ClinVar Miner

Variants in gene TTN with conflicting interpretations "benign" and "uncertain significance"

Submission 1 (benign) minimum review status: Submission 1 (benign) method:
Submission 2 (uncertain significance) minimum review status: Submission 2 (uncertain significance) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 276
Download table as spreadsheet
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100766-10del rs749872538
NM_001267550.2(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104457C>T (p.Tyr34819=) rs548677252
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.105383C>T (p.Ala35128Val) rs758458467
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.11254+2T>C rs199565715
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3703A>G rs144226338
NM_001267550.2(TTN):c.11311+5051T>C rs142132973
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12307T>C (p.Leu4103=) rs587780988
NM_001267550.2(TTN):c.13969A>C (p.Asn4657His) rs200204761
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.23023G>T (p.Asp7675Tyr) rs552951988
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.266C>G (p.Ala89Gly) rs200165636
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.296-14T>C rs199951296
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30511+3G>A rs563582627
NM_001267550.2(TTN):c.30683-3del rs368277751
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33501AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33827-8C>T rs371318311
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34216C>A (p.Pro11406Thr) rs532102837
NM_001267550.2(TTN):c.34241AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36655T>G (p.Leu12219Val) rs12994774
NM_001267550.2(TTN):c.37432C>T (p.Pro12478Ser) rs200992277
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.43255G>A (p.Val14419Ile) rs529018517
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.49032G>A (p.Val16344=) rs587780980
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52656T>C (p.Pro17552=) rs371031259
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52948G>A (p.Ala17650Thr) rs535008556
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53226T>C (p.Tyr17742=) rs202200861
NM_001267550.2(TTN):c.53287+6G>A rs149890360
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.57273C>T (p.Asp19091=) rs587780489
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62275G>A (p.Glu20759Lys) rs562680371
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.6353T>C (p.Ile2118Thr) rs56404770
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.65276-8T>C rs377484398
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.66051G>A (p.Val22017=) rs587780981
NM_001267550.2(TTN):c.66123A>G (p.Pro22041=) rs727504190
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.687T>C (p.Phe229=) rs376527094
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74596A>G (p.Thr24866Ala) rs199784966
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.77043T>C (p.Tyr25681=) rs370810609
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.80858C>T (p.Thr26953Met) rs377506142
NM_001267550.2(TTN):c.80859G>A (p.Thr26953=) rs771257647
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81123G>A (p.Thr27041=) rs181299250
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.83063G>A (p.Arg27688His) rs185002960
NM_001267550.2(TTN):c.83133G>A (p.Lys27711=) rs369223412
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.85248A>T (p.Thr28416=) rs187180708
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86683G>A (p.Val28895Met) rs201290358
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.8902+14T>A rs13388274
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92241T>C (p.Gly30747=) rs373311745
NM_001267550.2(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.9402C>T (p.Asn3134=) rs587780987
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95415C>A (p.Phe31805Leu) rs587780983
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.96904+4T>C rs373514079
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.99162G>A (p.Lys33054=) rs368686031
NM_001267550.2(TTN):c.99830G>A (p.Gly33277Glu) rs397517781
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_003319.4(TTN):c.13282+39166del rs1553868981
NM_133378.4(TTN):c.80602+8T>C rs369690199

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.