ClinVar Miner

Variants in gene TTN with conflicting interpretations "uncertain significance" and "likely benign"

Submission 1 (uncertain significance) minimum review status: Submission 1 (uncertain significance) method:
Submission 2 (likely benign) minimum review status: Submission 2 (likely benign) method:
Gene type:
ClinVar version:
Total variants with conflicting interpretations: 1141
Download table as spreadsheet
NM_001256850.1(TTN):c.18197-4A>G rs1025136671
NM_001256850.1(TTN):c.29273-7T>G rs778458915
NM_001256850.1(TTN):c.35188+9G>C rs765647346
NM_001256850.1(TTN):c.93175+3G>A rs556524594
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.1(TTN):c.83315A>T rs578191491
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100116C>T (p.Phe33372=) rs770089807
NM_001267550.2(TTN):c.100167A>G (p.Pro33389=) rs778478048
NM_001267550.2(TTN):c.100400T>G (p.Val33467Gly) rs200166942
NM_001267550.2(TTN):c.100467T>C (p.Ser33489=) rs794727540
NM_001267550.2(TTN):c.10049C>T (p.Pro3350Leu) rs139504522
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.100982G>A (p.Arg33661Lys) rs201857158
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.10115-4G>A rs367648529
NM_001267550.2(TTN):c.101262A>G (p.Gly33754=) rs374878689
NM_001267550.2(TTN):c.101291C>T (p.Ala33764Val) rs773542514
NM_001267550.2(TTN):c.101708G>A (p.Arg33903His) rs72629782
NM_001267550.2(TTN):c.101728G>A (p.Glu33910Lys) rs943777958
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101890C>A (p.Arg33964Ser) rs779064623
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.102024A>G (p.Leu34008=) rs727504677
NM_001267550.2(TTN):c.102025T>C (p.Leu34009=) rs794727543
NM_001267550.2(TTN):c.102190G>A (p.Ala34064Thr) rs200237973
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102562G>A (p.Glu34188Lys) rs577667352
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102657T>A (p.Ser34219Arg) rs370077023
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102737G>A (p.Arg34246His) rs372716177
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102885T>C (p.Gly34295=) rs886039175
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.103104A>G (p.Leu34368=) rs371535721
NM_001267550.2(TTN):c.103113T>C (p.Asn34371=) rs886042668
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103207C>T (p.Leu34403=) rs773892755
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103417G>A (p.Val34473Ile) rs188917199
NM_001267550.2(TTN):c.103514A>T (p.Glu34505Val) rs761105256
NM_001267550.2(TTN):c.103576G>C (p.Glu34526Gln) rs770742837
NM_001267550.2(TTN):c.103580T>C (p.Ile34527Thr) rs370618537
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.103913G>A (p.Arg34638His) rs371528685
NM_001267550.2(TTN):c.104251G>C (p.Ala34751Pro) rs185683410
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104277G>A (p.Lys34759=) rs377391143
NM_001267550.2(TTN):c.104298T>C (p.Ala34766=) rs751788327
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104581C>T (p.Arg34861Cys) rs398124463
NM_001267550.2(TTN):c.104605G>A (p.Glu34869Lys) rs563430855
NM_001267550.2(TTN):c.104640G>A (p.Glu34880=) rs373134178
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.104936G>C (p.Gly34979Ala) rs376634193
NM_001267550.2(TTN):c.104943A>G (p.Glu34981=) rs372312805
NM_001267550.2(TTN):c.104978C>T (p.Thr34993Met) rs368945564
NM_001267550.2(TTN):c.105090C>T (p.Asp35030=) rs72629789
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105128G>A (p.Arg35043His) rs370137295
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys) rs765274398
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105876G>A (p.Leu35292=) rs372521529
NM_001267550.2(TTN):c.105999G>A (p.Gln35333=) rs764231632
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106343G>A (p.Arg35448Gln) rs369703073
NM_001267550.2(TTN):c.106442A>G (p.Lys35481Arg) rs200716018
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106927G>A (p.Val35643Ile) rs754459138
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.107089G>C (p.Glu35697Gln) rs199531140
NM_001267550.2(TTN):c.107134A>C (p.Asn35712His) rs727504949
NM_001267550.2(TTN):c.107230A>G (p.Ile35744Val) rs142336788
NM_001267550.2(TTN):c.107301C>A (p.Ser35767Arg) rs1558965303
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107591T>C (p.Val35864Ala) rs374859388
NM_001267550.2(TTN):c.107593G>A (p.Glu35865Lys) rs372841288
NM_001267550.2(TTN):c.107647T>G (p.Ser35883Ala) rs1553477432
NM_001267550.2(TTN):c.107753G>A (p.Cys35918Tyr) rs193212275
NM_001267550.2(TTN):c.107915G>T (p.Ser35972Ile) rs397517478
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.11254+2T>C rs199565715
NM_001267550.2(TTN):c.11311+1370G>A rs148115514
NM_001267550.2(TTN):c.11311+1799G>C rs147314430
NM_001267550.2(TTN):c.11311+1978T>A rs144209883
NM_001267550.2(TTN):c.11311+2007G>C rs200816462
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2950G>A rs144690298
NM_001267550.2(TTN):c.11311+3423T>C rs185931752
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3769C>A rs140064945
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4346A>G rs147073497
NM_001267550.2(TTN):c.11311+4470A>G rs201945197
NM_001267550.2(TTN):c.11311+4523A>C rs200760091
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+5250T>A rs776361113
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11312-3866G>A rs145932311
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-4459T>C rs200378944
NM_001267550.2(TTN):c.11312-4478C>T rs151253841
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.11337C>T (p.Ala3779=) rs375603989
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11506G>A (p.Val3836Met) rs397517825
NM_001267550.2(TTN):c.11614G>A (p.Gly3872Ser) rs754936734
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11788G>A (p.Glu3930Lys) rs186624523
NM_001267550.2(TTN):c.11842C>T (p.Arg3948Cys) rs397517827
NM_001267550.2(TTN):c.11910A>T (p.Thr3970=) rs727503660
NM_001267550.2(TTN):c.11959A>G (p.Ile3987Val) rs551387805
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12332C>G (p.Ala4111Gly) rs140289517
NM_001267550.2(TTN):c.12401T>A (p.Ile4134Asn) rs112009206
NM_001267550.2(TTN):c.12547A>G (p.Lys4183Glu) rs201565932
NM_001267550.2(TTN):c.12564C>A (p.Ala4188=) rs547338168
NM_001267550.2(TTN):c.12653T>C (p.Ile4218Thr) rs374631591
NM_001267550.2(TTN):c.12743A>C (p.Gln4248Pro) rs770583611
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.1288G>A (p.Val430Ile) rs371639583
NM_001267550.2(TTN):c.13090G>A (p.Val4364Met) rs201506104
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.1333G>A (p.Ala445Thr) rs142414432
NM_001267550.2(TTN):c.13340C>T (p.Ser4447Leu) rs777547090
NM_001267550.2(TTN):c.13458C>T (p.Asp4486=) rs748885610
NM_001267550.2(TTN):c.13499A>G (p.Lys4500Arg) rs727503655
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.13618G>A (p.Val4540Met) rs201046911
NM_001267550.2(TTN):c.13701T>G (p.Asp4567Glu) rs200422152
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.1398+4C>T rs368548209
NM_001267550.2(TTN):c.1398+5G>A rs542965530
NM_001267550.2(TTN):c.1399-3C>T rs397517486
NM_001267550.2(TTN):c.14049C>T (p.Ser4683=) rs370208081
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14302G>A (p.Gly4768Ser) rs727503652
NM_001267550.2(TTN):c.1449C>T (p.Ala483=) rs141617218
NM_001267550.2(TTN):c.1450G>A (p.Asp484Asn) rs768211726
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14759C>T (p.Thr4920Met) rs371455094
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14869A>C (p.Thr4957Pro) rs780405420
NM_001267550.2(TTN):c.14998C>T (p.Arg5000Cys) rs369933152
NM_001267550.2(TTN):c.15086G>A (p.Arg5029Gln) rs200792058
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15185G>A (p.Ser5062Asn) rs371687650
NM_001267550.2(TTN):c.15430G>A (p.Glu5144Lys) rs766612317
NM_001267550.2(TTN):c.15497-8T>C rs727505010
NM_001267550.2(TTN):c.15544G>A (p.Gly5182Arg) rs775552018
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.15659A>G (p.Asn5220Ser) rs565670799
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.15822A>T (p.Ala5274=) rs779456916
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16057C>A (p.Arg5353=) rs267599069
NM_001267550.2(TTN):c.16078A>G (p.Thr5360Ala) rs749081117
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16126C>A (p.Leu5376Met) rs72648936
NM_001267550.2(TTN):c.16157T>C (p.Met5386Thr) rs375417155
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16477G>A (p.Gly5493Ser) rs377042940
NM_001267550.2(TTN):c.16480G>A (p.Gly5494Arg) rs727504697
NM_001267550.2(TTN):c.16515T>C (p.Ser5505=) rs201625116
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.16738A>G (p.Asn5580Asp) rs376598696
NM_001267550.2(TTN):c.16751T>A (p.Ile5584Asn) rs779652311
NM_001267550.2(TTN):c.16959T>C (p.Asp5653=) rs770260995
NM_001267550.2(TTN):c.16964T>C (p.Met5655Thr) rs886044306
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.1709C>T (p.Ala570Val) rs146690035
NM_001267550.2(TTN):c.17116G>A (p.Glu5706Lys) rs376593556
NM_001267550.2(TTN):c.17129G>A (p.Arg5710Gln) rs200018866
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17228G>A (p.Arg5743Gln) rs753892271
NM_001267550.2(TTN):c.1742C>T (p.Pro581Leu) rs199778910
NM_001267550.2(TTN):c.17543G>A (p.Gly5848Glu) rs185962498
NM_001267550.2(TTN):c.17806A>G (p.Ile5936Val) rs72648945
NM_001267550.2(TTN):c.17910T>C (p.His5970=) rs1175537809
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.180T>C (p.Asp60=) rs144750850
NM_001267550.2(TTN):c.1815T>C (p.Thr605=) rs757604614
NM_001267550.2(TTN):c.18172C>T (p.Arg6058Cys) rs189127014
NM_001267550.2(TTN):c.1834A>G (p.Lys612Glu) rs727505256
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18557C>T (p.Thr6186Met) rs200359082
NM_001267550.2(TTN):c.18561G>A (p.Ala6187=) rs377556808
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18720A>G (p.Arg6240=) rs201395913
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18777C>A (p.Thr6259=) rs750180579
NM_001267550.2(TTN):c.18778A>C (p.Lys6260Gln) rs375652574
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.1895G>A (p.Gly632Asp) rs150231219
NM_001267550.2(TTN):c.19054A>G (p.Arg6352Gly) rs569003242
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19715-4A>G rs375009631
NM_001267550.2(TTN):c.19728C>T (p.Phe6576=) rs751902051
NM_001267550.2(TTN):c.197C>T (p.Thr66Met) rs372755739
NM_001267550.2(TTN):c.19881G>A (p.Ser6627=) rs371495674
NM_001267550.2(TTN):c.19922C>A (p.Thr6641Asn) rs747240394
NM_001267550.2(TTN):c.19995A>T (p.Glu6665Asp) rs146828735
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20792A>G (p.Asn6931Ser) rs200866883
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21003A>G (p.Lys7001=) rs727504579
NM_001267550.2(TTN):c.210G>T (p.Val70=) rs746033038
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21273A>G (p.Gln7091=) rs878903172
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21332T>C (p.Met7111Thr) rs374408615
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21378A>C (p.Glu7126Asp) rs786205315
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21605C>G (p.Ser7202Cys) rs747376234
NM_001267550.2(TTN):c.21642C>T (p.Asn7214=) rs752620885
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.21689C>T (p.Ala7230Val) rs761223583
NM_001267550.2(TTN):c.21800G>A (p.Gly7267Asp) rs375627540
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.22241-5T>C rs397517501
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22439A>C (p.Gln7480Pro) rs201065037
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.22922C>T (p.Ser7641Leu) rs369508943
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23067C>T (p.Asp7689=) rs191854953
NM_001267550.2(TTN):c.23076C>T (p.Cys7692=) rs769505705
NM_001267550.2(TTN):c.23091A>G (p.Thr7697=) rs1198504900
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23178G>A (p.Ser7726=) rs753546095
NM_001267550.2(TTN):c.23302G>A (p.Asp7768Asn) rs72648973
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.23387G>A (p.Arg7796Gln) rs267599059
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.24045A>T (p.Ser8015=) rs1060503946
NM_001267550.2(TTN):c.24114C>T (p.Asn8038=) rs199576800
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24622G>A (p.Glu8208Lys) rs190192954
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24905C>A (p.Thr8302Lys) rs549604128
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.25035C>T (p.Val8345=) rs781552736
NM_001267550.2(TTN):c.25066C>T (p.Arg8356Cys) rs201810836
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25481G>A (p.Arg8494Gln) rs201418615
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.25619C>T (p.Ser8540Phe) rs201523784
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.2599A>G (p.Ser867Gly) rs148631577
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.2611G>T (p.Val871Leu) rs72647861
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26281G>A (p.Gly8761Ser) rs369385294
NM_001267550.2(TTN):c.2629C>A (p.Pro877Thr) rs751640052
NM_001267550.2(TTN):c.26329G>A (p.Val8777Ile) rs376823283
NM_001267550.2(TTN):c.26468C>T (p.Thr8823Met) rs368151971
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.2649C>T (p.Phe883=) rs775588479
NM_001267550.2(TTN):c.2650G>A (p.Ala884Thr) rs772195446
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-9A>G rs200821070
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.26928G>A (p.Leu8976=) rs370973715
NM_001267550.2(TTN):c.26932G>C (p.Asp8978His) rs773744166
NM_001267550.2(TTN):c.26991A>C (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.27193T>C (p.Cys9065Arg) rs201229221
NM_001267550.2(TTN):c.27198C>G (p.Asn9066Lys) rs369529493
NM_001267550.2(TTN):c.2731G>A (p.Val911Ile) rs141961878
NM_001267550.2(TTN):c.2744G>A (p.Arg915His) rs376922544
NM_001267550.2(TTN):c.27485C>T (p.Thr9162Met) rs199793620
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.2760C>T (p.His920=) rs138788406
NM_001267550.2(TTN):c.2776-14T>C rs201611946
NM_001267550.2(TTN):c.27847G>A (p.Val9283Met) rs727504515
NM_001267550.2(TTN):c.28042C>G (p.Gln9348Glu) rs794727987
NM_001267550.2(TTN):c.28055T>C (p.Leu9352Ser) rs776487201
NM_001267550.2(TTN):c.28127C>G (p.Thr9376Arg) rs749875409
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28175-10C>T rs748478445
NM_001267550.2(TTN):c.28187C>T (p.Pro9396Leu) rs373065549
NM_001267550.2(TTN):c.28200C>T (p.Asp9400=) rs886044076
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28320C>T (p.Gly9440=) rs375083775
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28644G>A (p.Thr9548=) rs376744914
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.28754A>G (p.Glu9585Gly) rs200856239
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.28924A>G (p.Ser9642Gly) rs367888853
NM_001267550.2(TTN):c.28971G>A (p.Ser9657=) rs370903846
NM_001267550.2(TTN):c.29042-2A>C rs6716782
NM_001267550.2(TTN):c.2916G>A (p.Pro972=) rs757569345
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.29448AGA[2] (p.Glu9820del) rs377232641
NM_001267550.2(TTN):c.29577A>G (p.Gln9859=) rs368780181
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.2998C>T (p.Leu1000Phe) rs140953779
NM_001267550.2(TTN):c.3002T>G (p.Met1001Arg) rs148269839
NM_001267550.2(TTN):c.30088C>T (p.Pro10030Ser) rs368531555
NM_001267550.2(TTN):c.3010G>A (p.Glu1004Lys) rs200902055
NM_001267550.2(TTN):c.30181A>C (p.Lys10061Gln) rs184153985
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30282T>G (p.Ser10094=) rs886042543
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.3069C>T (p.Thr1023=) rs371447978
NM_001267550.2(TTN):c.3070G>A (p.Val1024Ile) rs368770038
NM_001267550.2(TTN):c.30713A>G (p.Lys10238Arg) rs780073797
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31070A>G (p.His10357Arg) rs1343660563
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.31321G>A (p.Glu10441Lys) rs901197333
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31441A>G (p.Thr10481Ala) rs370208651
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31505C>T (p.Ser10502Leu) rs768632287
NM_001267550.2(TTN):c.31518C>T (p.Pro10506=) rs746912694
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31807G>A (p.Val10603Ile) rs139790668
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.31846+5A>G rs760788961
NM_001267550.2(TTN):c.31875A>C (p.Thr10625=) rs182934463
NM_001267550.2(TTN):c.32035G>A (p.Val10679Ile) rs369932282
NM_001267550.2(TTN):c.32071G>A (p.Ala10691Thr) rs371452173
NM_001267550.2(TTN):c.32186C>T (p.Thr10729Met) rs115119858
NM_001267550.2(TTN):c.32198-10T>C rs371121439
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.3241G>T (p.Ala1081Ser) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32555-12G>T rs397517540
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32706G>A (p.Ala10902=) rs372124201
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32767A>C (p.Lys10923Gln) rs367720439
NM_001267550.2(TTN):c.32953C>T (p.Arg10985Trp) rs201991864
NM_001267550.2(TTN):c.3295G>A (p.Val1099Met) rs368282893
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33172+4G>A rs756475184
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33501AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33501AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33838C>T (p.Pro11280Ser) rs374449452
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[1] (p.11363VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34241AAG[2] (p.Glu11416del) rs397517549
NM_001267550.2(TTN):c.34391A>G (p.Lys11464Arg) rs786205396
NM_001267550.2(TTN):c.3445G>A (p.Asp1149Asn) rs368967197
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34571G>A (p.Arg11524Gln) rs201622536
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34660GAA[1] (p.Glu11555del) rs763098227
NM_001267550.2(TTN):c.34675A>G (p.Ile11559Val) rs752903377
NM_001267550.2(TTN):c.34708+9G>T rs397517551
NM_001267550.2(TTN):c.34734A>G (p.Val11578=) rs866407525
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.35037G>A (p.Pro11679=) rs369095270
NM_001267550.2(TTN):c.35083G>A (p.Glu11695Lys) rs376117402
NM_001267550.2(TTN):c.35268G>A (p.Pro11756=) rs778338717
NM_001267550.2(TTN):c.35313G>A (p.Pro11771=) rs369739111
NM_001267550.2(TTN):c.3605T>C (p.Val1202Ala) rs150667217
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36708A>T (p.Glu12236Asp) rs796478043
NM_001267550.2(TTN):c.3680A>G (p.Lys1227Arg) rs541811273
NM_001267550.2(TTN):c.37421T>C (p.Ile12474Thr) rs72650057
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.39044-9T>A rs184888200
NM_001267550.2(TTN):c.39050A>G (p.Glu13017Gly) rs368056479
NM_001267550.2(TTN):c.39099T>C (p.Pro13033=) rs755793186
NM_001267550.2(TTN):c.39166G>T (p.Val13056Leu) rs727504201
NM_001267550.2(TTN):c.39230T>C (p.Val13077Ala) rs398124449
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39368C>T (p.Ala13123Val) rs761828404
NM_001267550.2(TTN):c.39375A>G (p.Pro13125=) rs566794300
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39473T>C (p.Val13158Ala) rs1553769611
NM_001267550.2(TTN):c.39548-8A>G rs369594816
NM_001267550.2(TTN):c.39578A>G (p.Glu13193Gly) rs190461403
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.39786A>G (p.Glu13262=) rs398124450
NM_001267550.2(TTN):c.39885G>A (p.Pro13295=) rs756518824
NM_001267550.2(TTN):c.40395A>G (p.Ile13465Met) rs766145596
NM_001267550.2(TTN):c.40408+3dup rs727504922
NM_001267550.2(TTN):c.40408+7_40408+10dup rs397517560
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.40557C>T (p.Ser13519=) rs371178429
NM_001267550.2(TTN):c.40558G>A (p.Val13520Ile) rs587780488
NM_001267550.2(TTN):c.40576GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.40581A>G (p.Glu13527=) rs775954427
NM_001267550.2(TTN):c.40595T>C (p.Val13532Ala) rs756446770
NM_001267550.2(TTN):c.40788A>G (p.Glu13596=) rs886042511
NM_001267550.2(TTN):c.40796C>T (p.Thr13599Ile) rs370418677
NM_001267550.2(TTN):c.40903G>A (p.Ala13635Thr) rs191699632
NM_001267550.2(TTN):c.40939A>G (p.Lys13647Glu) rs777187629
NM_001267550.2(TTN):c.40973A>G (p.Lys13658Arg) rs184713215
NM_001267550.2(TTN):c.41019G>A (p.Pro13673=) rs762470432
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.41488G>A (p.Val13830Ile) rs149059189
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.41596G>A (p.Val13866Ile) rs375474669
NM_001267550.2(TTN):c.41703T>C (p.Thr13901=) rs756282138
NM_001267550.2(TTN):c.41812A>G (p.Met13938Val) rs201725483
NM_001267550.2(TTN):c.41920G>A (p.Val13974Ile) rs373881831
NM_001267550.2(TTN):c.42056G>A (p.Arg14019His) rs374683153
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42840T>G (p.Asp14280Glu) rs760643071
NM_001267550.2(TTN):c.42891C>T (p.Gly14297=) rs550471556
NM_001267550.2(TTN):c.42892G>A (p.Glu14298Lys) rs778634417
NM_001267550.2(TTN):c.43138T>C (p.Cys14380Arg) rs557125278
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.43244G>A (p.Ser14415Asn) rs370342831
NM_001267550.2(TTN):c.43255G>A (p.Val14419Ile) rs529018517
NM_001267550.2(TTN):c.43417G>C (p.Asp14473His) rs397517573
NM_001267550.2(TTN):c.43502C>G (p.Thr14501Ser) rs115825044
NM_001267550.2(TTN):c.43565A>G (p.His14522Arg) rs374085402
NM_001267550.2(TTN):c.43577G>A (p.Arg14526Gln) rs373491468
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.43748-7C>T rs771927358
NM_001267550.2(TTN):c.43836A>G (p.Ala14612=) rs755492644
NM_001267550.2(TTN):c.43986T>G (p.Asp14662Glu) rs201390600
NM_001267550.2(TTN):c.43G>A (p.Val15Ile) rs201857541
NM_001267550.2(TTN):c.44036G>A (p.Arg14679Gln) rs369709751
NM_001267550.2(TTN):c.44077C>T (p.Arg14693Cys) rs200445568
NM_001267550.2(TTN):c.44112C>T (p.His14704=) rs754693395
NM_001267550.2(TTN):c.44210G>A (p.Arg14737His) rs373298007
NM_001267550.2(TTN):c.44210G>T (p.Arg14737Leu) rs373298007
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44282-6G>A rs372166634
NM_001267550.2(TTN):c.44323G>A (p.Val14775Met) rs540115992
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.44423A>C (p.Lys14808Thr) rs374419129
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.44593G>A (p.Glu14865Lys) rs543102139
NM_001267550.2(TTN):c.44599G>A (p.Gly14867Arg) rs144848584
NM_001267550.2(TTN):c.44790G>A (p.Lys14930=) rs886042667
NM_001267550.2(TTN):c.44978G>A (p.Gly14993Glu) rs200931793
NM_001267550.2(TTN):c.45053C>A (p.Ala15018Glu) rs72677221
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45499G>A (p.Val15167Ile) rs183245562
NM_001267550.2(TTN):c.45598G>A (p.Ala15200Thr) rs752318420
NM_001267550.2(TTN):c.45748A>T (p.Ser15250Cys) rs776190494
NM_001267550.2(TTN):c.45760A>T (p.Ile15254Phe) rs72677226
NM_001267550.2(TTN):c.46147G>C (p.Glu15383Gln) rs773073914
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46823T>C (p.Leu15608Ser) rs397517588
NM_001267550.2(TTN):c.46847C>T (p.Thr15616Met) rs368057764
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47129G>A (p.Arg15710His) rs185689179
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47217C>T (p.Gly15739=) rs373305832
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47598A>G (p.Leu15866=) rs879099244
NM_001267550.2(TTN):c.47761-4G>A rs564918195
NM_001267550.2(TTN):c.47766C>T (p.Thr15922=) rs757006832
NM_001267550.2(TTN):c.47767G>A (p.Gly15923Arg) rs371943746
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.47998G>C (p.Asp16000His) rs201388509
NM_001267550.2(TTN):c.48143T>C (p.Ile16048Thr) rs749678590
NM_001267550.2(TTN):c.48161-4del rs730880371
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48394C>T (p.Arg16132Cys) rs2303830
NM_001267550.2(TTN):c.48462G>A (p.Thr16154=) rs202141158
NM_001267550.2(TTN):c.48589C>T (p.Arg16197Cys) rs748917057
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48960T>C (p.Asp16320=) rs1057523898
NM_001267550.2(TTN):c.49357C>A (p.Pro16453Thr) rs200121902
NM_001267550.2(TTN):c.49366C>T (p.Arg16456Cys) rs727504986
NM_001267550.2(TTN):c.49367G>A (p.Arg16456His) rs768914789
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.49527A>G (p.Thr16509=) rs727505248
NM_001267550.2(TTN):c.49649-11T>C rs727504474
NM_001267550.2(TTN):c.49758T>C (p.Tyr16586=) rs72677247
NM_001267550.2(TTN):c.49871G>A (p.Arg16624Gln) rs367566671
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.50059A>G (p.Ile16687Val) rs727504194
NM_001267550.2(TTN):c.50212G>A (p.Glu16738Lys) rs148018042
NM_001267550.2(TTN):c.5022C>G (p.Ala1674=) rs753444772
NM_001267550.2(TTN):c.50363T>C (p.Ile16788Thr) rs397517599
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.50452G>A (p.Glu16818Lys) rs397517600
NM_001267550.2(TTN):c.50480G>A (p.Arg16827Gln) rs138896856
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50758C>G (p.Pro16920Ala) rs377289817
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51782G>A (p.Arg17261Gln) rs201825412
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.5198C>T (p.Thr1733Met) rs367700246
NM_001267550.2(TTN):c.52004G>A (p.Arg17335His) rs367603302
NM_001267550.2(TTN):c.52006G>A (p.Val17336Ile) rs567781604
NM_001267550.2(TTN):c.52022G>A (p.Arg17341Gln) rs370390570
NM_001267550.2(TTN):c.52144A>G (p.Arg17382Gly) rs397517607
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52242C>T (p.Pro17414=) rs765216874
NM_001267550.2(TTN):c.52290T>C (p.Tyr17430=) rs990974705
NM_001267550.2(TTN):c.52317A>G (p.Lys17439=) rs370450339
NM_001267550.2(TTN):c.52331G>A (p.Arg17444His) rs376080116
NM_001267550.2(TTN):c.52374T>C (p.Val17458=) rs752571545
NM_001267550.2(TTN):c.52536C>G (p.Asn17512Lys) rs199615557
NM_001267550.2(TTN):c.5255G>A (p.Arg1752His) rs150737838
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.52920C>T (p.Tyr17640=) rs1553687219
NM_001267550.2(TTN):c.52927C>T (p.Arg17643Trp) rs375944265
NM_001267550.2(TTN):c.53012C>T (p.Ala17671Val) rs549478203
NM_001267550.2(TTN):c.53055G>A (p.Met17685Ile) rs200387466
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.53122_53123delinsGT (p.Lys17708Val) rs886042743
NM_001267550.2(TTN):c.53142T>C (p.Asp17714=) rs373316165
NM_001267550.2(TTN):c.53185C>T (p.Leu17729=) rs767559716
NM_001267550.2(TTN):c.53260T>C (p.Phe17754Leu) rs397517612
NM_001267550.2(TTN):c.53295T>C (p.Pro17765=) rs771792080
NM_001267550.2(TTN):c.53443A>G (p.Ile17815Val) rs368065637
NM_001267550.2(TTN):c.53625A>G (p.Thr17875=) rs373277508
NM_001267550.2(TTN):c.53717A>G (p.Lys17906Arg) rs727503606
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.53780T>C (p.Leu17927Pro) rs369678018
NM_001267550.2(TTN):c.54054G>A (p.Lys18018=) rs761146363
NM_001267550.2(TTN):c.54068G>A (p.Arg18023Gln) rs727503603
NM_001267550.2(TTN):c.54109C>T (p.Arg18037Trp) rs201623791
NM_001267550.2(TTN):c.54140C>T (p.Ala18047Val) rs373815064
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.54360T>C (p.Thr18120=) rs749248039
NM_001267550.2(TTN):c.543C>T (p.Ser181=) rs758598014
NM_001267550.2(TTN):c.54477C>G (p.Val18159=) rs374335905
NM_001267550.2(TTN):c.5464A>C (p.Met1822Leu) rs201581947
NM_001267550.2(TTN):c.54710T>C (p.Leu18237Pro) rs201412693
NM_001267550.2(TTN):c.54740T>C (p.Met18247Thr) rs200585270
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.54811+10C>T rs796651993
NM_001267550.2(TTN):c.54818C>T (p.Pro18273Leu) rs201035511
NM_001267550.2(TTN):c.54855G>A (p.Thr18285=) rs200410212
NM_001267550.2(TTN):c.54874G>C (p.Gly18292Arg) rs377512675
NM_001267550.2(TTN):c.5503C>A (p.Gln1835Lys) rs537070177
NM_001267550.2(TTN):c.55079C>T (p.Pro18360Leu) rs192788942
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55379C>T (p.Thr18460Ile) rs372778818
NM_001267550.2(TTN):c.55417A>G (p.Arg18473Gly) rs72646822
NM_001267550.2(TTN):c.55503G>A (p.Lys18501=) rs879239475
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55692T>A (p.Pro18564=) rs200864020
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.55986C>T (p.Val18662=) rs747136342
NM_001267550.2(TTN):c.56019T>C (p.Thr18673=) rs183047238
NM_001267550.2(TTN):c.56118C>T (p.Ala18706=) rs1559671858
NM_001267550.2(TTN):c.56256G>A (p.Pro18752=) rs111262307
NM_001267550.2(TTN):c.56351G>A (p.Arg18784His) rs771284532
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.56456A>G (p.Asn18819Ser) rs201337786
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56686G>A (p.Val18896Met) rs370629962
NM_001267550.2(TTN):c.5668C>T (p.Arg1890Cys) rs146496197
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.56942C>T (p.Ala18981Val) rs397517627
NM_001267550.2(TTN):c.56947G>A (p.Ala18983Thr) rs377000174
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57263-4C>T rs373552048
NM_001267550.2(TTN):c.5739C>T (p.Thr1913=) rs530291008
NM_001267550.2(TTN):c.5740G>A (p.Ala1914Thr) rs118161093
NM_001267550.2(TTN):c.5741C>T (p.Ala1914Val) rs374203813
NM_001267550.2(TTN):c.57478G>A (p.Val19160Ile) rs200778464
NM_001267550.2(TTN):c.57478G>C (p.Val19160Leu) rs200778464
NM_001267550.2(TTN):c.57544+7dup rs750881309
NM_001267550.2(TTN):c.57586C>G (p.Leu19196Val) rs397517630
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.57682C>T (p.Arg19228Cys) rs757820671
NM_001267550.2(TTN):c.57808G>C (p.Val19270Leu) rs369440319
NM_001267550.2(TTN):c.57860G>A (p.Arg19287His) rs371422299
NM_001267550.2(TTN):c.57971G>A (p.Arg19324Gln) rs186809500
NM_001267550.2(TTN):c.58008T>C (p.Asn19336=) rs770525693
NM_001267550.2(TTN):c.58072C>T (p.Arg19358Cys) rs371973579
NM_001267550.2(TTN):c.58190C>T (p.Thr19397Met) rs373527448
NM_001267550.2(TTN):c.58191G>A (p.Thr19397=) rs370091658
NM_001267550.2(TTN):c.58205A>G (p.Glu19402Gly) rs886042539
NM_001267550.2(TTN):c.58226G>A (p.Arg19409His) rs201505306
NM_001267550.2(TTN):c.583+5G>A rs397517663
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58576G>A (p.Val19526Ile) rs377682563
NM_001267550.2(TTN):c.58653T>C (p.Ile19551=) rs727504980
NM_001267550.2(TTN):c.587AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.58841T>C (p.Ile19614Thr) rs199933004
NM_001267550.2(TTN):c.58971A>C (p.Glu19657Asp) rs200728232
NM_001267550.2(TTN):c.59248G>A (p.Gly19750Ser) rs200732032
NM_001267550.2(TTN):c.59282A>G (p.Asn19761Ser) rs563969986
NM_001267550.2(TTN):c.59316G>A (p.Pro19772=) rs377180286
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.597A>G (p.Val199=) rs144214844
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.59937G>A (p.Gly19979=) rs727505101
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.60008G>A (p.Arg20003His) rs756091180
NM_001267550.2(TTN):c.60654G>A (p.Thr20218=) rs776141268
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61355T>A (p.Ile20452Asn) rs375946418
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.61556G>A (p.Arg20519Gln) rs727504191
NM_001267550.2(TTN):c.61825C>T (p.Arg20609Cys) rs786205389
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.61962C>T (p.Ile20654=) rs369710636
NM_001267550.2(TTN):c.62030T>C (p.Ile20677Thr) rs558670891
NM_001267550.2(TTN):c.62098A>G (p.Asn20700Asp) rs151193056
NM_001267550.2(TTN):c.62280T>C (p.Val20760=) rs372065796
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62432A>G (p.Asp20811Gly) rs72646849
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62507G>A (p.Arg20836Gln) rs201693851
NM_001267550.2(TTN):c.62547G>A (p.Thr20849=) rs368969893
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.62994C>T (p.Tyr20998=) rs375006117
NM_001267550.2(TTN):c.63065G>A (p.Arg21022His) rs727503585
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63181C>T (p.Pro21061Ser) rs375401971
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63463C>T (p.Arg21155Cys) rs374727686
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.63743T>C (p.Leu21248Pro) rs745323281
NM_001267550.2(TTN):c.63775G>A (p.Val21259Ile) rs371286595
NM_001267550.2(TTN):c.63917G>A (p.Arg21306His) rs202240487
NM_001267550.2(TTN):c.63960T>A (p.Val21320=) rs397517655
NM_001267550.2(TTN):c.64101G>A (p.Pro21367=) rs397517657
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.64338T>C (p.Ala21446=) rs371514555
NM_001267550.2(TTN):c.64673-5T>C rs530496528
NM_001267550.2(TTN):c.64683C>G (p.Gly21561=) rs542156552
NM_001267550.2(TTN):c.64720G>A (p.Ala21574Thr) rs578085621
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.64811G>A (p.Arg21604Gln) rs188996850
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.65173G>A (p.Val21725Ile) rs368716894
NM_001267550.2(TTN):c.65187G>A (p.Glu21729=) rs397517660
NM_001267550.2(TTN):c.65276-16C>T rs370634364
NM_001267550.2(TTN):c.65276-8T>C rs377484398
NM_001267550.2(TTN):c.65319T>C (p.Thr21773=) rs746956869
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65514C>T (p.Thr21838=) rs372543748
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65574T>C (p.Asn21858=) rs374858668
NM_001267550.2(TTN):c.65649G>T (p.Leu21883Phe) rs374736305
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.66172C>T (p.Arg22058Cys) rs199643269
NM_001267550.2(TTN):c.66288A>G (p.Glu22096=) rs368297582
NM_001267550.2(TTN):c.66349G>A (p.Ala22117Thr) rs727505036
NM_001267550.2(TTN):c.66385C>T (p.Arg22129Cys) rs763729258
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66430G>A (p.Ala22144Thr) rs183276016
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.66673G>A (p.Asp22225Asn) rs72646870
NM_001267550.2(TTN):c.66702C>T (p.Ala22234=) rs371802557
NM_001267550.2(TTN):c.66703G>A (p.Val22235Ile) rs751354601
NM_001267550.2(TTN):c.6690C>T (p.Phe2230=) rs755122338
NM_001267550.2(TTN):c.66917T>C (p.Ile22306Thr) rs397517667
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67104A>C (p.Lys22368Asn) rs727503577
NM_001267550.2(TTN):c.6713C>T (p.Thr2238Met) rs201284459
NM_001267550.2(TTN):c.67146C>T (p.Gly22382=) rs770418172
NM_001267550.2(TTN):c.67322A>G (p.Glu22441Gly) rs201223583
NM_001267550.2(TTN):c.67444C>T (p.Arg22482Trp) rs563233842
NM_001267550.2(TTN):c.67604G>A (p.Ser22535Asn) rs375676529
NM_001267550.2(TTN):c.67637-4A>G rs376053678
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.67959T>C (p.Phe22653=) rs72646877
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68161G>A (p.Glu22721Lys) rs374492812
NM_001267550.2(TTN):c.68195C>T (p.Ser22732Leu) rs727505352
NM_001267550.2(TTN):c.68208T>A (p.Val22736=) rs727503575
NM_001267550.2(TTN):c.6820C>G (p.Gln2274Glu) rs145649088
NM_001267550.2(TTN):c.68218C>T (p.Pro22740Ser) rs886039082
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68604C>T (p.Asp22868=) rs750368181
NM_001267550.2(TTN):c.68762C>T (p.Thr22921Ile) rs534567766
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.687T>C (p.Phe229=) rs376527094
NM_001267550.2(TTN):c.68823C>T (p.Tyr22941=) rs200717463
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.69044C>T (p.Ala23015Val) rs771710562
NM_001267550.2(TTN):c.69338G>A (p.Arg23113Gln) rs370890454
NM_001267550.2(TTN):c.69639T>C (p.Arg23213=) rs1487392148
NM_001267550.2(TTN):c.69660A>G (p.Ala23220=) rs371996901
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69864A>G (p.Ile23288Met) rs368867993
NM_001267550.2(TTN):c.69876A>C (p.Thr23292=) rs1267766480
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.69904G>A (p.Val23302Ile) rs190421400
NM_001267550.2(TTN):c.69984G>A (p.Ala23328=) rs56052239
NM_001267550.2(TTN):c.70042G>A (p.Ala23348Thr) rs775146212
NM_001267550.2(TTN):c.70056A>G (p.Arg23352=) rs75948012
NM_001267550.2(TTN):c.70097T>C (p.Val23366Ala) rs372782502
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.70137C>A (p.Thr23379=) rs770349910
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.70260G>A (p.Pro23420=) rs72646887
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.7060C>T (p.Arg2354Cys) rs145039979
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70833G>A (p.Ala23611=) rs377220635
NM_001267550.2(TTN):c.70864G>A (p.Val23622Ile) rs72646892
NM_001267550.2(TTN):c.70906C>T (p.Arg23636Cys) rs189208539
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71149G>T (p.Asp23717Tyr) rs371818894
NM_001267550.2(TTN):c.71300G>A (p.Arg23767Gln) rs370516890
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.7156G>A (p.Gly2386Ser) rs777101912
NM_001267550.2(TTN):c.71581T>C (p.Tyr23861His) rs759611506
NM_001267550.2(TTN):c.71608G>A (p.Gly23870Ser) rs727503564
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.71723G>A (p.Gly23908Asp) rs540161344
NM_001267550.2(TTN):c.7173C>T (p.Asp2391=) rs374509926
NM_001267550.2(TTN):c.71832A>C (p.Lys23944Asn) rs1449315408
NM_001267550.2(TTN):c.71841G>C (p.Lys23947Asn) rs56019808
NM_001267550.2(TTN):c.71903A>C (p.Asn23968Thr) rs769320596
NM_001267550.2(TTN):c.72001G>A (p.Ala24001Thr) rs180828370
NM_001267550.2(TTN):c.72114G>A (p.Thr24038=) rs768064912
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72181A>G (p.Met24061Val) rs201482015
NM_001267550.2(TTN):c.72182T>C (p.Met24061Thr) rs200471370
NM_001267550.2(TTN):c.72302C>A (p.Thr24101Asn) rs192962624
NM_001267550.2(TTN):c.72358C>T (p.Leu24120Phe) rs372309164
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72586C>T (p.Arg24196Cys) rs185626486
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.72723C>G (p.Val24241=) rs372701206
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72803G>A (p.Arg24268His) rs140018785
NM_001267550.2(TTN):c.72824A>T (p.Lys24275Ile) rs199860952
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.73224G>A (p.Gly24408=) rs371034493
NM_001267550.2(TTN):c.732C>T (p.Ala244=) rs761859812
NM_001267550.2(TTN):c.73334C>T (p.Thr24445Ile) rs377334665
NM_001267550.2(TTN):c.7339G>A (p.Val2447Met) rs779064962
NM_001267550.2(TTN):c.73517G>A (p.Gly24506Asp) rs567446185
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.7392T>C (p.Leu2464=) rs565784637
NM_001267550.2(TTN):c.74331C>T (p.Asp24777=) rs368530092
NM_001267550.2(TTN):c.74513G>C (p.Gly24838Ala) rs200723435
NM_001267550.2(TTN):c.74527A>G (p.Asn24843Asp) rs373527654
NM_001267550.2(TTN):c.74596A>G (p.Thr24866Ala) rs199784966
NM_001267550.2(TTN):c.74597CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74763C>T (p.Ser24921=) rs371563258
NM_001267550.2(TTN):c.74844G>A (p.Lys24948=) rs371884545
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75099C>T (p.Asp25033=) rs370272814
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.7524T>C (p.His2508=) rs2291307
NM_001267550.2(TTN):c.75361A>G (p.Ile25121Val) rs199508062
NM_001267550.2(TTN):c.75504T>G (p.Ser25168Arg) rs375204371
NM_001267550.2(TTN):c.75527G>A (p.Arg25176His) rs375693396
NM_001267550.2(TTN):c.75668C>T (p.Thr25223Ile) rs370070176
NM_001267550.2(TTN):c.75682C>T (p.Pro25228Ser) rs377226540
NM_001267550.2(TTN):c.75914C>T (p.Pro25305Leu) rs142453163
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.76296T>C (p.Asp25432=) rs868081432
NM_001267550.2(TTN):c.76482C>T (p.Asp25494=) rs370908118
NM_001267550.2(TTN):c.76645G>A (p.Gly25549Ser) rs181166140
NM_001267550.2(TTN):c.76739C>A (p.Thr25580Lys) rs56372592
NM_001267550.2(TTN):c.76922G>A (p.Arg25641His) rs369707906
NM_001267550.2(TTN):c.76987G>A (p.Asp25663Asn) rs143186270
NM_001267550.2(TTN):c.77043T>C (p.Tyr25681=) rs370810609
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.7711G>A (p.Glu2571Lys) rs149660690
NM_001267550.2(TTN):c.77166T>C (p.Pro25722=) rs757252494
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77216C>G (p.Ala25739Gly) rs56391938
NM_001267550.2(TTN):c.77302C>A (p.Leu25768Ile) rs541266544
NM_001267550.2(TTN):c.77515A>C (p.Lys25839Gln) rs1371831965
NM_001267550.2(TTN):c.77706C>T (p.Asp25902=) rs375764395
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.77907C>T (p.Asn25969=) rs375903820
NM_001267550.2(TTN):c.78774A>G (p.Arg26258=) rs368270588
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.78896T>A (p.Val26299Asp) rs73036377
NM_001267550.2(TTN):c.78906A>C (p.Glu26302Asp) rs534003014
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79334G>A (p.Arg26445His) rs764254441
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.79410G>A (p.Gly26470=) rs140942979
NM_001267550.2(TTN):c.79546G>A (p.Gly26516Ser) rs776256093
NM_001267550.2(TTN):c.7957T>C (p.Leu2653=) rs201837864
NM_001267550.2(TTN):c.79591G>A (p.Glu26531Lys) rs772211147
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.79883G>A (p.Arg26628Gln) rs201091376
NM_001267550.2(TTN):c.79883G>C (p.Arg26628Pro) rs201091376
NM_001267550.2(TTN):c.80209T>A (p.Cys26737Ser) rs566764105
NM_001267550.2(TTN):c.80425G>A (p.Gly26809Ser) rs369941201
NM_001267550.2(TTN):c.80527T>C (p.Leu26843=) rs142004835
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80701A>G (p.Ile26901Val) rs201562505
NM_001267550.2(TTN):c.80905G>A (p.Val26969Ile) rs377667066
NM_001267550.2(TTN):c.80944T>C (p.Phe26982Leu) rs200406978
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81247T>C (p.Ser27083Pro) rs186273940
NM_001267550.2(TTN):c.81302G>T (p.Gly27101Val) rs201490050
NM_001267550.2(TTN):c.81393A>G (p.Lys27131=) rs374501251
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81527G>T (p.Arg27176Leu) rs199726308
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81737T>C (p.Ile27246Thr) rs367603381
NM_001267550.2(TTN):c.8184C>G (p.Val2728=) rs753356474
NM_001267550.2(TTN):c.8184C>T (p.Val2728=) rs753356474
NM_001267550.2(TTN):c.81850G>A (p.Val27284Ile) rs746222222
NM_001267550.2(TTN):c.81856G>A (p.Val27286Ile) rs372784067
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82235C>A (p.Thr27412Lys) rs201489661
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82684T>C (p.Tyr27562His) rs376616067
NM_001267550.2(TTN):c.82688G>A (p.Arg27563His) rs118079537
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82754C>A (p.Ser27585Tyr) rs72648215
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_001267550.2(TTN):c.82933C>T (p.Arg27645Cys) rs751318609
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82964G>A (p.Gly27655Asp) rs373745130
NM_001267550.2(TTN):c.83017C>A (p.Pro27673Thr) rs769343491
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83299C>A (p.Pro27767Thr) rs184643087
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.83580G>A (p.Val27860=) rs200096597
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83733C>T (p.Ser27911=) rs375442124
NM_001267550.2(TTN):c.84148A>G (p.Ile28050Val) rs201348580
NM_001267550.2(TTN):c.84157C>T (p.Leu28053Phe) rs1194981313
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.8434G>C (p.Val2812Leu) rs146636599
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.84923A>C (p.Gln28308Pro) rs201674674
NM_001267550.2(TTN):c.84977G>A (p.Arg28326Gln) rs200843338
NM_001267550.2(TTN):c.85040T>C (p.Ile28347Thr) rs397517731
NM_001267550.2(TTN):c.85389C>T (p.Leu28463=) rs144731702
NM_001267550.2(TTN):c.85443A>G (p.Ala28481=) rs373326137
NM_001267550.2(TTN):c.85651C>A (p.Pro28551Thr) rs142478636
NM_001267550.2(TTN):c.85745T>A (p.Ile28582Lys) rs201688358
NM_001267550.2(TTN):c.85769G>A (p.Arg28590Gln) rs375667028
NM_001267550.2(TTN):c.85953A>G (p.Leu28651=) rs546573613
NM_001267550.2(TTN):c.86025G>A (p.Pro28675=) rs369528150
NM_001267550.2(TTN):c.86045C>T (p.Pro28682Leu) rs760467197
NM_001267550.2(TTN):c.86085C>T (p.Asp28695=) rs773001228
NM_001267550.2(TTN):c.86117G>A (p.Arg28706Gln) rs199788826
NM_001267550.2(TTN):c.86355T>C (p.Asn28785=) rs745857020
NM_001267550.2(TTN):c.8641A>C (p.Thr2881Pro) rs546667760
NM_001267550.2(TTN):c.86526T>G (p.Val28842=) rs72648226
NM_001267550.2(TTN):c.86700C>T (p.Asn28900=) rs727504793
NM_001267550.2(TTN):c.86729AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86910C>T (p.Gly28970=) rs397517736
NM_001267550.2(TTN):c.86935G>A (p.Val28979Ile) rs201687390
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87345T>C (p.Tyr29115=) rs369444690
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87495C>T (p.Asp29165=) rs371763584
NM_001267550.2(TTN):c.87600G>C (p.Met29200Ile) rs750362675
NM_001267550.2(TTN):c.87611C>G (p.Thr29204Arg) rs72648228
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.87805G>A (p.Val29269Ile) rs727503551
NM_001267550.2(TTN):c.87808G>A (p.Val29270Ile) rs141624266
NM_001267550.2(TTN):c.87878G>A (p.Arg29293His) rs202001776
NM_001267550.2(TTN):c.8788G>A (p.Val2930Ile) rs56373393
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88090G>A (p.Gly29364Ser) rs183013408
NM_001267550.2(TTN):c.88112T>C (p.Ile29371Thr) rs767890385
NM_001267550.2(TTN):c.88246G>T (p.Val29416Phe) rs755325663
NM_001267550.2(TTN):c.88285A>G (p.Ile29429Val) rs373738818
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88685G>A (p.Gly29562Asp) rs72648235
NM_001267550.2(TTN):c.88720C>T (p.Arg29574Cys) rs200513274
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88733G>A (p.Arg29578His) rs374147064
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.88983C>T (p.Gly29661=) rs371678936
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.8902+14T>A rs13388274
NM_001267550.2(TTN):c.89295T>C (p.Ala29765=) rs375374658
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.89760A>C (p.Glu29920Asp) rs747181293
NM_001267550.2(TTN):c.89906T>C (p.Val29969Ala) rs201220828
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.89984T>C (p.Ile29995Thr) rs754676727
NM_001267550.2(TTN):c.90159A>C (p.Lys30053Asn) rs886039117
NM_001267550.2(TTN):c.90246A>G (p.Ile30082Met) rs886038812
NM_001267550.2(TTN):c.90332T>C (p.Leu30111Pro) rs368516973
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90624T>C (p.Asn30208=) rs370479059
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90691C>T (p.Pro30231Ser) rs373722546
NM_001267550.2(TTN):c.90758GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.90786C>T (p.Ile30262=) rs727504439
NM_001267550.2(TTN):c.90793C>T (p.Arg30265Trp) rs200022152
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.90968G>C (p.Arg30323Thr) rs11887722
NM_001267550.2(TTN):c.90991C>T (p.Pro30331Ser) rs75022916
NM_001267550.2(TTN):c.91173A>C (p.Glu30391Asp) rs199505541
NM_001267550.2(TTN):c.91224C>T (p.Ser30408=) rs1057522835
NM_001267550.2(TTN):c.91311A>G (p.Glu30437=) rs374094732
NM_001267550.2(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_001267550.2(TTN):c.91425C>T (p.Asp30475=) rs145133144
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.91749C>T (p.Ser30583=) rs886044458
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.91884A>G (p.Arg30628=) rs144922355
NM_001267550.2(TTN):c.918C>T (p.Ser306=) rs773898647
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92226G>A (p.Arg30742=) rs759484932
NM_001267550.2(TTN):c.92294G>C (p.Arg30765Thr) rs373099440
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92451G>T (p.Glu30817Asp) rs397517755
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92750T>C (p.Val30917Ala) rs748545482
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.92871T>C (p.Ala30957=) rs748822553
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93129C>T (p.Asp31043=) rs758336721
NM_001267550.2(TTN):c.93214C>T (p.Arg31072Cys) rs368932767
NM_001267550.2(TTN):c.93215G>A (p.Arg31072His) rs141817409
NM_001267550.2(TTN):c.93255G>A (p.Pro31085=) rs372611171
NM_001267550.2(TTN):c.93367G>C (p.Val31123Leu) rs202096200
NM_001267550.2(TTN):c.9338G>A (p.Arg3113His) rs141258018
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93725G>A (p.Arg31242His) rs369899675
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.93972A>G (p.Glu31324=) rs727504528
NM_001267550.2(TTN):c.93981C>G (p.Val31327=) rs370894846
NM_001267550.2(TTN):c.94016C>T (p.Thr31339Ile) rs184078016
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.94590A>G (p.Pro31530=) rs558347312
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.94633C>T (p.Arg31545Cys) rs202187398
NM_001267550.2(TTN):c.94700A>G (p.Asn31567Ser) rs886042885
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.9488G>A (p.Arg3163His) rs149755500
NM_001267550.2(TTN):c.95068G>A (p.Val31690Met) rs727503543
NM_001267550.2(TTN):c.95078C>A (p.Ala31693Asp) rs2288326
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95130C>A (p.Gly31710=) rs727504857
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.95961C>T (p.Ala31987=) rs369405564
NM_001267550.2(TTN):c.96015C>T (p.Pro32005=) rs183620684
NM_001267550.2(TTN):c.96098G>A (p.Arg32033His) rs200648462
NM_001267550.2(TTN):c.96138A>T (p.Ile32046=) rs368154623
NM_001267550.2(TTN):c.96173G>A (p.Arg32058Gln) rs374063064
NM_001267550.2(TTN):c.96225T>A (p.Val32075=) rs752745266
NM_001267550.2(TTN):c.96234C>T (p.Tyr32078=) rs376532382
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001267550.2(TTN):c.96252A>G (p.Thr32084=) rs369626133
NM_001267550.2(TTN):c.9639C>T (p.Ser3213=) rs760666570
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.9674A>G (p.Asn3225Ser) rs202011992
NM_001267550.2(TTN):c.96883G>A (p.Val32295Met) rs199532781
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97294C>T (p.Leu32432=) rs72648267
NM_001267550.2(TTN):c.97331G>C (p.Arg32444Pro) rs184922462
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97436G>A (p.Arg32479His) rs369845358
NM_001267550.2(TTN):c.9749T>G (p.Val3250Gly) rs55634230
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97642C>T (p.Arg32548Cys) rs377599569
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.97760G>C (p.Arg32587Pro) rs55704830
NM_001267550.2(TTN):c.97859C>T (p.Ala32620Val) rs397517772
NM_001267550.2(TTN):c.97947G>C (p.Lys32649Asn) rs773776767
NM_001267550.2(TTN):c.98022C>T (p.Arg32674=) rs372825562
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.9827A>G (p.Glu3276Gly) rs377049518
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98431C>T (p.Arg32811Cys) rs371807358
NM_001267550.2(TTN):c.98500G>A (p.Glu32834Lys) rs199761901
NM_001267550.2(TTN):c.98556T>C (p.Gly32852=) rs373853269
NM_001267550.2(TTN):c.9857A>G (p.Lys3286Arg) rs200052398
NM_001267550.2(TTN):c.98606G>A (p.Arg32869His) rs587780495
NM_001267550.2(TTN):c.98641C>T (p.Pro32881Ser) rs367979582
NM_001267550.2(TTN):c.98685T>C (p.Asn32895=) rs752093604
NM_001267550.2(TTN):c.98716G>A (p.Val32906Ile) rs182683829
NM_001267550.2(TTN):c.98721C>T (p.Leu32907=) rs375361462
NM_001267550.2(TTN):c.98726T>C (p.Val32909Ala) rs368877793
NM_001267550.2(TTN):c.98826C>G (p.Asp32942Glu) rs190967471
NM_001267550.2(TTN):c.9884C>T (p.Thr3295Met) rs191708454
NM_001267550.2(TTN):c.98866A>G (p.Met32956Val) rs727503538
NM_001267550.2(TTN):c.98893G>C (p.Asp32965His) rs186405108
NM_001267550.2(TTN):c.99102G>C (p.Trp33034Cys) rs397517778
NM_001267550.2(TTN):c.99162G>A (p.Lys33054=) rs368686031
NM_001267550.2(TTN):c.99340T>C (p.Leu33114=) rs371656672
NM_001267550.2(TTN):c.99415A>G (p.Lys33139Glu) rs779723670
NM_001267550.2(TTN):c.9955G>A (p.Val3319Ile) rs375533809
NM_001267550.2(TTN):c.99560A>C (p.Lys33187Thr) rs560306385
NM_001267550.2(TTN):c.99567C>T (p.Leu33189=) rs745708104
NM_001267550.2(TTN):c.99581C>T (p.Pro33194Leu) rs140025425
NM_001267550.2(TTN):c.99668G>A (p.Arg33223His) rs369081242
NM_001267550.2(TTN):c.99840T>C (p.Asp33280=) rs375178211
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001267550.2(TTN):c.99946G>A (p.Ala33316Thr) rs374295768
NM_001267550.2(TTN):c.99990A>G (p.Lys33330=) rs749702063
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_001267550.2(TTN):c.99996G>A (p.Glu33332=) rs754693509
NM_133378.4(TTN):c.52301A>G rs199512049
NM_133378.4(TTN):c.80602+8T>C rs369690199
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.