile4079Val) rs34070843
NM_001267550.2(TTN):c.12307T>C (p.Leu4103=) rs587780988
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12404A>G (p.Asn4135Ser) rs565638291
NM_001267550.2(TTN):c.12405del (p.Asn4135fs) rs727503658
NM_001267550.2(TTN):c.1245+20G>T rs371234481
NM_001267550.2(TTN):c.1246-16G>A rs72647847
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12564C>A (p.Ala4188=) rs547338168
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.12587C>A (p.Ser4196Ter) rs370912401
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12733A>C (p.Asn4245His) rs199652066
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.12780G>T (p.Ala4260=) rs746578
NM_001267550.2(TTN):c.12821G>A (p.Ser4274Asn) rs200348414
NM_001267550.2(TTN):c.1288G>A (p.Val430Ile) rs371639583
NM_001267550.2(TTN):c.12955G>A (p.Ala4319Thr) rs150137596
NM_001267550.2(TTN):c.1297G>A (p.Val433Ile) rs146000949
NM_001267550.2(TTN):c.12986G>A (p.Arg4329Lys) rs199560188
NM_001267550.2(TTN):c.13090G>A (p.Val4364Met) rs201506104
NM_001267550.2(TTN):c.13194A>G (p.Gln4398=) rs375347596
NM_001267550.2(TTN):c.13202G>A (p.Arg4401Gln) rs200431386
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13281C>T (p.Val4427=) rs551703401
NM_001267550.2(TTN):c.13287T>C (p.Ala4429=) rs370604524
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13340C>T (p.Ser4447Leu) rs777547090
NM_001267550.2(TTN):c.13458C>T (p.Asp4486=) rs748885610
NM_001267550.2(TTN):c.13479T>G (p.Pro4493=) rs368698752
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13689C>T (p.Asp4563=) rs369466156
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.13976A>G (p.Tyr4659Cys) rs34706803
NM_001267550.2(TTN):c.1398+16C>T rs144043280
NM_001267550.2(TTN):c.1398+18A>G rs72647849
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.1398+5G>A rs542965530
NM_001267550.2(TTN):c.1399-3C>T rs397517486
NM_001267550.2(TTN):c.14004C>T (p.Thr4668=) rs201200682
NM_001267550.2(TTN):c.14049C>T (p.Ser4683=) rs370208081
NM_001267550.2(TTN):c.14092+20del rs560021681
NM_001267550.2(TTN):c.14189G>A (p.Arg4730Gln) rs202017278
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.1447G>A (p.Ala483Thr) rs34337578
NM_001267550.2(TTN):c.14486A>C (p.Gln4829Pro) rs375177753
NM_001267550.2(TTN):c.1449C>T (p.Ala483=) rs141617218
NM_001267550.2(TTN):c.1450G>A (p.Asp484Asn) rs768211726
NM_001267550.2(TTN):c.14525G>A (p.Arg4842Lys) rs2742347
NM_001267550.2(TTN):c.14533G>A (p.Asp4845Asn) rs373378672
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14588G>A (p.Gly4863Glu) rs375680312
NM_001267550.2(TTN):c.14639C>T (p.Ala4880Val) rs373683445
NM_001267550.2(TTN):c.14697C>T (p.Ser4899=) rs372740215
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14746A>G (p.Lys4916Glu) rs376597173
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14784C>A (p.Leu4928=) rs373875040
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14813T>C (p.Phe4938Ser) rs560537668
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.14898T>C (p.Ala4966=) rs370105333
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14935+9C>T rs544241749
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.15086G>A (p.Arg5029Gln) rs200792058
NM_001267550.2(TTN):c.15178G>A (p.Val5060Ile) rs72648929
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15185G>A (p.Ser5062Asn) rs371687650
NM_001267550.2(TTN):c.1537-4G>A rs56006378
NM_001267550.2(TTN):c.15430G>A (p.Glu5144Lys) rs766612317
NM_001267550.2(TTN):c.15497-8T>C rs727505010
NM_001267550.2(TTN):c.15542G>C (p.Gly5181Ala) rs201185434
NM_001267550.2(TTN):c.15544G>A (p.Gly5182Arg) rs775552018
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15561G>A (p.Leu5187=) rs779159076
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15584A>G (p.Glu5195Gly) rs72648931
NM_001267550.2(TTN):c.15659A>G (p.Asn5220Ser) rs565670799
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.15717G>A (p.Thr5239=) rs72648932
NM_001267550.2(TTN):c.15822A>T (p.Ala5274=) rs779456916
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15860C>T (p.Thr5287Met) rs148551876
NM_001267550.2(TTN):c.15906C>T (p.Val5302=) rs375179152
NM_001267550.2(TTN):c.15922C>T (p.Arg5308Ter) rs886042995
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16055-9A>C rs368897883
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16057C>A (p.Arg5353=) rs267599069
NM_001267550.2(TTN):c.16078A>G (p.Thr5360Ala) rs749081117
NM_001267550.2(TTN):c.16091G>A (p.Arg5364His) rs200941841
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16121G>A (p.Cys5374Tyr) rs375577529
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.16288C>T (p.Arg5430Ter) rs772235481
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16422A>G (p.Gln5474=) rs371026448
NM_001267550.2(TTN):c.16477G>A (p.Gly5493Ser) rs377042940
NM_001267550.2(TTN):c.16480G>A (p.Gly5494Arg) rs727504697
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16550C>T (p.Ser5517Leu) rs769165258
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16738A>G (p.Asn5580Asp) rs376598696
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16934C>T (p.Pro5645Leu) rs370889765
NM_001267550.2(TTN):c.16959T>C (p.Asp5653=) rs770260995
NM_001267550.2(TTN):c.16964T>C (p.Met5655Thr) rs886044306
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17115C>T (p.Gly5705=) rs370036981
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17183-7C>T rs371785683
NM_001267550.2(TTN):c.17183-9T>C rs141687561
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17228G>A (p.Arg5743Gln) rs753892271
NM_001267550.2(TTN):c.17300G>A (p.Ser5767Asn) rs200692495
NM_001267550.2(TTN):c.17302G>A (p.Asp5768Asn) rs576904726
NM_001267550.2(TTN):c.17312C>G (p.Thr5771Ser) rs16866477
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17500G>A (p.Val5834Ile) rs727505221
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17596G>T (p.Gly5866Cys) rs753136638
NM_001267550.2(TTN):c.17686G>A (p.Glu5896Lys) rs561557554
NM_001267550.2(TTN):c.1776T>C (p.Asp592=) rs147081804
NM_001267550.2(TTN):c.177C>A (p.Ser59Arg) rs191057824
NM_001267550.2(TTN):c.177C>T (p.Ser59=) rs191057824
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17821A>G (p.Ile5941Val) rs397517487
NM_001267550.2(TTN):c.17833T>C (p.Ser5945Pro) rs776790387
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17910T>C (p.His5970=) rs1175537809
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.18037T>C (p.Tyr6013His) rs548015673
NM_001267550.2(TTN):c.18075C>T (p.Pro6025=) rs557350005
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.1815T>C (p.Thr605=) rs757604614
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.18295C>T (p.Leu6099Phe) rs370109572
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18363G>A (p.Gln6121=) rs375032616
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.1851A>C (p.Thr617=) rs727504530
NM_001267550.2(TTN):c.18531G>C (p.Val6177=) rs370684491
NM_001267550.2(TTN):c.18542G>A (p.Arg6181Gln)
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18557C>T (p.Thr6186Met) rs200359082
NM_001267550.2(TTN):c.18561G>A (p.Ala6187=) rs377556808
NM_001267550.2(TTN):c.18655G>A (p.Glu6219Lys) rs72648948
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18663A>C (p.Glu6221Asp) rs369544339
NM_001267550.2(TTN):c.18669G>A (p.Thr6223=) rs772600691
NM_001267550.2(TTN):c.18720A>G (p.Arg6240=) rs201395913
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18777C>A (p.Thr6259=) rs750180579
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19016A>G (p.Tyr6339Cys) rs192553687
NM_001267550.2(TTN):c.19036G>A (p.Val6346Met) rs537966944
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19190C>T (p.Thr6397Met) rs199564845
NM_001267550.2(TTN):c.19191G>A (p.Thr6397=) rs140495148
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19301G>A (p.Ser6434Asn) rs11888217
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.1938+10G>C rs190935632
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19541G>T (p.Trp6514Leu) rs760007747
NM_001267550.2(TTN):c.19547A>T (p.Lys6516Met) rs199796249
NM_001267550.2(TTN):c.19677A>C (p.Ala6559=) rs372654116
NM_001267550.2(TTN):c.19715-4A>G rs375009631
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.197C>T (p.Thr66Met) rs372755739
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.19881G>A (p.Ser6627=) rs371495674
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19963G>A (p.Asp6655Asn) rs397517493
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.19995A>T (p.Glu6665Asp) rs146828735
NM_001267550.2(TTN):c.20025C>A (p.Ala6675=) rs373842558
NM_001267550.2(TTN):c.20057G>A (p.Arg6686Gln) rs202022304
NM_001267550.2(TTN):c.20108G>A (p.Arg6703Gln) rs546821182
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20236G>A (p.Ala6746Thr) rs202108224
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.20465A>G (p.Asn6822Ser) rs371518764
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.20861C>T (p.Ala6954Val) rs17355446
NM_001267550.2(TTN):c.20874G>A (p.Thr6958=) rs765956215
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21003A>G (p.Lys7001=) rs727504579
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.210G>T (p.Val70=) rs746033038
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21273A>G (p.Gln7091=) rs878903172
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21404-8C>G rs761542135
NM_001267550.2(TTN):c.21475G>A (p.Val7159Ile) rs371267140
NM_001267550.2(TTN):c.21489C>G (p.Thr7163=) rs376882041
NM_001267550.2(TTN):c.2151C>T (p.Pro717=) rs374570732
NM_001267550.2(TTN):c.21521C>T (p.Ala7174Val) rs764832849
NM_001267550.2(TTN):c.21544C>T (p.Arg7182Trp) rs727504736
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21570T>G (p.Thr7190=) rs889991615
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21642C>T (p.Asn7214=) rs752620885
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21721G>A (p.Val7241Ile) rs367854582
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.21785C>G (p.Thr7262Ser) rs200954184
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21962-6C>T rs374870814
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.2206G>A (p.Gly736Arg) rs876658047
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22080T>C (p.Asp7360=) rs16866473
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2229C>T (p.Ala743=) rs746990488
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22384G>C (p.Asp7462His) rs12693166
NM_001267550.2(TTN):c.22386T>A (p.Asp7462Glu) rs183482849
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22576G>T (p.Val7526Phe)
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22629G>A (p.Pro7543=) rs776917811
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.2264C>T (p.Ser755Leu) rs533384820
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_001267550.2(TTN):c.22745_22746del (p.Ser7582fs) rs779549899
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.227G>C (p.Gly76Ala) rs138750421
NM_001267550.2(TTN):c.2280C>T (p.Val760=) rs727505021
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.22922C>T (p.Ser7641Leu) rs369508943
NM_001267550.2(TTN):c.22942G>A (p.Glu7648Lys) rs397517502
NM_001267550.2(TTN):c.22956T>C (p.Ser7652=) rs1004007215
NM_001267550.2(TTN):c.22968C>T (p.Asn7656=) rs201904848
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23067C>T (p.Asp7689=) rs191854953
NM_001267550.2(TTN):c.23076C>T (p.Cys7692=) rs769505705
NM_001267550.2(TTN):c.23091A>G (p.Thr7697=) rs1198504900
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23177C>T (p.Ser7726Leu) rs17452588
NM_001267550.2(TTN):c.23178G>A (p.Ser7726=) rs753546095
NM_001267550.2(TTN):c.23232C>G (p.Asn7744Lys) rs72648972
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23308G>A (p.Gly7770Arg)
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.23382T>A (p.Pro7794=) rs768874223
NM_001267550.2(TTN):c.23387G>A (p.Arg7796Gln) rs267599059
NM_001267550.2(TTN):c.23444G>A (p.Arg7815Gln) rs372804810
NM_001267550.2(TTN):c.23455G>C (p.Glu7819Gln) rs201420077
NM_001267550.2(TTN):c.23469A>G (p.Pro7823=)
NM_001267550.2(TTN):c.23521A>T (p.Asn7841Tyr) rs753072306
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.23916C>T (p.Cys7972=)
NM_001267550.2(TTN):c.23925C>T (p.Ser7975=) rs374879942
NM_001267550.2(TTN):c.23939-13C>A rs876658045
NM_001267550.2(TTN):c.23965C>T (p.Arg7989Cys) rs201653851
NM_001267550.2(TTN):c.2396C>T (p.Thr799Met) rs149061352
NM_001267550.2(TTN):c.24045A>T (p.Ser8015=) rs1060503946
NM_001267550.2(TTN):c.24075T>G (p.Ile8025Met) rs371496970
NM_001267550.2(TTN):c.24107C>T (p.Ser8036Leu) rs200598509
NM_001267550.2(TTN):c.24114C>T (p.Asn8038=) rs199576800
NM_001267550.2(TTN):c.24150C>T (p.Ser8050=) rs185062935
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24160A>T (p.Ile8054Leu) rs72648976
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24227-15C>T rs397517505
NM_001267550.2(TTN):c.2422C>T (p.Arg808Cys) rs149155733
NM_001267550.2(TTN):c.2432C>T (p.Thr811Ile) rs35813871
NM_001267550.2(TTN):c.24431A>C (p.Glu8144Ala) rs16866465
NM_001267550.2(TTN):c.24454G>A (p.Val8152Ile) rs397517507
NM_001267550.2(TTN):c.24505+13C>T rs534803807
NM_001267550.2(TTN):c.24506-16T>C rs200319727
NM_001267550.2(TTN):c.24621C>T (p.Asp8207=) rs751733811
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24639A>C (p.Gln8213His) rs397517510
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24905C>A (p.Thr8302Lys) rs549604128
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25035C>T (p.Val8345=) rs781552736
NM_001267550.2(TTN):c.25064C>A (p.Ala8355Glu) rs2627043
NM_001267550.2(TTN):c.25065G>A (p.Ala8355=) rs397517514
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.2506G>A (p.Gly836Ser) rs751157908
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25126C>T (p.Pro8376Ser) rs375209098
NM_001267550.2(TTN):c.25134A>G (p.Ala8378=) rs371819104
NM_001267550.2(TTN):c.25145G>A (p.Arg8382His) rs199598066
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25223C>T (p.Thr8408Ile) rs201432372
NM_001267550.2(TTN):c.25274G>A (p.Ser8425Asn) rs13390491
NM_001267550.2(TTN):c.25351+13C>G rs138362885
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25570G>A (p.Gly8524Arg) rs371512914
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25660A>G (p.Lys8554Glu) rs201945791
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.25758C>T (p.Asp8586=) rs372802604
NM_001267550.2(TTN):c.25853G>A (p.Gly8618Glu) rs369947439
NM_001267550.2(TTN):c.25877A>G (p.Asn8626Ser) rs200355367
NM_001267550.2(TTN):c.25921+10C>T rs10183237
NM_001267550.2(TTN):c.25921+20G>A rs148460010
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25942A>G (p.Lys8648Glu) rs188234466
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.2599A>G (p.Ser867Gly) rs148631577
NM_001267550.2(TTN):c.25A>T (p.Thr9Ser)
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26056G>A (p.Gly8686Ser) rs370578197
NM_001267550.2(TTN):c.2605A>T (p.Thr869Ser) rs370962244
NM_001267550.2(TTN):c.2607T>C (p.Thr869=) rs143969192
NM_001267550.2(TTN):c.26116G>A (p.Asp8706Asn) rs377074955
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.2629C>A (p.Pro877Thr) rs751640052
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26408A>G (p.Asn8803Ser) rs12693164
NM_001267550.2(TTN):c.26439C>T (p.Asn8813=) rs200088963
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2649C>T (p.Phe883=) rs775588479
NM_001267550.2(TTN):c.2650G>A (p.Ala884Thr) rs772195446
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26599G>A (p.Gly8867Arg) rs762113080
NM_001267550.2(TTN):c.26619C>A (p.Asp8873Glu) rs772596633
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26681C>T (p.Pro8894Leu) rs13398235
NM_001267550.2(TTN):c.26682G>A (p.Pro8894=) rs142812510
NM_001267550.2(TTN):c.26694G>T (p.Gly8898=) rs199525540
NM_001267550.2(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-39TTTGT[10] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[12] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[5] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26762-39TTTGT[8] rs71393436
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.26765G>A (p.Arg8922Gln) rs397517520
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.26818G>A (p.Gly8940Ser) rs201005813
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26893G>A (p.Glu8965Lys) rs200325324
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26932G>C (p.Asp8978His) rs773744166
NM_001267550.2(TTN):c.26935A>C (p.Asn8979His) rs376982715
NM_001267550.2(TTN):c.26985C>A (p.Asp8995Glu) rs781351100
NM_001267550.2(TTN):c.26991A>C (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.27237C>T (p.Phe9079=)
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.27328+5G>A rs397517521
NM_001267550.2(TTN):c.2734C>T (p.Arg912Cys) rs371156190
NM_001267550.2(TTN):c.27350G>C (p.Arg9117Thr) rs375907742
NM_001267550.2(TTN):c.2744G>A (p.Arg915His) rs376922544
NM_001267550.2(TTN):c.27485C>T (p.Thr9162Met) rs199793620
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27592C>G (p.Gln9198Glu) rs72648995
NM_001267550.2(TTN):c.2760C>T (p.His920=) rs138788406
NM_001267550.2(TTN):c.27631T>C (p.Leu9211=) rs563954136
NM_001267550.2(TTN):c.2764C>T (p.Arg922Cys) rs72647862
NM_001267550.2(TTN):c.27652G>T (p.Val9218Phe) rs746558975
NM_001267550.2(TTN):c.27676T>C (p.Cys9226Arg) rs372820178
NM_001267550.2(TTN):c.27677G>A (p.Cys9226Tyr) rs369108107
NM_001267550.2(TTN):c.2767G>A (p.Glu923Lys) rs369195237
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.2775+19G>T rs199707799
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.27846C>T (p.Ser9282=) rs182355009
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.28042C>G (p.Gln9348Glu) rs794727987
NM_001267550.2(TTN):c.28055T>C (p.Leu9352Ser) rs776487201
NM_001267550.2(TTN):c.28070C>T (p.Thr9357Ile) rs144930507
NM_001267550.2(TTN):c.28094G>A (p.Arg9365Gln) rs570608843
NM_001267550.2(TTN):c.28127C>G (p.Thr9376Arg) rs749875409
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.28175-10C>T rs748478445
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28200C>T (p.Asp9400=) rs886044076
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28320C>T (p.Gly9440=) rs375083775
NM_001267550.2(TTN):c.28463-14G>A rs200917885
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28547G>A (p.Arg9516His) rs374156904
NM_001267550.2(TTN):c.28644G>A (p.Thr9548=) rs376744914
NM_001267550.2(TTN):c.28653G>C (p.Leu9551=) rs876657601
NM_001267550.2(TTN):c.28678G>A (p.Asp9560Asn) rs771843862
NM_001267550.2(TTN):c.28681G>A (p.Ala9561Thr) rs373380202
NM_001267550.2(TTN):c.28733C>T (p.Thr9578Met) rs184923756
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28924A>G (p.Ser9642Gly) rs367888853
NM_001267550.2(TTN):c.28970C>T (p.Ser9657Leu) rs200049911
NM_001267550.2(TTN):c.28971G>A (p.Ser9657=) rs370903846
NM_001267550.2(TTN):c.289G>A (p.Val97Met) rs185921345
NM_001267550.2(TTN):c.29042-2A>C rs6716782
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29144C>T (p.Ala9715Val) rs533172128
NM_001267550.2(TTN):c.29153T>C (p.Ile9718Thr) rs4893852
NM_001267550.2(TTN):c.2916G>A (p.Pro972=) rs757569345
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29219A>G (p.Asn9740Ser) rs753121692
NM_001267550.2(TTN):c.29230C>T (p.Arg9744Cys) rs375266859
NM_001267550.2(TTN):c.29245C>T (p.Gln9749Ter) rs746721983
NM_001267550.2(TTN):c.29317G>A (p.Ala9773Thr) rs371163094
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.29448AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.29541C>T (p.Phe9847=) rs56812642
NM_001267550.2(TTN):c.29577A>G (p.Gln9859=) rs368780181
NM_001267550.2(TTN):c.296-14T>C rs199951296
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.29937C>T (p.Ile9979=) rs878892843
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29963-13A>G rs72650008
NM_001267550.2(TTN):c.2998C>T (p.Leu1000Phe) rs140953779
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30088C>T (p.Pro10030Ser) rs368531555
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.3011A>C (p.Glu1004Ala) rs1413214135
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30231A>G (p.Pro10077=) rs74324101
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30282T>G (p.Ser10094=) rs886042543
NM_001267550.2(TTN):c.30283G>A (p.Ala10095Thr) rs201635835
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.3030C>T (p.Ser1010=) rs374346637
NM_001267550.2(TTN):c.30384T>C (p.Asp10128=) rs188584219
NM_001267550.2(TTN):c.30389G>A (p.Arg10130His) rs373355159
NM_001267550.2(TTN):c.30433+11T>G rs199848546
NM_001267550.2(TTN):c.30433+15A>T rs371872220
NM_001267550.2(TTN):c.30444G>A (p.Ser10148=) rs367901929
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30511+3G>A rs563582627
NM_001267550.2(TTN):c.30512-19dup rs397517532
NM_001267550.2(TTN):c.30513A>T (p.Glu10171Asp) rs577066020
NM_001267550.2(TTN):c.30619C>G (p.Pro10207Ala) rs781304514
NM_001267550.2(TTN):c.30683-17dup rs368277751
NM_001267550.2(TTN):c.30683-3del rs368277751
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30713A>G (p.Lys10238Arg) rs780073797
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30811A>G (p.Ile10271Val) rs182720979
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31070A>G (p.His10357Arg) rs1343660563
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31114G>C (p.Glu10372Gln) rs200831060
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31270+12G>T rs564264476
NM_001267550.2(TTN):c.31321G>A (p.Glu10441Lys) rs901197333
NM_001267550.2(TTN):c.3132C>T (p.Ala1044=) rs777315600
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31441A>G (p.Thr10481Ala) rs370208651
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31505C>T (p.Ser10502Leu) rs768632287
NM_001267550.2(TTN):c.31514-4del rs776720259
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.31564A>G (p.Ile10522Val) rs2042995
NM_001267550.2(TTN):c.3170T>C (p.Val1057Ala) rs145940356
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31763-6dup rs1192352676
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31846+1G>A rs794727043
NM_001267550.2(TTN):c.31846+5A>G rs760788961
NM_001267550.2(TTN):c.31847-17A>G rs72650025
NM_001267550.2(TTN):c.31864G>A (p.Gly10622Arg) rs2244492
NM_001267550.2(TTN):c.31875A>C (p.Thr10625=) rs182934463
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32049A>G (p.Lys10683=) rs375408527
NM_001267550.2(TTN):c.32070C>T (p.Val10690=) rs757316831
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32093G>A (p.Arg10698Gln) rs200161147
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32197+11G>A rs369265969
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.32367G>A (p.Lys10789=) rs79232842
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32470+4T>C rs1390842582
NM_001267550.2(TTN):c.32471-6C>T rs763361422
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32482C>T (p.Pro10828Ser)
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32555-6T>C rs375742678
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32593G>C (p.Val10865Leu) rs150733188
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32703G>A (p.Glu10901=) rs397517542
NM_001267550.2(TTN):c.32706G>A (p.Ala10902=) rs372124201
NM_001267550.2(TTN):c.32722+9G>A rs148231130
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.32767A>C (p.Lys10923Gln) rs367720439
NM_001267550.2(TTN):c.32792A>C (p.Glu10931Ala) rs370498307
NM_001267550.2(TTN):c.32807-10T>A rs138192315
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.32954G>C (p.Arg10985Pro) rs181395238
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.32971G>A (p.Glu10991Lys) rs201081803
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.33173-4G>A rs727504440
NM_001267550.2(TTN):c.33287G>A (p.Arg11096His) rs36051007
NM_001267550.2(TTN):c.33305G>A (p.Arg11102His) rs368777046
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33418+12C>A rs199772748
NM_001267550.2(TTN):c.33501AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33501AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33657G>A (p.Pro11219=) rs754038093
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33742+11A>G rs72650042
NM_001267550.2(TTN):c.33742+8C>T rs375939001
NM_001267550.2(TTN):c.33796C>T (p.Pro11266Ser) rs201120871
NM_001267550.2(TTN):c.3380+9A>G rs770149480
NM_001267550.2(TTN):c.33827-8C>T rs371318311
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33965C>T (p.Pro11322Leu) rs539800132
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.34092A>T (p.Leu11364=) rs765888527
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[1] (p.11363VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[3] (p.11363VLPEEEE[5]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34241AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34379-14T>C rs727505341
NM_001267550.2(TTN):c.34391A>G (p.Lys11464Arg) rs786205396
NM_001267550.2(TTN):c.34453+14G>A rs397517550
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34505G>T (p.Gly11502Val) rs190209925
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34660GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34675A>G (p.Ile11559Val) rs752903377
NM_001267550.2(TTN):c.34708+9G>T rs397517551
NM_001267550.2(TTN):c.34734A>G (p.Val11578=) rs866407525
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34856-17A>G rs188686309
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.34982T>C (p.Val11661Ala) rs199561793
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.35083G>A (p.Glu11695Lys) rs376117402
NM_001267550.2(TTN):c.35249T>C (p.Ile11750Thr) rs398124447
NM_001267550.2(TTN):c.35264A>C (p.Lys11755Thr) rs189966800
NM_001267550.2(TTN):c.35268G>A (p.Pro11756=) rs778338717
NM_001267550.2(TTN):c.35313G>A (p.Pro11771=) rs369739111
NM_001267550.2(TTN):c.35371G>T (p.Val11791Phe) rs200587998
NM_001267550.2(TTN):c.35794G>T (p.Glu11932Ter) rs878854299
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.36019G>C (p.Glu12007Gln)
NM_001267550.2(TTN):c.36044C>G (p.Thr12015Arg) rs199868380
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.36126A>C (p.Glu12042Asp) rs113231696
NM_001267550.2(TTN):c.3616G>T (p.Ala1206Ser) rs200749662
NM_001267550.2(TTN):c.36285C>T (p.His12095=) rs201184203
NM_001267550.2(TTN):c.36299A>T (p.Glu12100Val) rs73973133
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36461C>G (p.Pro12154Arg) rs371580084
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36625G>T (p.Val12209Leu) rs72650053
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.36701-16A>G rs577899845
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.36776C>T (p.Ala12259Val) rs755562550
NM_001267550.2(TTN):c.3680A>G (p.Lys1227Arg) rs541811273
NM_001267550.2(TTN):c.36855G>A (p.Pro12285=) rs535294541
NM_001267550.2(TTN):c.36949G>A (p.Ala12317Thr) rs1405466072
NM_001267550.2(TTN):c.36952G>A (p.Val12318Ile) rs762149243
NM_001267550.2(TTN):c.3713C>A (p.Thr1238Asn)
NM_001267550.2(TTN):c.37408G>T (p.Val12470Leu) rs398124448
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.37461A>T (p.Glu12487Asp) rs200021871
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.37722T>C (p.Val12574=) rs377422414
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38323C>T (p.Leu12775Phe) rs186232617
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38708-4T>C rs200819643
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.38929C>T (p.Pro12977Ser) rs150223722
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39045G>C (p.Val13015=) rs192464868
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39057G>A (p.Pro13019=) rs371945519
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39085C>A (p.Pro13029Thr) rs397517553
NM_001267550.2(TTN):c.39099T>C (p.Pro13033=) rs755793186
NM_001267550.2(TTN):c.39127+10A>C rs397517554
NM_001267550.2(TTN):c.39128-14T>C rs200916144
NM_001267550.2(TTN):c.39166G>T (p.Val13056Leu) rs727504201
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39212-9C>A rs373056460
NM_001267550.2(TTN):c.39230T>C (p.Val13077Ala) rs398124449
NM_001267550.2(TTN):c.39235G>A (p.Val13079Ile) rs777119867
NM_001267550.2(TTN):c.39250G>T (p.Val13084Leu) rs72650062
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39368C>T (p.Ala13123Val) rs761828404
NM_001267550.2(TTN):c.39375A>G (p.Pro13125=) rs566794300
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39473T>C (p.Val13158Ala) rs1553769611
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39690G>A (p.Ala13230=) rs528832388
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39709+6C>T rs72650067
NM_001267550.2(TTN):c.39709+9G>C rs765647346
NM_001267550.2(TTN):c.39731TTGCTCCTGAAGAGGAAA[1] (p.13244IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39813A>G (p.Pro13271=) rs373429851
NM_001267550.2(TTN):c.39885G>A (p.Pro13295=) rs756518824
NM_001267550.2(TTN):c.39919G>T (p.Val13307Phe) rs553280930
NM_001267550.2(TTN):c.39941C>A (p.Thr13314Asn) rs543338451
NM_001267550.2(TTN):c.40222+2TA[10] rs10580462
NM_001267550.2(TTN):c.40222+2TA[9] rs10580462
NM_001267550.2(TTN):c.40223A>G (p.Glu13408Gly) rs183950862
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40408+3dup rs727504922
NM_001267550.2(TTN):c.40408+7_40408+10dup rs397517560
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40502G>A (p.Arg13501His) rs571348685
NM_001267550.2(TTN):c.40515G>A (p.Pro13505=) rs367958537
NM_001267550.2(TTN):c.40557C>T (p.Ser13519=) rs371178429
NM_001267550.2(TTN):c.40558G>A (p.Val13520Ile) rs587780488
NM_001267550.2(TTN):c.40558G>C (p.Val13520Leu) rs587780488
NM_001267550.2(TTN):c.40576GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40581A>G (p.Glu13527=) rs775954427
NM_001267550.2(TTN):c.40587A>G (p.Glu13529=) rs370597107
NM_001267550.2(TTN):c.40595T>C (p.Val13532Ala) rs756446770
NM_001267550.2(TTN):c.40634-15_40634-11del rs375561641
NM_001267550.2(TTN):c.40634-9A>G rs373511249
NM_001267550.2(TTN):c.40788A>G (p.Glu13596=) rs886042511
NM_001267550.2(TTN):c.40796C>T (p.Thr13599Ile) rs370418677
NM_001267550.2(TTN):c.40877-7A>G rs727505201
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40927+16C>T rs369965589
NM_001267550.2(TTN):c.40939A>G (p.Lys13647Glu) rs777187629
NM_001267550.2(TTN):c.40963G>T (p.Glu13655Ter) rs727504198
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41019G>A (p.Pro13673=) rs762470432
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41166C>T (p.Asp13722=) rs143049740
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.41406C>T (p.Cys13802=) rs749356221
NM_001267550.2(TTN):c.41488G>A (p.Val13830Ile) rs149059189
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.41703T>C (p.Thr13901=) rs756282138
NM_001267550.2(TTN):c.41812A>G (p.Met13938Val) rs201725483
NM_001267550.2(TTN):c.41920G>A (p.Val13974Ile) rs373881831
NM_001267550.2(TTN):c.41931T>C (p.Tyr13977=) rs369128249
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.42024+6T>C rs140002940
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.42219C>T (p.Phe14073=) rs150612172
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42509T>C (p.Met14170Thr) rs369623392
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.42750G>A (p.Leu14250=) rs1273953637
NM_001267550.2(TTN):c.42783A>G (p.Lys14261=) rs16866425
NM_001267550.2(TTN):c.42839A>G (p.Asp14280Gly) rs181902304
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42847C>T (p.Arg14283Cys)
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42892G>A (p.Glu14298Lys) rs778634417
NM_001267550.2(TTN):c.42933T>C (p.Asn14311=) rs148528251
NM_001267550.2(TTN):c.42958A>G (p.Lys14320Glu) rs6723526
NM_001267550.2(TTN):c.42978C>T (p.Tyr14326=) rs369959066
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43255G>A (p.Val14419Ile) rs529018517
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.43315C>T (p.Arg14439Cys) rs200914097
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43481-16dup rs730880350
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43502C>G (p.Thr14501Ser) rs115825044
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43704A>G (p.Val14568=) rs368783829
NM_001267550.2(TTN):c.43748-7C>T rs771927358
NM_001267550.2(TTN):c.43836A>G (p.Ala14612=) rs755492644
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44014+19G>C rs139264089
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44112C>T (p.His14704=) rs754693395
NM_001267550.2(TTN):c.44210G>A (p.Arg14737His) rs373298007
NM_001267550.2(TTN):c.44210G>T (p.Arg14737Leu) rs373298007
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44282-6G>A rs372166634
NM_001267550.2(TTN):c.44323G>A (p.Val14775Met) rs540115992
NM_001267550.2(TTN):c.44367C>T (p.Tyr14789=) rs750270873
NM_001267550.2(TTN):c.44375T>A (p.Ile14792Asn) rs747654057
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44472T>C (p.Asp14824=)
NM_001267550.2(TTN):c.44529C>T (p.His14843=) rs55973744
NM_001267550.2(TTN):c.44548+9A>G rs372725070
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44599G>A (p.Gly14867Arg) rs144848584
NM_001267550.2(TTN):c.44734C>T (p.His14912Tyr) rs766391823
NM_001267550.2(TTN):c.44784T>C (p.Asp14928=) rs186105748
NM_001267550.2(TTN):c.44790G>A (p.Lys14930=) rs886042667
NM_001267550.2(TTN):c.44899C>T (p.Arg14967Ter) rs727505350
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.44987G>A (p.Arg14996His) rs762128685
NM_001267550.2(TTN):c.45014T>C (p.Leu15005Pro) rs369992659
NM_001267550.2(TTN):c.45053C>A (p.Ala15018Glu) rs72677221
NM_001267550.2(TTN):c.45053C>T (p.Ala15018Val) rs72677221
NM_001267550.2(TTN):c.45083-10A>G rs72677222
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45212T>C (p.Ile15071Thr) rs184078045
NM_001267550.2(TTN):c.45247C>T (p.Arg15083Trp) rs199834143
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45307C>T (p.Arg15103Ter) rs397517580
NM_001267550.2(TTN):c.45310C>T (p.Leu15104Phe) rs370782950
NM_001267550.2(TTN):c.45316_45320dup (p.Arg15108fs) rs794729390
NM_001267550.2(TTN):c.45328G>A (p.Asp15110Asn) rs17354992
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45567C>T (p.Tyr15189=) rs1455525236
NM_001267550.2(TTN):c.45594A>T (p.Ala15198=)
NM_001267550.2(TTN):c.45598G>A (p.Ala15200Thr) rs752318420
NM_001267550.2(TTN):c.45652C>T (p.Arg15218Trp) rs371621174
NM_001267550.2(TTN):c.45748A>T (p.Ser15250Cys) rs776190494
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.45979C>T (p.Arg15327Cys) rs367774903
NM_001267550.2(TTN):c.45994C>T (p.Leu15332=) rs765663809
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.46147G>C (p.Glu15383Gln) rs773073914
NM_001267550.2(TTN):c.46363G>A (p.Asp15455Asn) rs370813526
NM_001267550.2(TTN):c.46373G>A (p.Cys15458Tyr) rs377564388
NM_001267550.2(TTN):c.46386C>T (p.Cys15462=) rs147703145
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46489G>T (p.Val15497Phe) rs371299188
NM_001267550.2(TTN):c.46693G>T (p.Ala15565Ser) rs145520397
NM_001267550.2(TTN):c.46697-19_46697-18del rs530484268
NM_001267550.2(TTN):c.46800A>G (p.Glu15600=) rs190058852
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46880C>T (p.Ala15627Val) rs115813214
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47089C>T (p.Arg15697Cys) rs780334981
NM_001267550.2(TTN):c.47129G>A (p.Arg15710His) rs185689179
NM_001267550.2(TTN):c.47133A>G (p.Ala15711=) rs573218266
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47217C>T (p.Gly15739=) rs373305832
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47258G>A (p.Arg15753Lys) rs577133803
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47379C>T (p.Tyr15793=) rs374281025
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47516T>C (p.Ile15839Thr) rs764388462
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47598A>G (p.Leu15866=) rs879099244
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.47737C>T (p.Leu15913Phe) rs138576504
NM_001267550.2(TTN):c.47758A>C (p.Lys15920Gln) rs775513269
NM_001267550.2(TTN):c.47761-4G>A rs564918195
NM_001267550.2(TTN):c.47766C>T (p.Thr15922=) rs757006832
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47860G>A (p.Ala15954Thr) rs377037421
NM_001267550.2(TTN):c.47887A>G (p.Met15963Val) rs397517590
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48015_48016del (p.Asp16007fs) rs794729319
NM_001267550.2(TTN):c.48143T>C (p.Ile16048Thr) rs749678590
NM_001267550.2(TTN):c.48161-4del rs730880371
NM_001267550.2(TTN):c.48164G>A (p.Arg16055His) rs72677238
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48378_48380del (p.Leu16126del) rs561618839
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48395G>A (p.Arg16132His) rs397517593
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48595T>C (p.Ser16199Pro) rs752629624
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48638+5G>T rs397517594
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48827T>C (p.Ile16276Thr) rs759916327
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48960T>C (p.Asp16320=) rs1057523898
NM_001267550.2(TTN):c.49032G>A (p.Val16344=) rs587780980
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49263C>A (p.Tyr16421Ter)
NM_001267550.2(TTN):c.49263C>T (p.Tyr16421=) rs376188859
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49357C>A (p.Pro16453Thr) rs200121902
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49367G>A (p.Arg16456His) rs768914789
NM_001267550.2(TTN):c.49371A>T (p.Leu16457=) rs146163169
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49443A>C (p.Pro16481=) rs74321406
NM_001267550.2(TTN):c.49527A>G (p.Thr16509=) rs727505248
NM_001267550.2(TTN):c.49648+16T>C rs57677875
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49704A>G (p.Val16568=)
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49801G>T (p.Val16601Leu) rs773271774
NM_001267550.2(TTN):c.49814T>G (p.Val16605Gly) rs781195013
NM_001267550.2(TTN):c.49871G>A (p.Arg16624Gln) rs367566671
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49944G>A (p.Lys16648=) rs190021597
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.49998T>C (p.Asn16666=) rs376917681
NM_001267550.2(TTN):c.50059A>G (p.Ile16687Val) rs727504194
NM_001267550.2(TTN):c.50077G>A (p.Val16693Ile) rs377141765
NM_001267550.2(TTN):c.50083C>T (p.Arg16695Ter) rs751502842
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.5022C>G (p.Ala1674=) rs753444772
NM_001267550.2(TTN):c.50355-15T>C rs757425897
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50551+20C>T rs67636125
NM_001267550.2(TTN):c.50642G>C (p.Gly16881Ala) rs201302681
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50719A>G (p.Ile16907Val) rs750610895
NM_001267550.2(TTN):c.5073A>T (p.Glu1691Asp) rs770902874
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50774T>C (p.Val16925Ala) rs370067597
NM_001267550.2(TTN):c.50812G>C (p.Glu16938Gln) rs72677250
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.51249C>A (p.Val17083=) rs377342233
NM_001267550.2(TTN):c.51273G>A (p.Arg17091=) rs532589236
NM_001267550.2(TTN):c.51437-9G>A rs183060991
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51483G>A (p.Ala17161=) rs397517604
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51668G>A (p.Arg17223Gln) rs142395261
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51683C>T (p.Ala17228Val) rs370644359
NM_001267550.2(TTN):c.51712C>T (p.Pro17238Ser) rs773035917
NM_001267550.2(TTN):c.51739+14C>A rs727505018
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.51928GAA[2] (p.Glu17312del) rs780745206
NM_001267550.2(TTN):c.5198C>T (p.Thr1733Met) rs367700246
NM_001267550.2(TTN):c.51991G>C (p.Glu17331Gln) rs547986881
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52006G>A (p.Val17336Ile) rs567781604
NM_001267550.2(TTN):c.52008C>G (p.Val17336=) rs144507270
NM_001267550.2(TTN):c.52022G>A (p.Arg17341Gln) rs370390570
NM_001267550.2(TTN):c.52110G>A (p.Pro17370=) rs139789997
NM_001267550.2(TTN):c.52139A>T (p.Asp17380Val) rs373305248
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52242C>T (p.Pro17414=) rs765216874
NM_001267550.2(TTN):c.52243G>A (p.Asp17415Asn) rs397517609
NM_001267550.2(TTN):c.52290T>C (p.Tyr17430=) rs990974705
NM_001267550.2(TTN):c.52307_52310dup (p.Glu17437delinsAspTer) rs794729323
NM_001267550.2(TTN):c.52317A>G (p.Lys17439=) rs370450339
NM_001267550.2(TTN):c.5231C>T (p.Pro1744Leu) rs75686037
NM_001267550.2(TTN):c.52331G>A (p.Arg17444His) rs376080116
NM_001267550.2(TTN):c.52374T>C (p.Val17458=) rs752571545
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52536C>G (p.Asn17512Lys) rs199615557
NM_001267550.2(TTN):c.52553G>A (p.Arg17518His) rs559590585
NM_001267550.2(TTN):c.5255G>A (p.Arg1752His) rs150737838
NM_001267550.2(TTN):c.5264A>G (p.Asn1755Ser) rs201904897
NM_001267550.2(TTN):c.52656T>C (p.Pro17552=) rs371031259
NM_001267550.2(TTN):c.52702A>G (p.Ile17568Val) rs377571654
NM_001267550.2(TTN):c.52706-17A>G rs72646807
NM_001267550.2(TTN):c.52826A>T (p.Gln17609Leu) rs368820294
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52853G>A (p.Arg17618His) rs371538664
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.52920C>T (p.Tyr17640=) rs1553687219
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.52948G>A (p.Ala17650Thr) rs535008556
NM_001267550.2(TTN):c.52962G>A (p.Pro17654=) rs773148195
NM_001267550.2(TTN):c.53002+10G>A rs370352450
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53100T>G (p.Pro17700=) rs373140387
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53142T>C (p.Asp17714=) rs373316165
NM_001267550.2(TTN):c.5314A>G (p.Ser1772Gly) rs150725992
NM_001267550.2(TTN):c.53166C>T (p.Asn17722=) rs371730757
NM_001267550.2(TTN):c.53185C>T (p.Leu17729=) rs767559716
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.53226T>C (p.Tyr17742=) rs202200861
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53261T>C (p.Phe17754Ser) rs749312983
NM_001267550.2(TTN):c.53287+6G>A rs149890360
NM_001267550.2(TTN):c.53295T>C (p.Pro17765=) rs771792080
NM_001267550.2(TTN):c.53443A>G (p.Ile17815Val) rs368065637
NM_001267550.2(TTN):c.53507G>A (p.Arg17836His) rs373526624
NM_001267550.2(TTN):c.53625A>G (p.Thr17875=) rs373277508
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.53780T>C (p.Leu17927Pro) rs369678018
NM_001267550.2(TTN):c.53807G>A (p.Arg17936His) rs727503604
NM_001267550.2(TTN):c.53881+4C>T rs187632918
NM_001267550.2(TTN):c.53918del (p.Gly17973fs)
NM_001267550.2(TTN):c.54053A>T (p.Lys18018Met) rs368425364
NM_001267550.2(TTN):c.54054G>A (p.Lys18018=) rs761146363
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54104C>T (p.Ala18035Val) rs182445366
NM_001267550.2(TTN):c.54105G>A (p.Ala18035=) rs371155050
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54112del (p.Glu18038fs) rs794729325
NM_001267550.2(TTN):c.54115G>A (p.Asp18039Asn) rs765148928
NM_001267550.2(TTN):c.54140C>T (p.Ala18047Val) rs373815064
NM_001267550.2(TTN):c.54148C>T (p.Arg18050Cys) rs55734111
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54166C>T (p.Arg18056Ter) rs768431507
NM_001267550.2(TTN):c.54178G>A (p.Val18060Ile) rs190574498
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.54314G>A (p.Arg18105His) rs760383112
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.54360T>C (p.Thr18120=) rs749248039
NM_001267550.2(TTN):c.54381+6C>G rs368265962
NM_001267550.2(TTN):c.543C>T (p.Ser181=) rs758598014
NM_001267550.2(TTN):c.54477C>G (p.Val18159=) rs374335905
NM_001267550.2(TTN):c.54490T>C (p.Tyr18164His) rs370135374
NM_001267550.2(TTN):c.5464A>C (p.Met1822Leu) rs201581947
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54718G>A (p.Val18240Ile) rs375141729
NM_001267550.2(TTN):c.54740T>C (p.Met18247Thr) rs200585270
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.54811+10C>T rs796651993
NM_001267550.2(TTN):c.54812-5A>G rs375343798
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54855G>A (p.Thr18285=) rs200410212
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.55079C>T (p.Pro18360Leu) rs192788942
NM_001267550.2(TTN):c.55139T>C (p.Ile18380Thr) rs72646819
NM_001267550.2(TTN):c.55213C>T (p.Arg18405Cys)
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55306G>A (p.Glu18436Lys) rs201510986
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55378A>G (p.Thr18460Ala) rs727503600
NM_001267550.2(TTN):c.55379C>T (p.Thr18460Ile) rs372778818
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55432+5G>C rs754717390
NM_001267550.2(TTN):c.55449C>T (p.Pro18483=) rs187366691
NM_001267550.2(TTN):c.55452A>G (p.Lys18484=)
NM_001267550.2(TTN):c.55503G>A (p.Lys18501=) rs879239475
NM_001267550.2(TTN):c.55512C>T (p.Asp18504=) rs377164046
NM_001267550.2(TTN):c.55547T>C (p.Ile18516Thr) rs146608896
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55692T>A (p.Pro18564=) rs200864020
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.5582G>A (p.Arg1861His) rs140914855
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.55932T>C (p.Phe18644=) rs755839294
NM_001267550.2(TTN):c.55986C>T (p.Val18662=) rs747136342
NM_001267550.2(TTN):c.56019T>C (p.Thr18673=) rs183047238
NM_001267550.2(TTN):c.56051-12T>A rs147192175
NM_001267550.2(TTN):c.56101A>G (p.Asn18701Asp) rs1001238
NM_001267550.2(TTN):c.56118C>T (p.Ala18706=) rs1559671858
NM_001267550.2(TTN):c.56171A>G (p.Lys18724Arg) rs201091423
NM_001267550.2(TTN):c.561G>A (p.Ser187=) rs141444282
NM_001267550.2(TTN):c.56255C>T (p.Pro18752Leu) rs200132226
NM_001267550.2(TTN):c.56256G>A (p.Pro18752=) rs111262307
NM_001267550.2(TTN):c.56351G>A (p.Arg18784His) rs771284532
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.56456A>G (p.Asn18819Ser) rs201337786
NM_001267550.2(TTN):c.5645G>A (p.Arg1882His) rs374605213
NM_001267550.2(TTN):c.56461G>A (p.Val18821Ile) rs1576247575
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56686G>A (p.Val18896Met) rs370629962
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.56871C>T (p.Ser18957=) rs370619063
NM_001267550.2(TTN):c.56884C>T (p.Arg18962Trp) rs556286196
NM_001267550.2(TTN):c.56910C>T (p.Gly18970=) rs148299739
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56943G>A (p.Ala18981=) rs370998052
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56960T>C (p.Ile18987Thr) rs373351577
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.56970T>C (p.Pro18990=) rs372019333
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.5698G>A (p.Val1900Met) rs750823043
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57242T>C (p.Ile19081Thr) rs78509062
NM_001267550.2(TTN):c.57243T>A (p.Ile19081=) rs1185555417
NM_001267550.2(TTN):c.57263-4C>T rs373552048
NM_001267550.2(TTN):c.57273C>T (p.Asp19091=) rs587780489
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.57360T>A (p.Pro19120=) rs778995340
NM_001267550.2(TTN):c.57369C>T (p.Thr19123=) rs199742163
NM_001267550.2(TTN):c.5739C>T (p.Thr1913=) rs530291008
NM_001267550.2(TTN):c.57405A>G (p.Gln19135=)
NM_001267550.2(TTN):c.5740G>A (p.Ala1914Thr) rs118161093
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.5742G>A (p.Ala1914=) rs368719553
NM_001267550.2(TTN):c.57442A>G (p.Met19148Val) rs188185141
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57478G>A (p.Val19160Ile) rs200778464
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57544+7dup rs750881309
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57648C>T (p.Ile19216=) rs55956577
NM_001267550.2(TTN):c.57656A>T (p.Tyr19219Phe) rs201541213
NM_001267550.2(TTN):c.57682C>T (p.Arg19228Cys) rs757820671
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.57769C>T (p.Arg19257Ter) rs794729275
NM_001267550.2(TTN):c.57808G>C (p.Val19270Leu) rs369440319
NM_001267550.2(TTN):c.57847+19del rs111496283
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.58008T>C (p.Asn19336=) rs770525693
NM_001267550.2(TTN):c.58017G>C (p.Leu19339Phe) rs368025965
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58191G>A (p.Thr19397=) rs370091658
NM_001267550.2(TTN):c.58205A>G (p.Glu19402Gly) rs886042539
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58299T>G (p.Thr19433=) rs778334134
NM_001267550.2(TTN):c.583+5G>A rs397517663
NM_001267550.2(TTN):c.58397G>C (p.Gly19466Ala) rs201922910
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58433-16dup rs758370659
NM_001267550.2(TTN):c.58436G>A (p.Arg19479His) rs2288569
NM_001267550.2(TTN):c.58470T>A (p.Asp19490Glu) rs374118468
NM_001267550.2(TTN):c.5855A>G (p.His1952Arg) rs572691153
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58612A>G (p.Thr19538Ala) rs200017524
NM_001267550.2(TTN):c.58613C>A (p.Thr19538Lys) rs370686112
NM_001267550.2(TTN):c.58653T>C (p.Ile19551=) rs727504980
NM_001267550.2(TTN):c.5875T>A (p.Phe1959Ile) rs562856820
NM_001267550.2(TTN):c.58796C>T (p.Thr19599Ile) rs367816473
NM_001267550.2(TTN):c.587AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.58841T>C (p.Ile19614Thr) rs199933004
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.58933C>T (p.Leu19645=) rs2303836
NM_001267550.2(TTN):c.58971A>C (p.Glu19657Asp) rs200728232
NM_001267550.2(TTN):c.59113C>T (p.Arg19705Cys) rs72646839
NM_001267550.2(TTN):c.59236G>A (p.Gly19746Ser) rs372802352
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59315C>T (p.Pro19772Leu) rs72646840
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59319G>A (p.Glu19773=) rs367622770
NM_001267550.2(TTN):c.59322A>G (p.Pro19774=) rs188063446
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.59474G>C (p.Arg19825Thr) rs376465623
NM_001267550.2(TTN):c.59502T>C (p.Asp19834=) rs972823319
NM_001267550.2(TTN):c.59585C>T (p.Pro19862Leu) rs16866406
NM_001267550.2(TTN):c.59657T>G (p.Val19886Gly) rs755949982
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.597A>G (p.Val199=) rs144214844
NM_001267550.2(TTN):c.59835C>T (p.Asn19945=) rs72646842
NM_001267550.2(TTN):c.59849G>A (p.Arg19950Gln) rs374914334
NM_001267550.2(TTN):c.59926+1G>A rs553526525
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.59937G>A (p.Gly19979=) rs727505101
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.59943C>A (p.Pro19981=) rs202017608
NM_001267550.2(TTN):c.60008G>A (p.Arg20003His) rs756091180
NM_001267550.2(TTN):c.60055G>A (p.Glu20019Lys) rs201487340
NM_001267550.2(TTN):c.60146G>A (p.Arg20049His) rs200455644
NM_001267550.2(TTN):c.60198G>A (p.Pro20066=) rs767152563
NM_001267550.2(TTN):c.60232G>A (p.Val20078Met) rs77351975
NM_001267550.2(TTN):c.60342C>T (p.Thr20114=) rs529529087
NM_001267550.2(TTN):c.60490G>C (p.Val20164Leu) rs72646843
NM_001267550.2(TTN):c.60654G>A (p.Thr20218=) rs776141268
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60821C>T (p.Pro20274Leu) rs72646845
NM_001267550.2(TTN):c.61029T>C (p.Phe20343=) rs6706088
NM_001267550.2(TTN):c.61099C>T (p.Arg20367Trp) rs727504479
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.61138C>A (p.Leu20380Met) rs201167216
NM_001267550.2(TTN):c.61224G>A (p.Val20408=) rs566188777
NM_001267550.2(TTN):c.61289G>A (p.Cys20430Tyr) rs527704660
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61355T>A (p.Ile20452Asn) rs375946418
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.61462G>A (p.Val20488Met)
NM_001267550.2(TTN):c.61556G>A (p.Arg20519Gln) rs727504191
NM_001267550.2(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_001267550.2(TTN):c.61696G>A (p.Val20566Ile) rs764777213
NM_001267550.2(TTN):c.61825C>T (p.Arg20609Cys) rs786205389
NM_001267550.2(TTN):c.61876C>T (p.Arg20626Ter) rs72646846
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.61962C>T (p.Ile20654=) rs369710636
NM_001267550.2(TTN):c.62030T>C (p.Ile20677Thr) rs558670891
NM_001267550.2(TTN):c.62097A>G (p.Pro20699=) rs774995592
NM_001267550.2(TTN):c.62098A>G (p.Asn20700Asp) rs151193056
NM_001267550.2(TTN):c.62178T>C (p.Thr20726=) rs72646847
NM_001267550.2(TTN):c.62217T>A (p.Tyr20739Ter) rs727503586
NM_001267550.2(TTN):c.62275G>A (p.Glu20759Lys) rs562680371
NM_001267550.2(TTN):c.62280T>C (p.Val20760=) rs372065796
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62432A>G (p.Asp20811Gly) rs72646849
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62506C>T (p.Arg20836Ter) rs757231565
NM_001267550.2(TTN):c.62507G>A (p.Arg20836Gln) rs201693851
NM_001267550.2(TTN):c.62534C>G (p.Thr20845Arg) rs727505316
NM_001267550.2(TTN):c.62547G>A (p.Thr20849=) rs368969893
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62611C>G (p.Leu20871Val) rs767670018
NM_001267550.2(TTN):c.62723G>A (p.Arg20908Gln) rs377203669
NM_001267550.2(TTN):c.62931AGA[1] (p.Glu20979del) rs727505236
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63026G>A (p.Arg21009Gln) rs72646851
NM_001267550.2(TTN):c.6303C>T (p.Val2101=) rs937168906
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63137T>C (p.Ile21046Thr)
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63181C>T (p.Pro21061Ser) rs375401971
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63464G>A (p.Arg21155His)
NM_001267550.2(TTN):c.63516G>A (p.Pro21172=) rs372493799
NM_001267550.2(TTN):c.6353T>C (p.Ile2118Thr) rs56404770
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63581T>C (p.Leu21194Pro) rs367838375
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.6359G>A (p.Arg2120Gln) rs141142920
NM_001267550.2(TTN):c.6359G>T (p.Arg2120Leu) rs141142920
NM_001267550.2(TTN):c.63601C>T (p.Arg21201Ter) rs764243269
NM_001267550.2(TTN):c.63625C>T (p.Arg21209Ter) rs794729279
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.63743T>C (p.Leu21248Pro) rs745323281
NM_001267550.2(TTN):c.63775G>A (p.Val21259Ile) rs371286595
NM_001267550.2(TTN):c.63876C>T (p.Asn21292=) rs199598302
NM_001267550.2(TTN):c.63877G>A (p.Asp21293Asn) rs199505416
NM_001267550.2(TTN):c.63879C>T (p.Asp21293=) rs200463088
NM_001267550.2(TTN):c.63907G>A (p.Val21303Met) rs372812312
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.63921G>A (p.Glu21307=) rs1466883677
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.63960T>A (p.Val21320=) rs397517655
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64101G>A (p.Pro21367=) rs397517657
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64175G>A (p.Arg21392His) rs777176324
NM_001267550.2(TTN):c.64208C>T (p.Thr21403Ile) rs2042996
NM_001267550.2(TTN):c.6420T>A (p.Asp2140Glu) rs777009984
NM_001267550.2(TTN):c.64283T>C (p.Val21428Ala) rs1576014979
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.64673-5T>C rs530496528
NM_001267550.2(TTN):c.64680dup (p.Gly21561fs) rs794729330
NM_001267550.2(TTN):c.64683C>G (p.Gly21561=) rs542156552
NM_001267550.2(TTN):c.64688del (p.Pro21563fs) rs774395395
NM_001267550.2(TTN):c.64720G>A (p.Ala21574Thr) rs578085621
NM_001267550.2(TTN):c.64762G>A (p.Gly21588Arg) rs181717727
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.6478A>G (p.Thr2160Ala) rs397517693
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.65047C>A (p.Pro21683Thr) rs528707403
NM_001267550.2(TTN):c.6508+15T>C rs747722195
NM_001267550.2(TTN):c.65092C>T (p.Arg21698Cys) rs72646861
NM_001267550.2(TTN):c.65147C>T (p.Ser21716Leu) rs13021201
NM_001267550.2(TTN):c.65173G>A (p.Val21725Ile) rs368716894
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65194T>C (p.Phe21732Leu) rs397517661
NM_001267550.2(TTN):c.65276-16C>T rs370634364
NM_001267550.2(TTN):c.65276-8T>C rs377484398
NM_001267550.2(TTN):c.65300T>C (p.Ile21767Thr) rs762578274
NM_001267550.2(TTN):c.65319T>C (p.Thr21773=) rs746956869
NM_001267550.2(TTN):c.65371G>A (p.Gly21791Ser) rs370878527
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65514C>T (p.Thr21838=) rs372543748
NM_001267550.2(TTN):c.65516C>T (p.Ala21839Val) rs55948748
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.6555_6556insTGTAAGGAAACAGACA (p.Lys2186fs) rs587780494
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65575+10T>C rs72646864
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65649G>T (p.Leu21883Phe) rs374736305
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.65746C>T (p.Arg21916Trp) rs200155485
NM_001267550.2(TTN):c.65747G>A (p.Arg21916Gln) rs148849567
NM_001267550.2(TTN):c.65775C>T (p.Ser21925=) rs72646867
NM_001267550.2(TTN):c.65776G>A (p.Val21926Met) rs145527033
NM_001267550.2(TTN):c.65794G>A (p.Gly21932Arg) rs373636513
NM_001267550.2(TTN):c.6584A>G (p.Glu2195Gly) rs202032875
NM_001267550.2(TTN):c.66051G>A (p.Val22017=) rs587780981
NM_001267550.2(TTN):c.66086G>A (p.Arg22029His) rs72646868
NM_001267550.2(TTN):c.66123A>G (p.Pro22041=) rs727504190
NM_001267550.2(TTN):c.66160+15C>T rs377288086
NM_001267550.2(TTN):c.66160+16G>A rs149714835
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66288A>G (p.Glu22096=) rs368297582
NM_001267550.2(TTN):c.66349G>A (p.Ala22117Thr) rs727505036
NM_001267550.2(TTN):c.66372C>T (p.Thr22124=) rs756981729
NM_001267550.2(TTN):c.66385C>T (p.Arg22129Cys) rs763729258
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66576C>A (p.Leu22192=) rs187378247
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66601G>A (p.Asp22201Asn) rs368924655
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.66650T>G (p.Phe22217Cys) rs764330098
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.6668A>T (p.His2223Leu) rs372979075
NM_001267550.2(TTN):c.66692G>A (p.Arg22231His) rs200971254
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66703G>A (p.Val22235Ile) rs751354601
NM_001267550.2(TTN):c.66898G>A (p.Val22300Ile) rs200343420
NM_001267550.2(TTN):c.6690C>T (p.Phe2230=) rs755122338
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.66977A>G (p.Lys22326Arg) rs202125813
NM_001267550.2(TTN):c.67014C>A (p.Asn22338Lys) rs761241302
NM_001267550.2(TTN):c.67075G>A (p.Val22359Ile) rs2303838
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67104A>C (p.Lys22368Asn) rs727503577
NM_001267550.2(TTN):c.6713C>T (p.Thr2238Met) rs201284459
NM_001267550.2(TTN):c.67146C>T (p.Gly22382=) rs770418172
NM_001267550.2(TTN):c.67147G>A (p.Gly22383Arg) rs372388682
NM_001267550.2(TTN):c.67210G>A (p.Val22404Met) rs369257896
NM_001267550.2(TTN):c.6727G>T (p.Asp2243Tyr) rs138787974
NM_001267550.2(TTN):c.67280G>A (p.Arg22427Gln) rs770566210
NM_001267550.2(TTN):c.67322A>G (p.Glu22441Gly) rs201223583
NM_001267550.2(TTN):c.67348+11G>C rs587780982
NM_001267550.2(TTN):c.67444C>T (p.Arg22482Trp) rs563233842
NM_001267550.2(TTN):c.67445G>A (p.Arg22482Gln) rs200146608
NM_001267550.2(TTN):c.67495C>T (p.Arg22499Ter) rs574660186
NM_001267550.2(TTN):c.67542T>G (p.Thr22514=) rs72646876
NM_001267550.2(TTN):c.67604G>A (p.Ser22535Asn) rs375676529
NM_001267550.2(TTN):c.67637-4A>G rs376053678
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.67809G>A (p.Ala22603=) rs548223512
NM_001267550.2(TTN):c.67833C>T (p.Tyr22611=) rs375538420
NM_001267550.2(TTN):c.67834G>A (p.Asp22612Asn) rs757888367
NM_001267550.2(TTN):c.6790+12C>T rs200187117
NM_001267550.2(TTN):c.67959T>C (p.Phe22653=) rs72646877
NM_001267550.2(TTN):c.68079G>A (p.Thr22693=) rs11904444
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68083G>A (p.Ala22695Thr) rs767279296
NM_001267550.2(TTN):c.68097G>C (p.Gln22699His) rs727504520
NM_001267550.2(TTN):c.68160C>T (p.Ala22720=) rs397517673
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68165A>G (p.Asn22722Ser) rs200493270
NM_001267550.2(TTN):c.68195C>T (p.Ser22732Leu) rs727505352
NM_001267550.2(TTN):c.68208T>A (p.Val22736=) rs727503575
NM_001267550.2(TTN):c.6820C>G (p.Gln2274Glu) rs145649088
NM_001267550.2(TTN):c.68217T>C (p.His22739=) rs10497517
NM_001267550.2(TTN):c.68298C>A (p.Asp22766Glu) rs534340303
NM_001267550.2(TTN):c.68391G>A (p.Pro22797=) rs368985748
NM_001267550.2(TTN):c.68417C>T (p.Thr22806Ile) rs727503573
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68484del (p.Lys22828fs)
NM_001267550.2(TTN):c.68604C>T (p.Asp22868=) rs750368181
NM_001267550.2(TTN):c.68762C>T (p.Thr22921Ile) rs534567766
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.687T>C (p.Phe229=) rs376527094
NM_001267550.2(TTN):c.68823C>T (p.Tyr22941=) rs200717463
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.68864G>C (p.Gly22955Ala) rs201381085
NM_001267550.2(TTN):c.68885_68888dup (p.Ile22964fs) rs757603460
NM_001267550.2(TTN):c.68997C>A (p.Thr22999=) rs369068922
NM_001267550.2(TTN):c.69044C>T (p.Ala23015Val) rs771710562
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69145A>G (p.Ile23049Val) rs72646881
NM_001267550.2(TTN):c.69231T>C (p.Leu23077=) rs12615797
NM_001267550.2(TTN):c.6927T>A (p.Asn2309Lys) rs147580120
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.69383C>A (p.Ser23128Tyr) rs72646882
NM_001267550.2(TTN):c.69412+10G>C rs72646883
NM_001267550.2(TTN):c.69554G>A (p.Arg23185Gln) rs201448988
NM_001267550.2(TTN):c.69585C>T (p.Ser23195=) rs67041405
NM_001267550.2(TTN):c.69630C>T (p.Tyr23210=) rs777602537
NM_001267550.2(TTN):c.69639T>C (p.Arg23213=) rs1487392148
NM_001267550.2(TTN):c.69660A>G (p.Ala23220=) rs371996901
NM_001267550.2(TTN):c.69676A>G (p.Ser23226Gly) rs72646885
NM_001267550.2(TTN):c.69716-5C>G rs72646886
NM_001267550.2(TTN):c.69740C>T (p.Pro23247Leu) rs115658240
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69853G>A (p.Glu23285Lys) rs376870149
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69876A>C (p.Thr23292=) rs1267766480
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.69904G>A (p.Val23302Ile) rs190421400
NM_001267550.2(TTN):c.69957C>G (p.Ile23319Met) rs540840413
NM_001267550.2(TTN):c.69984G>A (p.Ala23328=) rs56052239
NM_001267550.2(TTN):c.70042G>A (p.Ala23348Thr) rs775146212
NM_001267550.2(TTN):c.70056A>G (p.Arg23352=) rs75948012
NM_001267550.2(TTN):c.70097T>C (p.Val23366Ala) rs372782502
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.70137C>A (p.Thr23379=) rs770349910
NM_001267550.2(TTN):c.70163G>A (p.Arg23388Gln) rs55853138
NM_001267550.2(TTN):c.70172T>C (p.Ile23391Thr) rs375202101
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.70250T>C (p.Ile23417Thr) rs201836227
NM_001267550.2(TTN):c.70260G>A (p.Pro23420=) rs72646887
NM_001267550.2(TTN):c.70305G>A (p.Thr23435=) rs397517684
NM_001267550.2(TTN):c.70435C>T (p.Arg23479Trp) rs760509116
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.70506G>T (p.Gly23502=) rs181702963
NM_001267550.2(TTN):c.70560A>G (p.Pro23520=)
NM_001267550.2(TTN):c.7057+2dup rs765019023
NM_001267550.2(TTN):c.70570A>G (p.Thr23524Ala) rs369526268
NM_001267550.2(TTN):c.7060C>T (p.Arg2354Cys) rs145039979
NM_001267550.2(TTN):c.7061G>A (p.Arg2354His) rs75031300
NM_001267550.2(TTN):c.70644C>T (p.Thr23548=) rs148210834
NM_001267550.2(TTN):c.70645G>A (p.Val23549Ile) rs755669336
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70656A>G (p.Ala23552=) rs372399881
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70696G>C (p.Gly23566Arg) rs55801134
NM_001267550.2(TTN):c.70743C>T (p.His23581=) rs375194057
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.70819G>A (p.Ala23607Thr) rs786205539
NM_001267550.2(TTN):c.70832C>T (p.Ala23611Val) rs72646891
NM_001267550.2(TTN):c.70833G>A (p.Ala23611=) rs377220635
NM_001267550.2(TTN):c.70854A>G (p.Glu23618=)
NM_001267550.2(TTN):c.70864G>A (p.Val23622Ile) rs72646892
NM_001267550.2(TTN):c.70906C>T (p.Arg23636Cys) rs189208539
NM_001267550.2(TTN):c.70907G>A (p.Arg23636His) rs56071233
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.70998A>G (p.Thr23666=) rs767989384
NM_001267550.2(TTN):c.71000G>A (p.Trp23667Ter)
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71149G>T (p.Asp23717Tyr) rs371818894
NM_001267550.2(TTN):c.71300G>A (p.Arg23767Gln) rs370516890
NM_001267550.2(TTN):c.71369G>A (p.Arg23790His) rs55677134
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.71452A>G (p.Ile23818Val) rs776911847
NM_001267550.2(TTN):c.7156G>A (p.Gly2386Ser) rs777101912
NM_001267550.2(TTN):c.71602C>T (p.Arg23868Ter) rs397517689
NM_001267550.2(TTN):c.71608G>A (p.Gly23870Ser) rs727503564
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71723G>A (p.Gly23908Asp) rs540161344
NM_001267550.2(TTN):c.7173C>T (p.Asp2391=) rs374509926
NM_001267550.2(TTN):c.7174G>A (p.Gly2392Ser) rs4894048
NM_001267550.2(TTN):c.71832A>C (p.Lys23944Asn) rs1449315408
NM_001267550.2(TTN):c.71841G>C (p.Lys23947Asn) rs56019808
NM_001267550.2(TTN):c.71848_71855dup (p.Gly23953fs)
NM_001267550.2(TTN):c.71881G>A (p.Val23961Ile) rs397517690
NM_001267550.2(TTN):c.71883T>C (p.Val23961=) rs368692510
NM_001267550.2(TTN):c.71903A>C (p.Asn23968Thr) rs769320596
NM_001267550.2(TTN):c.71940G>A (p.Leu23980=) rs72646893
NM_001267550.2(TTN):c.71981C>T (p.Ala23994Val) rs772886864
NM_001267550.2(TTN):c.71993G>A (p.Arg23998His) rs10164753
NM_001267550.2(TTN):c.72001G>A (p.Ala24001Thr) rs180828370
NM_001267550.2(TTN):c.72033A>G (p.Pro24011=) rs72646894
NM_001267550.2(TTN):c.72105T>C (p.Phe24035=) rs397517691
NM_001267550.2(TTN):c.72113C>T (p.Thr24038Met) rs370375696
NM_001267550.2(TTN):c.72114G>A (p.Thr24038=) rs768064912
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72137C>T (p.Ala24046Val) rs146767076
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72167G>A (p.Arg24056His) rs398124455
NM_001267550.2(TTN):c.72181A>G (p.Met24061Val) rs201482015
NM_001267550.2(TTN):c.72182T>C (p.Met24061Thr) rs200471370
NM_001267550.2(TTN):c.72302C>A (p.Thr24101Asn) rs192962624
NM_001267550.2(TTN):c.72358C>T (p.Leu24120Phe) rs372309164
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72488G>A (p.Arg24163His) rs374712231
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72624A>G (p.Pro24208=) rs56293906
NM_001267550.2(TTN):c.72669del (p.Asp24224fs) rs727504531
NM_001267550.2(TTN):c.72674C>T (p.Pro24225Leu) rs55992239
NM_001267550.2(TTN):c.72716T>A (p.Met24239Lys) rs750298083
NM_001267550.2(TTN):c.72723C>G (p.Val24241=) rs372701206
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72782G>A (p.Arg24261Gln) rs142874389
NM_001267550.2(TTN):c.72802C>T (p.Arg24268Cys) rs370474301
NM_001267550.2(TTN):c.72803G>A (p.Arg24268His) rs140018785
NM_001267550.2(TTN):c.72824A>T (p.Lys24275Ile) rs199860952
NM_001267550.2(TTN):c.72906T>A (p.Ala24302=) rs773886758
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.73168A>G (p.Thr24390Ala) rs182491843
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.73224G>A (p.Gly24408=) rs371034493
NM_001267550.2(TTN):c.732C>T (p.Ala244=) rs761859812
NM_001267550.2(TTN):c.73303C>T (p.Arg24435Cys) rs200028088
NM_001267550.2(TTN):c.73334C>T (p.Thr24445Ile) rs377334665
NM_001267550.2(TTN):c.73336C>T (p.Leu24446=) rs189768015
NM_001267550.2(TTN):c.7339G>A (p.Val2447Met) rs779064962
NM_001267550.2(TTN):c.73491T>C (p.Tyr24497=)
NM_001267550.2(TTN):c.73517G>A (p.Gly24506Asp) rs567446185
NM_001267550.2(TTN):c.73568del (p.Pro24523fs) rs1559415567
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73765T>C (p.Tyr24589His) rs371821218
NM_001267550.2(TTN):c.73783G>A (p.Ala24595Thr) rs543275318
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.7383G>A (p.Lys2461=) rs752865519
NM_001267550.2(TTN):c.73847G>A (p.Arg24616Gln) rs201694149
NM_001267550.2(TTN):c.7392T>C (p.Leu2464=) rs565784637
NM_001267550.2(TTN):c.73937G>A (p.Ser24646Asn) rs370902028
NM_001267550.2(TTN):c.73994C>T (p.Thr24665Met) rs144398602
NM_001267550.2(TTN):c.74042A>G (p.Gln24681Arg) rs537071956
NM_001267550.2(TTN):c.74305A>G (p.Asn24769Asp) rs372787601
NM_001267550.2(TTN):c.74331C>T (p.Asp24777=) rs368530092
NM_001267550.2(TTN):c.74513G>C (p.Gly24838Ala) rs200723435
NM_001267550.2(TTN):c.74527A>G (p.Asn24843Asp) rs373527654
NM_001267550.2(TTN):c.74546G>A (p.Arg24849Gln) rs745488276
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74596A>G (p.Thr24866Ala) rs199784966
NM_001267550.2(TTN):c.74597CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74763C>T (p.Ser24921=) rs371563258
NM_001267550.2(TTN):c.74839C>T (p.Arg24947Cys) rs744426
NM_001267550.2(TTN):c.74840G>A (p.Arg24947His) rs765512476
NM_001267550.2(TTN):c.74844G>A (p.Lys24948=) rs371884545
NM_001267550.2(TTN):c.74891C>T (p.Pro24964Leu) rs72646899
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.74972T>C (p.Ile24991Thr) rs744427
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75099C>T (p.Asp25033=) rs370272814
NM_001267550.2(TTN):c.75192T>C (p.Thr25064=) rs370480927
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.7524T>C (p.His2508=) rs2291307
NM_001267550.2(TTN):c.75250C>T (p.Arg25084Ter) rs794729286
NM_001267550.2(TTN):c.75259G>A (p.Ala25087Thr) rs759110420
NM_001267550.2(TTN):c.7530A>G (p.Ser2510=) rs189187431
NM_001267550.2(TTN):c.75328C>T (p.Arg25110Ter) rs794729382
NM_001267550.2(TTN):c.75361A>G (p.Ile25121Val) rs199508062
NM_001267550.2(TTN):c.75441A>G (p.Lys25147=) rs56151652
NM_001267550.2(TTN):c.75490G>A (p.Asp25164Asn) rs192468365
NM_001267550.2(TTN):c.75504T>G (p.Ser25168Arg) rs375204371
NM_001267550.2(TTN):c.75527G>A (p.Arg25176His) rs375693396
NM_001267550.2(TTN):c.75663del (p.Lys25221fs) rs1131691542
NM_001267550.2(TTN):c.75668C>T (p.Thr25223Ile) rs370070176
NM_001267550.2(TTN):c.75682C>T (p.Pro25228Ser) rs377226540
NM_001267550.2(TTN):c.75734G>A (p.Arg25245Lys) rs397517701
NM_001267550.2(TTN):c.75738A>G (p.Glu25246=) rs371344165
NM_001267550.2(TTN):c.75745C>T (p.Arg25249Cys) rs397517702
NM_001267550.2(TTN):c.75762G>T (p.Val25254=) rs374003257
NM_001267550.2(TTN):c.75914C>T (p.Pro25305Leu) rs142453163
NM_001267550.2(TTN):c.75997G>A (p.Gly25333Ser) rs757343393
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.76070G>A (p.Arg25357His) rs397517703
NM_001267550.2(TTN):c.76113A>G (p.Glu25371=) rs140350441
NM_001267550.2(TTN):c.76115dup (p.Asn25372fs) rs774604740
NM_001267550.2(TTN):c.76124A>T (p.Tyr25375Phe) rs374494927
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.76296T>C (p.Asp25432=) rs868081432
NM_001267550.2(TTN):c.76343G>A (p.Ser25448Asn) rs3813243
NM_001267550.2(TTN):c.76383TAA[1] (p.Asn25462del) rs749648136
NM_001267550.2(TTN):c.76397_76398del (p.Ile25466fs) rs794729342
NM_001267550.2(TTN):c.76482C>T (p.Asp25494=) rs370908118
NM_001267550.2(TTN):c.76483G>A (p.Val25495Ile) rs773127796
NM_001267550.2(TTN):c.76610G>A (p.Arg25537His) rs561977468
NM_001267550.2(TTN):c.76645G>A (p.Gly25549Ser) rs181166140
NM_001267550.2(TTN):c.76673A>T (p.Asp25558Val) rs201095164
NM_001267550.2(TTN):c.76720T>C (p.Tyr25574His) rs3813245
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76739C>T (p.Thr25580Met) rs56372592
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.76987G>A (p.Asp25663Asn) rs143186270
NM_001267550.2(TTN):c.77043T>C (p.Tyr25681=) rs370810609
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.7711G>A (p.Glu2571Lys) rs149660690
NM_001267550.2(TTN):c.77166T>C (p.Pro25722=) rs757252494
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.77249G>A (p.Arg25750Gln) rs368038362
NM_001267550.2(TTN):c.77279A>G (p.Asn25760Ser) rs3813246
NM_001267550.2(TTN):c.77302C>A (p.Leu25768Ile) rs541266544
NM_001267550.2(TTN):c.7740T>G (p.Ile2580Met) rs146590898
NM_001267550.2(TTN):c.77515A>C (p.Lys25839Gln) rs1371831965
NM_001267550.2(TTN):c.77601A>G (p.Gln25867=) rs777276284
NM_001267550.2(TTN):c.77638A>G (p.Thr25880Ala) rs56018860
NM_001267550.2(TTN):c.77646_77662delinsAGA (p.Ile25883fs) rs794729345
NM_001267550.2(TTN):c.77706C>T (p.Asp25902=) rs375764395
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77749T>C (p.Tyr25917His) rs370137092
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.7783A>G (p.Met2595Val) rs760786665
NM_001267550.2(TTN):c.77848C>T (p.Leu25950Phe) rs376814602
NM_001267550.2(TTN):c.77907C>T (p.Asn25969=) rs375903820
NM_001267550.2(TTN):c.77913T>C (p.Tyr25971=) rs72648203
NM_001267550.2(TTN):c.78039A>C (p.Glu26013Asp) rs755117644
NM_001267550.2(TTN):c.78068T>C (p.Ile26023Thr) rs572384303
NM_001267550.2(TTN):c.78147A>G (p.Gln26049=) rs149127072
NM_001267550.2(TTN):c.78178G>T (p.Glu26060Ter) rs794729289
NM_001267550.2(TTN):c.7830G>C (p.Met2610Ile) rs56142888
NM_001267550.2(TTN):c.78446C>G (p.Thr26149Ser) rs191263181
NM_001267550.2(TTN):c.78674T>C (p.Ile26225Thr) rs12463674
NM_001267550.2(TTN):c.78774A>G (p.Arg26258=) rs368270588
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.78906A>C (p.Glu26302Asp) rs534003014
NM_001267550.2(TTN):c.78991C>A (p.Arg26331=) rs779996703
NM_001267550.2(TTN):c.78992G>A (p.Arg26331Gln)
NM_001267550.2(TTN):c.79018G>T (p.Glu26340Ter)
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79265T>C (p.Ile26422Thr) rs3731745
NM_001267550.2(TTN):c.79318C>T (p.Arg26440Cys) rs55861600
NM_001267550.2(TTN):c.79319G>A (p.Arg26440His) rs56044609
NM_001267550.2(TTN):c.79334G>A (p.Arg26445His) rs764254441
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79545C>T (p.Gly26515=) rs761713195
NM_001267550.2(TTN):c.79546G>A (p.Gly26516Ser) rs776256093
NM_001267550.2(TTN):c.7957T>C (p.Leu2653=) rs201837864
NM_001267550.2(TTN):c.79591G>A (p.Glu26531Lys) rs772211147
NM_001267550.2(TTN):c.79612A>G (p.Thr26538Ala) rs150682764
NM_001267550.2(TTN):c.7961G>A (p.Arg2654Lys) rs147207100
NM_001267550.2(TTN):c.79700A>G (p.Asn26567Ser) rs183844833
NM_001267550.2(TTN):c.7975C>G (p.Leu2659Val)
NM_001267550.2(TTN):c.79783G>C (p.Asp26595His) rs56307213
NM_001267550.2(TTN):c.79862C>A (p.Thr26621Lys) rs3731746
NM_001267550.2(TTN):c.79862C>T (p.Thr26621Met) rs3731746
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.79883G>A (p.Arg26628Gln) rs201091376
NM_001267550.2(TTN):c.79883G>C (p.Arg26628Pro) rs201091376
NM_001267550.2(TTN):c.79941A>G (p.Gln26647=) rs72648208
NM_001267550.2(TTN):c.80115G>T (p.Glu26705Asp) rs558830502
NM_001267550.2(TTN):c.80209T>A (p.Cys26737Ser) rs566764105
NM_001267550.2(TTN):c.80271C>T (p.Val26757=) rs199875474
NM_001267550.2(TTN):c.80322C>T (p.Ala26774=) rs55892928
NM_001267550.2(TTN):c.80425G>A (p.Gly26809Ser) rs369941201
NM_001267550.2(TTN):c.80527T>C (p.Leu26843=) rs142004835
NM_001267550.2(TTN):c.80530del (p.Ser26844fs)
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.80635C>A (p.Gln26879Lys) rs79926414
NM_001267550.2(TTN):c.80661C>T (p.Asn26887=) rs201069672
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80720C>A (p.Pro26907Gln) rs375693686
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.80854G>A (p.Val26952Ile) rs371362606
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80859G>A (p.Thr26953=) rs771257647
NM_001267550.2(TTN):c.80905G>A (p.Val26969Ile) rs377667066
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.81037C>T (p.Arg27013Ter) rs869038795
NM_001267550.2(TTN):c.81057T>C (p.Thr27019=) rs114908705
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81123G>A (p.Thr27041=) rs181299250
NM_001267550.2(TTN):c.8116+19G>A rs13011633
NM_001267550.2(TTN):c.81247T>C (p.Ser27083Pro) rs186273940
NM_001267550.2(TTN):c.81250A>G (p.Ile27084Val) rs371498697
NM_001267550.2(TTN):c.81302G>T (p.Gly27101Val) rs201490050
NM_001267550.2(TTN):c.81393A>G (p.Lys27131=) rs374501251
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81527G>T (p.Arg27176Leu) rs199726308
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81565C>G (p.Leu27189Val) rs142391957
NM_001267550.2(TTN):c.81671A>G (p.Asn27224Ser) rs368443217
NM_001267550.2(TTN):c.81737T>C (p.Ile27246Thr) rs367603381
NM_001267550.2(TTN):c.81758A>G (p.Asn27253Ser) rs529055709
NM_001267550.2(TTN):c.8184C>G (p.Val2728=) rs753356474
NM_001267550.2(TTN):c.8184C>T (p.Val2728=) rs753356474
NM_001267550.2(TTN):c.81850G>A (p.Val27284Ile) rs746222222
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.81938G>A (p.Gly27313Glu) rs199670463
NM_001267550.2(TTN):c.81958G>A (p.Ala27320Thr) rs56365600
NM_001267550.2(TTN):c.82036C>T (p.Gln27346Ter) rs886042331
NM_001267550.2(TTN):c.82081C>G (p.Pro27361Ala) rs56137800
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82220T>C (p.Ile27407Thr) rs376037252
NM_001267550.2(TTN):c.82235C>A (p.Thr27412Lys) rs201489661
NM_001267550.2(TTN):c.82309_82312dup (p.Asn27438delinsArgTer)
NM_001267550.2(TTN):c.82385C>A (p.Thr27462Lys) rs55933739
NM_001267550.2(TTN):c.82385C>T (p.Thr27462Met) rs55933739
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82486G>A (p.Asp27496Asn) rs554231442
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82497C>T (p.Thr27499=) rs199629314
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82684T>C (p.Tyr27562His) rs376616067
NM_001267550.2(TTN):c.82688G>A (p.Arg27563His) rs118079537
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82692G>A (p.Ala27564=) rs557628408
NM_001267550.2(TTN):c.82732A>G (p.Lys27578Glu) rs368850871
NM_001267550.2(TTN):c.82740G>A (p.Thr27580=) rs56345408
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82797C>T (p.Gly27599=) rs72648216
NM_001267550.2(TTN):c.82798G>A (p.Ala27600Thr) rs11896637
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_001267550.2(TTN):c.82933C>T (p.Arg27645Cys) rs751318609
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82981C>T (p.Pro27661Ser) rs201422612
NM_001267550.2(TTN):c.83017C>A (p.Pro27673Thr) rs769343491
NM_001267550.2(TTN):c.83056G>A (p.Val27686Ile) rs56309296
NM_001267550.2(TTN):c.83059C>T (p.Leu27687=) rs200992636
NM_001267550.2(TTN):c.83063G>A (p.Arg27688His) rs185002960
NM_001267550.2(TTN):c.83081G>A (p.Arg27694His) rs775499341
NM_001267550.2(TTN):c.83133G>A (p.Lys27711=) rs369223412
NM_001267550.2(TTN):c.8314G>A (p.Val2772Met) rs143035953
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83272T>C (p.Phe27758Leu) rs188323108
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83299C>A (p.Pro27767Thr) rs184643087
NM_001267550.2(TTN):c.83323A>G (p.Ile27775Val) rs3829746
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.83571C>T (p.Pro27857=) rs368025526
NM_001267550.2(TTN):c.83580G>A (p.Val27860=) rs200096597
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83600C>G (p.Pro27867Arg)
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83733C>T (p.Ser27911=) rs375442124
NM_001267550.2(TTN):c.83740A>G (p.Thr27914Ala) rs188370772
NM_001267550.2(TTN):c.83870G>C (p.Arg27957Thr) rs148067743
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84157C>T (p.Leu28053Phe) rs1194981313
NM_001267550.2(TTN):c.84188G>A (p.Arg28063His) rs570847832
NM_001267550.2(TTN):c.84203G>C (p.Ser28068Thr) rs72648219
NM_001267550.2(TTN):c.84225T>C (p.Ser28075=)
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.8434G>C (p.Val2812Leu) rs146636599
NM_001267550.2(TTN):c.84352C>T (p.Arg28118Cys) rs56057221
NM_001267550.2(TTN):c.84453A>G (p.Pro28151=) rs73036373
NM_001267550.2(TTN):c.84461C>T (p.Pro28154Leu) rs200350579
NM_001267550.2(TTN):c.84524G>A (p.Trp28175Ter)
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84652G>A (p.Gly28218Ser) rs727504693
NM_001267550.2(TTN):c.8467G>T (p.Val2823Phe) rs33917087
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84872G>A (p.Arg28291His) rs774924903
NM_001267550.2(TTN):c.84893G>A (p.Arg28298Gln) rs187270666
NM_001267550.2(TTN):c.84923A>C (p.Gln28308Pro) rs201674674
NM_001267550.2(TTN):c.8492G>A (p.Ser2831Asn) rs2306636
NM_001267550.2(TTN):c.84945T>A (p.Thr28315=) rs768116404
NM_001267550.2(TTN):c.84965G>A (p.Arg28322His) rs373532064
NM_001267550.2(TTN):c.84976C>T (p.Arg28326Trp) rs749633038
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85040T>C (p.Ile28347Thr) rs397517731
NM_001267550.2(TTN):c.85090C>T (p.Arg28364Ter) rs770038577
NM_001267550.2(TTN):c.85248A>T (p.Thr28416=) rs187180708
NM_001267550.2(TTN):c.85316G>A (p.Arg28439Gln) rs764437671
NM_001267550.2(TTN):c.85389C>T (p.Leu28463=) rs144731702
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85443A>G (p.Ala28481=) rs373326137
NM_001267550.2(TTN):c.85651C>A (p.Pro28551Thr) rs142478636
NM_001267550.2(TTN):c.85691A>T (p.Lys28564Ile) rs199859344
NM_001267550.2(TTN):c.85745T>A (p.Ile28582Lys) rs201688358
NM_001267550.2(TTN):c.85769G>A (p.Arg28590Gln) rs375667028
NM_001267550.2(TTN):c.85809del (p.Lys28603fs)
NM_001267550.2(TTN):c.8589A>G (p.Glu2863=) rs72647883
NM_001267550.2(TTN):c.85953A>G (p.Leu28651=) rs546573613
NM_001267550.2(TTN):c.86003T>C (p.Ile28668Thr) rs374022393
NM_001267550.2(TTN):c.86025G>A (p.Pro28675=) rs369528150
NM_001267550.2(TTN):c.86045C>T (p.Pro28682Leu) rs760467197
NM_001267550.2(TTN):c.86052T>C (p.Thr28684=) rs76928874
NM_001267550.2(TTN):c.86085C>T (p.Asp28695=) rs773001228
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86140G>A (p.Gly28714Arg) rs532818379
NM_001267550.2(TTN):c.86301G>A (p.Lys28767=) rs56310931
NM_001267550.2(TTN):c.86355T>C (p.Asn28785=) rs745857020
NM_001267550.2(TTN):c.8641A>C (p.Thr2881Pro) rs546667760
NM_001267550.2(TTN):c.86463A>G (p.Gly28821=) rs368268066
NM_001267550.2(TTN):c.86471C>T (p.Thr28824Ile) rs200709344
NM_001267550.2(TTN):c.86526T>G (p.Val28842=) rs72648226
NM_001267550.2(TTN):c.86538A>T (p.Pro28846=) rs747423090
NM_001267550.2(TTN):c.86640C>A (p.Tyr28880Ter)
NM_001267550.2(TTN):c.86658G>A (p.Glu28886=) rs760858743
NM_001267550.2(TTN):c.86683G>A (p.Val28895Met) rs201290358
NM_001267550.2(TTN):c.86700C>T (p.Asn28900=) rs727504793
NM_001267550.2(TTN):c.86729AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86742_86745del (p.Tyr28915fs)
NM_001267550.2(TTN):c.86799_86802del (p.Glu28935_Gly28936insTer) rs727504856
NM_001267550.2(TTN):c.86811A>G (p.Val28937=) rs55972010
NM_001267550.2(TTN):c.86821+2T>A rs397517735
NM_001267550.2(TTN):c.86910C>T (p.Gly28970=) rs397517736
NM_001267550.2(TTN):c.86935G>A (p.Val28979Ile) rs201687390
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87111G>A (p.Glu29037=) rs374902148
NM_001267550.2(TTN):c.87280G>A (p.Glu29094Lys) rs199501185
NM_001267550.2(TTN):c.87345T>C (p.Tyr29115=) rs369444690
NM_001267550.2(TTN):c.87367A>C (p.Ser29123Arg) rs375198596
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87448A>T (p.Ile29150Leu) rs189030321
NM_001267550.2(TTN):c.87495C>T (p.Asp29165=) rs371763584
NM_001267550.2(TTN):c.87600G>C (p.Met29200Ile) rs750362675
NM_001267550.2(TTN):c.87611C>G (p.Thr29204Arg) rs72648228
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87669T>C (p.His29223=) rs72648229
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.87716del (p.Gly29239fs) rs869312028
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.87805G>A (p.Val29269Ile) rs727503551
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.87877C>T (p.Arg29293Cys) rs191482653
NM_001267550.2(TTN):c.87878G>A (p.Arg29293His) rs202001776
NM_001267550.2(TTN):c.8788G>A (p.Val2930Ile) rs56373393
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88112T>C (p.Ile29371Thr) rs767890385
NM_001267550.2(TTN):c.88123C>T (p.Arg29375Cys) rs368439674
NM_001267550.2(TTN):c.88134A>G (p.Pro29378=) rs374612925
NM_001267550.2(TTN):c.88152G>A (p.Lys29384=) rs1206935877
NM_001267550.2(TTN):c.88187T>C (p.Ile29396Thr) rs9808377
NM_001267550.2(TTN):c.88246G>T (p.Val29416Phe) rs755325663
NM_001267550.2(TTN):c.88272G>A (p.Glu29424=) rs9808036
NM_001267550.2(TTN):c.88285A>G (p.Ile29429Val) rs373738818
NM_001267550.2(TTN):c.88297G>A (p.Asp29433Asn) rs189202799
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88476C>G (p.Thr29492=) rs190406444
NM_001267550.2(TTN):c.88485C>T (p.Leu29495=) rs371612136
NM_001267550.2(TTN):c.88510G>A (p.Asp29504Asn) rs376679796
NM_001267550.2(TTN):c.88513C>T (p.Arg29505Cys) rs372360369
NM_001267550.2(TTN):c.88591C>T (p.Leu29531Phe) rs371483198
NM_001267550.2(TTN):c.88685G>A (p.Gly29562Asp) rs72648235
NM_001267550.2(TTN):c.88708A>G (p.Ile29570Val) rs139506970
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88733G>A (p.Arg29578His) rs374147064
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.88983C>T (p.Gly29661=) rs371678936
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.89017C>T (p.Arg29673Ter) rs886038916
NM_001267550.2(TTN):c.89018G>A (p.Arg29673Gln) rs200639218
NM_001267550.2(TTN):c.8902+12_8902+13del rs774238749
NM_001267550.2(TTN):c.8902+14T>A rs13388274
NM_001267550.2(TTN):c.8902+14del rs573000455
NM_001267550.2(TTN):c.8919C>G (p.Ser2973=) rs4894045
NM_001267550.2(TTN):c.89240C>G (p.Thr29747Ser) rs370568740
NM_001267550.2(TTN):c.89295T>C (p.Ala29765=) rs375374658
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89314G>T (p.Glu29772Ter)
NM_001267550.2(TTN):c.89317A>T (p.Ile29773Leu) rs77853750
NM_001267550.2(TTN):c.89357C>T (p.Thr29786Ile) rs753966916
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.89515A>G (p.Ile29839Val) rs750806089
NM_001267550.2(TTN):c.89708C>G (p.Thr29903Ser) rs72648240
NM_001267550.2(TTN):c.89760A>C (p.Glu29920Asp) rs747181293
NM_001267550.2(TTN):c.89906T>C (p.Val29969Ala) rs201220828
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.89984T>C (p.Ile29995Thr) rs754676727
NM_001267550.2(TTN):c.89989T>A (p.Leu29997Met) rs369855092
NM_001267550.2(TTN):c.89994G>A (p.Ser29998=) rs142891278
NM_001267550.2(TTN):c.899C>A (p.Thr300Asn) rs376737897
NM_001267550.2(TTN):c.90159A>C (p.Lys30053Asn) rs886039117
NM_001267550.2(TTN):c.90181G>A (p.Val30061Ile) rs138958733
NM_001267550.2(TTN):c.90227C>T (p.Thr30076Met) rs201998913
NM_001267550.2(TTN):c.90237C>T (p.His30079=) rs756663688
NM_001267550.2(TTN):c.90246A>G (p.Ile30082Met) rs886038812
NM_001267550.2(TTN):c.90332T>C (p.Leu30111Pro) rs368516973
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90624T>C (p.Asn30208=) rs370479059
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90691C>T (p.Pro30231Ser) rs373722546
NM_001267550.2(TTN):c.90748G>A (p.Glu30250Lys) rs200651247
NM_001267550.2(TTN):c.90758GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.9077A>T (p.Asn3026Ile) rs11900987
NM_001267550.2(TTN):c.90786C>T (p.Ile30262=) rs727504439
NM_001267550.2(TTN):c.90793C>T (p.Arg30265Trp) rs200022152
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.90950T>C (p.Val30317Ala) rs759474127
NM_001267550.2(TTN):c.90968G>A (p.Arg30323Lys) rs11887722
NM_001267550.2(TTN):c.90991C>T (p.Pro30331Ser) rs75022916
NM_001267550.2(TTN):c.91071T>G (p.Thr30357=) rs11897366
NM_001267550.2(TTN):c.91119A>G (p.Lys30373=) rs192167542
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91224C>T (p.Ser30408=) rs1057522835
NM_001267550.2(TTN):c.91311A>G (p.Glu30437=) rs374094732
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.91399C>T (p.Arg30467Cys) rs775591945
NM_001267550.2(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_001267550.2(TTN):c.91425C>T (p.Asp30475=) rs145133144
NM_001267550.2(TTN):c.91434A>C (p.Glu30478Asp) rs373900294
NM_001267550.2(TTN):c.915-7dup rs730880351
NM_001267550.2(TTN):c.9150A>G (p.Thr3050=) rs72647886
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91565-13C>T rs200847757
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91589C>T (p.Pro30530Leu) rs200875379
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91610TTA[1] (p.Ile30538del)
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91732G>A (p.Val30578Ile) rs727504672
NM_001267550.2(TTN):c.91749C>T (p.Ser30583=) rs886044458
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.9176A>T (p.Glu3059Val) rs727504501
NM_001267550.2(TTN):c.91884A>G (p.Arg30628=) rs144922355
NM_001267550.2(TTN):c.91884A>T (p.Arg30628Ser) rs144922355
NM_001267550.2(TTN):c.918C>T (p.Ser306=) rs773898647
NM_001267550.2(TTN):c.91937A>G (p.Asn30646Ser) rs72648245
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.92042C>A (p.Ala30681Asp) rs201400267
NM_001267550.2(TTN):c.92131G>A (p.Val30711Met) rs747122
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92191A>G (p.Ile30731Val) rs16866391
NM_001267550.2(TTN):c.92226G>A (p.Arg30742=) rs759484932
NM_001267550.2(TTN):c.92241T>C (p.Gly30747=) rs373311745
NM_001267550.2(TTN):c.92294G>C (p.Arg30765Thr) rs373099440
NM_001267550.2(TTN):c.92317C>T (p.Arg30773Ter) rs794729301
NM_001267550.2(TTN):c.92333C>G (p.Thr30778Arg) rs201019681
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92402C>T (p.Ala30801Val) rs372570504
NM_001267550.2(TTN):c.92451G>T (p.Glu30817Asp) rs397517755
NM_001267550.2(TTN):c.92537T>C (p.Val30846Ala) rs77968867
NM_001267550.2(TTN):c.92612T>C (p.Val30871Ala) rs756610221
NM_001267550.2(TTN):c.92631dup (p.Lys30878fs) rs886039145
NM_001267550.2(TTN):c.92677A>G (p.Lys30893Glu) rs370541682
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92750T>C (p.Val30917Ala) rs748545482
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.92871T>C (p.Ala30957=) rs748822553
NM_001267550.2(TTN):c.92901C>T (p.Ser30967=) rs11694623
NM_001267550.2(TTN):c.9290T>C (p.Leu3097Pro) rs373366126
NM_001267550.2(TTN):c.92951A>G (p.Glu30984Gly) rs770525487
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93129C>T (p.Asp31043=) rs758336721
NM_001267550.2(TTN):c.93131G>T (p.Gly31044Val) rs570464905
NM_001267550.2(TTN):c.93166C>T (p.Arg31056Ter) rs72648250
NM_001267550.2(TTN):c.93182G>A (p.Arg31061His) rs727504923
NM_001267550.2(TTN):c.93214C>T (p.Arg31072Cys) rs368932767
NM_001267550.2(TTN):c.93215G>A (p.Arg31072His) rs141817409
NM_001267550.2(TTN):c.93244G>A (p.Glu31082Lys) rs199663613
NM_001267550.2(TTN):c.93255G>A (p.Pro31085=) rs372611171
NM_001267550.2(TTN):c.93367G>C (p.Val31123Leu) rs202096200
NM_001267550.2(TTN):c.93387C>T (p.Ser31129=) rs35445420
NM_001267550.2(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_001267550.2(TTN):c.93396_93400del (p.Ala31133_Trp31134insTer) rs886044536
NM_001267550.2(TTN):c.93444C>T (p.Tyr31148=) rs561739832
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.93570T>A (p.Asn31190Lys) rs746309005
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93724C>T (p.Arg31242Cys) rs563887822
NM_001267550.2(TTN):c.93725G>A (p.Arg31242His) rs369899675
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.9381C>A (p.Tyr3127Ter)
NM_001267550.2(TTN):c.93868C>T (p.Leu31290=) rs557737090
NM_001267550.2(TTN):c.93900C>T (p.Ser31300=) rs200173934
NM_001267550.2(TTN):c.93901G>A (p.Val31301Ile) rs67665715
NM_001267550.2(TTN):c.93917T>C (p.Ile31306Thr) rs555405542
NM_001267550.2(TTN):c.93972A>G (p.Glu31324=) rs727504528
NM_001267550.2(TTN):c.93981C>G (p.Val31327=) rs370894846
NM_001267550.2(TTN):c.94016C>T (p.Thr31339Ile) rs184078016
NM_001267550.2(TTN):c.9402C>T (p.Asn3134=) rs587780987
NM_001267550.2(TTN):c.94046G>A (p.Arg31349His) rs181104321
NM_001267550.2(TTN):c.9423T>C (p.Phe3141=)
NM_001267550.2(TTN):c.94282C>A (p.Arg31428Ser) rs190282707
NM_001267550.2(TTN):c.94283G>A (p.Arg31428His) rs149375775
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.9443G>A (p.Arg3148His) rs368786036
NM_001267550.2(TTN):c.9448C>T (p.Arg3150Ter) rs146572907
NM_001267550.2(TTN):c.94507G>A (p.Ala31503Thr) rs375657115
NM_001267550.2(TTN):c.94553T>C (p.Val31518Ala) rs377016580
NM_001267550.2(TTN):c.94590A>G (p.Pro31530=) rs558347312
NM_001267550.2(TTN):c.9461A>G (p.Lys3154Arg) rs4893853
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.94633C>T (p.Arg31545Cys) rs202187398
NM_001267550.2(TTN):c.94664G>A (p.Arg31555His) rs727503545
NM_001267550.2(TTN):c.94700A>G (p.Asn31567Ser) rs886042885
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.94863C>T (p.His31621=) rs373871146
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.9488G>A (p.Arg3163His) rs149755500
NM_001267550.2(TTN):c.94980A>G (p.Glu31660=) rs370769662
NM_001267550.2(TTN):c.95035G>A (p.Asp31679Asn) rs116567963
NM_001267550.2(TTN):c.95047A>G (p.Ser31683Gly) rs72648257
NM_001267550.2(TTN):c.95068G>A (p.Val31690Met) rs727503543
NM_001267550.2(TTN):c.95078C>A (p.Ala31693Asp) rs2288326
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95126C>G (p.Pro31709Arg) rs869320739
NM_001267550.2(TTN):c.95130C>A (p.Gly31710=) rs727504857
NM_001267550.2(TTN):c.95148C>T (p.Thr31716=) rs140663434
NM_001267550.2(TTN):c.95149G>A (p.Val31717Ile) rs150930737
NM_001267550.2(TTN):c.95187G>C (p.Trp31729Cys) rs869320742
NM_001267550.2(TTN):c.95195C>T (p.Pro31732Leu) rs753334568
NM_001267550.2(TTN):c.95205C>T (p.Asp31735=) rs373182578
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95244C>T (p.Arg31748=) rs368243641
NM_001267550.2(TTN):c.95259C>T (p.Leu31753=) rs72648258
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95372G>A (p.Gly31791Asp) rs869320744
NM_001267550.2(TTN):c.95406A>G (p.Arg31802=) rs199652273
NM_001267550.2(TTN):c.95415C>A (p.Phe31805Leu) rs587780983
NM_001267550.2(TTN):c.95553C>T (p.Ser31851=) rs72648260
NM_001267550.2(TTN):c.95555T>C (p.Leu31852Pro) rs62621206
NM_001267550.2(TTN):c.95582A>G (p.Tyr31861Cys) rs59148238
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.95877G>A (p.Val31959=)
NM_001267550.2(TTN):c.95961C>T (p.Ala31987=) rs369405564
NM_001267550.2(TTN):c.96015C>T (p.Pro32005=) rs183620684
NM_001267550.2(TTN):c.96098G>A (p.Arg32033His) rs200648462
NM_001267550.2(TTN):c.96108G>A (p.Val32036=) rs372773283
NM_001267550.2(TTN):c.9610C>T (p.Arg3204Ter) rs757836789
NM_001267550.2(TTN):c.96138A>T (p.Ile32046=) rs368154623
NM_001267550.2(TTN):c.96140C>T (p.Thr32047Met) rs375640847
NM_001267550.2(TTN):c.96158T>C (p.Ile32053Thr) rs62621236
NM_001267550.2(TTN):c.96172C>T (p.Arg32058Trp) rs201463708
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.96180T>C (p.Ile32060=) rs572401798
NM_001267550.2(TTN):c.96225T>A (p.Val32075=) rs752745266
NM_001267550.2(TTN):c.96230G>A (p.Arg32077Gln) rs369835255
NM_001267550.2(TTN):c.96234C>T (p.Tyr32078=) rs376532382
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001267550.2(TTN):c.96252A>G (p.Thr32084=) rs369626133
NM_001267550.2(TTN):c.96390G>A (p.Thr32130=) rs200999706
NM_001267550.2(TTN):c.9639C>T (p.Ser3213=) rs760666570
NM_001267550.2(TTN):c.96501T>C (p.Ser32167=) rs139223781
NM_001267550.2(TTN):c.96637G>A (p.Asp32213Asn) rs764561909
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.9674A>G (p.Asn3225Ser) rs202011992
NM_001267550.2(TTN):c.96883G>A (p.Val32295Met) rs199532781
NM_001267550.2(TTN):c.96904+4T>C rs373514079
NM_001267550.2(TTN):c.96918C>T (p.Ile32306=) rs72648266
NM_001267550.2(TTN):c.96944C>T (p.Thr32315Ile) rs56027402
NM_001267550.2(TTN):c.96960T>C (p.Ala32320=) rs141431591
NM_001267550.2(TTN):c.96978G>A (p.Leu32326=) rs397517765
NM_001267550.2(TTN):c.9703+17T>A rs377693857
NM_001267550.2(TTN):c.97050dup (p.Glu32351fs) rs794729365
NM_001267550.2(TTN):c.97055G>A (p.Arg32352His) rs575939045
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.970C>T (p.Pro324Ser) rs72647845
NM_001267550.2(TTN):c.9714G>A (p.Pro3238=) rs886042397
NM_001267550.2(TTN):c.97247C>T (p.Ser32416Leu) rs377412567
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97294C>T (p.Leu32432=) rs72648267
NM_001267550.2(TTN):c.97331G>C (p.Arg32444Pro) rs184922462
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97396G>A (p.Glu32466Lys) rs55915651
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.97436G>A (p.Arg32479His) rs369845358
NM_001267550.2(TTN):c.97442G>A (p.Gly32481Glu) rs201364164
NM_001267550.2(TTN):c.97472T>C (p.Ile32491Thr) rs781572378
NM_001267550.2(TTN):c.97492+1G>C rs727505319
NM_001267550.2(TTN):c.9749T>G (p.Val3250Gly) rs55634230
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97578C>T (p.Asp32526=) rs142907833
NM_001267550.2(TTN):c.97579G>A (p.Gly32527Ser) rs762160311
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97613G>A (p.Arg32538His) rs3731749
NM_001267550.2(TTN):c.97642C>T (p.Arg32548Cys) rs377599569