ClinVar Miner

Variants with conflicting interpretations "benign" and "pathogenic"

Submission 1 (benign) minimum review status: Submission 1 (benign) method:
Submission 2 (pathogenic) minimum review status: Submission 2 (pathogenic) method:
ClinVar version:

Total variants with conflicting interpretations: 670

HGVS dbSNP
GRCh37/hg19 15q11.2(chr15:22750305-23109890)x1
GRCh37/hg19 15q11.2(chr15:22750305-23226254)x3
GRCh38/hg38 7q11.1-11.21(chr7:61006478-62410831)x1
GRCh38/hg38 7q11.1-11.21(chr7:61006478-62410831)x3
GRCh38/hg38 Xp22.31(chrX:6570680-8129470)x1
NCBI36/hg18 16p11.2-q24.3(chr16:31893599-33705883)x3
NC_000008.11:g.11573132C>T rs61199332
NC_012920.1:m.11984T>C rs200911567
NC_012920.1:m.7444G>A rs199474822
NM_000017.4(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.4(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000022.2(ADA):c.22G>A (p.Asp8Asn) rs73598374
NM_000031.6(ALAD):c.177G>C (p.Lys59Asn) rs1800435
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000041.4(APOE):c.487C>T (p.Arg163Cys) rs769455
NM_000044.6(AR):c.1174C>T (p.Pro392Ser) rs201934623
NM_000044.6(AR):c.2659A>G (p.Met887Val) rs755226547
NM_000050.4(ASS1):c.323G>T rs35269064
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000063.6(C2):c.954G>C (p.Glu318Asp) rs9332739
NM_000067.3(CA2):c.754A>G (p.Asn252Asp) rs2228063
NM_000070.3(CAPN3):c.1746-20C>G rs201892814
NM_000070.3(CAPN3):c.2332G>A (p.Asp778Asn) rs115311625
NM_000078.3(CETP):c.1376A>G (p.Asp459Gly) rs2303790
NM_000083.3(CLCN1):c.501C>G (p.Phe167Leu) rs149729531
NM_000093.5(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000094.3(COL7A1):c.4373C>T (p.Pro1458Leu) rs79378857
NM_000096.4(CP):c.1652C>T (p.Thr551Ile) rs61733458
NM_000098.3(CPT2):c.1342T>C (p.Phe448Leu) rs74315297
NM_000099.4(CST3):c.73G>A (p.Ala25Thr) rs1064039
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000130.5(F5):c.1601= (p.Arg534=) rs6025
NM_000135.4(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000137.3(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000138.4(FBN1):c.7499G>A (p.Cys2500Tyr) rs794728160
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000153.4(GALC):c.1901T>C (p.Leu634Ser) rs138577661
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.4(GALT):c.820+13A>G rs111033768
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000160.5(GCGR):c.118G>A (p.Gly40Ser) rs1801483
NM_000163.5(GHR):c.484G>A (p.Val162Ile) rs6413484
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000165.5(GJA1):c.1127G>A (p.Arg376Gln) rs104893965
NM_000166.6(GJB1):c.688C>T (p.Arg230Cys) rs587781246
NM_000166.6(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000171.4(GLRA1):c.1108G>A (p.Gly370Ser) rs116474260
NM_000176.3(NR3C1):c.66G>A (p.Glu22=) rs6189
NM_000178.4(GSS):c.941C>T (p.Pro314Leu) rs75863437
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000180.4(GUCY2D):c.154G>T (p.Ala52Ser) rs61749665
NM_000185.4(SERPIND1):c.623G>A (p.Arg208His) rs5907
NM_000193.4(SHH):c.869G>A (p.Gly290Asp) rs104894047
NM_000202.8(IDS):c.641C>T (p.Thr214Met) rs61736892
NM_000203.5(IDUA):c.1081G>A (p.Ala361Thr) rs6831280
NM_000211.5(ITGB2):c.1756C>T (p.Arg586Trp) rs5030672
NM_000211.5(ITGB2):c.329-6C>T rs9983887
NM_000218.2(KCNQ1):c.160_168dup (p.Ile54_Pro56dup) rs397515877
NM_000218.3(KCNQ1):c.1552C>T (p.Arg518Ter) rs17215500
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000220.5(KCNJ1):c.1070T>C (p.Met357Thr) rs59172778
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.2(MYOC):c.136C>T (p.Arg46Ter) rs74315337
NM_000264.5(PTCH1):c.1177G>A (p.Ala393Thr) rs199476091
NM_000264.5(PTCH1):c.2183C>T (p.Thr728Met) rs115556836
NM_000264.5(PTCH1):c.2479A>G (p.Ser827Gly) rs199476092
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.3(OCA2):c.79G>A (p.Gly27Arg) rs61738394
NM_000282.4(PCCA):c.1676G>T (p.Trp559Leu) rs118169528
NM_000283.3(PDE6B):c.2326G>A (p.Asp776Asn) rs141563823
NM_000284.4(PDHA1):c.844A>C (p.Met282Leu) rs2229137
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000290.4(PGAM2):c.290G>A (p.Gly97Asp) rs77938727
NM_000301.3(PLG):c.1858G>A (p.Ala620Thr) rs121918027
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000325.6(PITX2):c.*454C>T rs6533526
NM_000334.4(SCN4A):c.3386G>A (p.Arg1129Gln) rs527236149
NM_000334.4(SCN4A):c.737C>T (p.Ser246Leu) rs80338951
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.5(SCN5A):c.3908C>T (p.Thr1303Met) rs199473603
NM_000335.5(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.5(SCN5A):c.5708C>T (p.Ser1903Leu) rs150264233
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000336.3(SCNN1B):c.109G>A (p.Gly37Ser) rs137852706
NM_000336.3(SCNN1B):c.245C>G (p.Ser82Cys) rs35731153
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.3(SLC4A1):c.388G>A (p.Gly130Arg) rs121912749
NM_000342.4(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.4(SLC4A1):c.1937G>A (p.Arg646Gln) rs121912757
NM_000342.4(SLC4A1):c.2561C>T (p.Pro854Leu) rs2285644
NM_000344.3(SMN1):c.840C>T (p.Phe280=) rs1164325688
NM_000348.4(SRD5A2):c.145G>A (p.Ala49Thr) rs9282858
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.3602T>G (p.Leu1201Arg) rs61750126
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.6320G>A (p.Arg2107His) rs62642564
NM_000350.3(ABCA4):c.6730-19G>A rs375179475
NM_000354.5(SERPINA7):c.631G>A (p.Ala211Thr) rs2234036
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000359.3(TGM1):c.1552G>A (p.Val518Met) rs35312232
NM_000361.2(THBD):c.-151G>T rs16984852
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000369.2(TSHR):c.1349G>A (p.Arg450His) rs189261858
NM_000369.2(TSHR):c.1637G>A (p.Trp546Ter) rs121908866
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000375.3(UROS):c.-219C>A rs4385801
NM_000384.3(APOB):c.10780T>C (p.Trp3594Arg) rs61744288
NM_000384.3(APOB):c.3337G>C (p.Asp1113His) rs12713844
NM_000384.3(APOB):c.35del (p.Leu12fs) rs1060499841
NM_000388.4(CASR):c.2915C>T (p.Thr972Met) rs200620134
NM_000400.3(ERCC2):c.1381C>G (p.Leu461Val) rs121913016
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000420.3(KEL):c.1790T>C (p.Leu597Pro) rs8176038
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000433.3(NCF2):c.1183C>T (p.Arg395Trp) rs13306575
NM_000435.3(NOTCH3):c.3058G>C (p.Ala1020Pro) rs35769976
NM_000435.3(NOTCH3):c.3691C>T (p.Arg1231Cys) rs201680145
NM_000443.4(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636
NM_000443.4(ABCB4):c.523A>G (p.Thr175Ala) rs58238559
NM_000447.3(PSEN2):c.389C>T (p.Ser130Leu) rs63750197
NM_000451.3(SHOX):c.-507G>C rs111549748
NM_000451.3(SHOX):c.-512C>A rs113313554
NM_000483.5(APOC2):c.122A>C (p.Lys41Thr) rs120074114
NM_000483.5(APOC2):c.229A>C (p.Lys77Gln) rs5126
NM_000487.6(ARSA):c.*96A>G rs6151429
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.5(ATRX):c.5579A>G (p.Asn1860Ser) rs45439799
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.2421A>G (p.Ile807Met) rs144055758
NM_000492.3(CFTR):c.2620-26A>G rs201716473
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.4(CFTR):c.1052C>G (p.Thr351Ser) rs1800086
NM_000492.4(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.4(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.4(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.4(CFTR):c.220C>T (p.Arg74Trp) rs115545701
NM_000492.4(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.4(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000500.9(CYP21A2):c.188A>T (p.His63Leu) rs9378252
NM_000503.6(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000506.3(F2):c.598G>A (p.Glu200Lys) rs62623459
NM_000506.5(F2):c.*97G>A rs1799963
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.5(HBB):c.*132+101G>C rs12788013
NM_000518.5(HBB):c.316-70C>G rs193922560
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000520.6(HEXA):c.672+30T>G rs117160567
NM_000520.6(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000521.3(HEXB):c.185C>T (p.Ser62Leu) rs820878
NM_000521.4(HEXB):c.445+1G>C rs761197472
NM_000527.5(LDLR):c.1024G>A (p.Asp342Asn) rs139361635
NM_000527.5(LDLR):c.1359-31_1359-23delinsCGGCT rs879254876
NM_000527.5(LDLR):c.1510A>G (p.Lys504Glu) rs730882103
NM_000527.5(LDLR):c.1867A>G (p.Ile623Val) rs555292896
NM_000527.5(LDLR):c.1966C>A (p.His656Asn) rs762815611
NM_000527.5(LDLR):c.2101G>A (p.Gly701Ser) rs368838866
NM_000527.5(LDLR):c.2282C>T (p.Thr761Met) rs138477254
NM_000527.5(LDLR):c.2389+5G>A rs879255191
NM_000527.5(LDLR):c.313+2T>C rs793888517
NM_000527.5(LDLR):c.58G>A (p.Gly20Arg) rs147509697
NM_000527.5(LDLR):c.757C>T (p.Arg253Trp) rs150673992
NM_000527.5(LDLR):c.806G>A (p.Gly269Asp) rs143992984
NM_000527.5(LDLR):c.828C>A (p.Cys276Ter) rs146651743
NM_000527.5(LDLR):c.829G>A (p.Glu277Lys) rs148698650
NM_000527.5(LDLR):c.941-12G>A rs879254734
NM_000527.5(LDLR):c.970G>A (p.Gly324Ser) rs72658860
NM_000531.6(OTC):c.298+5G>C rs72554348
NM_000536.4(RAG2):c.644C>T (p.Thr215Ile) rs35691292
NM_000540.2(RYR1):c.11763C>A (p.Tyr3921Ter) rs377178986
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000545.6(HNF1A):c.1720G>A (p.Gly574Ser) rs1169305
NM_000551.4(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000579.3(CCR5):c.-301+246A>G rs1799987
NM_000603.5(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000616.5(CD4):c.793C>T (p.Arg265Trp) rs28919570
NM_000666.3(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000702.4(ATP1A2):c.193C>T (p.Arg65Trp) rs121918619
NM_000719.7(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000784.4(CYP27A1):c.1151C>T (p.Pro384Leu) rs41272687
NM_000789.3(ACE):c.2306-117_2306-116insAF118569.1:g.14094_14382
NM_000883.4(IMPDH1):c.568C>T (p.Arg190Trp) rs121912553
NM_000891.2(KCNJ2):c.277G>A (p.Val93Ile) rs147750704
NM_000892.5(KLKB1):c.428G>A (p.Ser143Asn) rs3733402
NM_000941.3(POR):c.15A>G (p.Gly5=) rs10262966
NM_000949.7(PRLR):c.508A>C (p.Ile170Leu) rs72478580
NM_001001547.3(CD36):c.975T>G (p.Tyr325Ter) rs3211938
NM_001002294.3(FMO3):c.769G>A (p.Val257Met) rs1736557
NM_001003811.2(TEX11):c.450C>T (p.Ala150=) rs147088100
NM_001008212.2(OPTN):c.1634G>A (p.Arg545Gln) rs75654767
NM_001008212.2(OPTN):c.293T>A (p.Met98Lys) rs11258194
NM_001008216.2(GALE):c.770A>G (p.Lys257Arg) rs28940884
NM_001009944.3(PKD1):c.971G>T (p.Arg324Leu) rs199476099
NM_001012515.3(FECH):c.68-23C>T rs2269219
NM_001023570.4(IQCB1):c.1178T>A (p.Ile393Asn) rs1141528
NM_001032386.2(SUOX):c.228G>T (p.Arg76Ser) rs202085145
NM_001038.6(SCNN1A):c.1477T>C (p.Trp493Arg) rs5742912
NM_001039.4(SCNN1G):c.547G>A (p.Gly183Ser) rs5736
NM_001039.4(SCNN1G):c.589G>A (p.Glu197Lys) rs5738
NM_001040108.1(MLH3):c.2221G>T (p.Val741Phe) rs28756990
NM_001040142.2(SCN2A):c.788C>T (p.Ala263Val) rs387906686
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001063.4(TF):c.956A>G (p.His319Arg) rs41295774
NM_001065.4(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001065.4(TNFRSF1A):c.935G>A (p.Arg312Lys) rs200900510
NM_001069.3(TUBB2A):c.743C>T (p.Ala248Val) rs2808001
NM_001072.4(UGT1A6):c.1088C>T (p.Pro363Leu) rs34946978
NM_001072.4(UGT1A6):c.862-10021T>G rs4124874
NM_001072.4(UGT1A6):c.862-6061C>A rs35350960
NM_001072.4(UGT1A6):c.862-6606C>T rs34526305
NM_001077182.3(FSCN2):c.72del (p.Thr25fs) rs376633374
NM_001077415.3(CRELD1):c.320G>A (p.Arg107His) rs28941780
NM_001079668.3(NKX2-1):c.464-2A>T rs587776708
NM_001080413.3(NOBOX):c.271G>T (p.Gly91Trp) rs77587352
NM_001080413.3(NOBOX):c.349C>T (p.Arg117Trp) rs7800847
NM_001083116.3(PRF1):c.11G>A (p.Arg4His) rs35418374
NM_001083116.3(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001098.3(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001099274.3(TINF2):c.706C>T (p.Pro236Ser) rs199422321
NM_001099274.3(TINF2):c.734C>A (p.Ser245Tyr) rs142777869
NM_001101677.2(SOHLH1):c.346-1G>A rs140132974
NM_001104.4(ACTN3):c.1729C>T (p.Arg577Ter) rs1815739
NM_001106.4(ACVR2B):c.119G>A (p.Arg40His) rs121434437
NM_001110556.2(FLNA):c.3872C>T (p.Pro1291Leu) rs137853319
NM_001110792.2(MECP2):c.1165_1234del (p.Lys389fs) rs1557135353
NM_001110792.2(MECP2):c.1169C>T (p.Ala390Val) rs201314910
NM_001110792.2(MECP2):c.1318G>A (p.Gly440Ser) rs61753971
NM_001110792.2(MECP2):c.638C>T (p.Ala213Val) rs61748381
NM_001114636.1(FANCL):c.1111_1114dup (p.Thr372fs) rs759217526
NM_001114753.3(ENG):c.1633G>A (p.Gly545Ser) rs142896669
NM_001122764.3(PPOX):c.767C>G (p.Pro256Arg) rs12735723
NM_001126112.2(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.2890C>T (p.Arg964Cys) rs201477273
NM_001130438.3(SPTAN1):c.1303T>G (p.Ser435Ala) rs144787939
NM_001130438.3(SPTAN1):c.3720-5T>G rs200543425
NM_001130987.2(DYSF):c.3946A>G (p.Ile1316Val) rs121908954
NM_001130987.2(DYSF):c.4993G>A (p.Val1665Ile) rs147056383
NM_001134407.3(GRIN2A):c.547T>A (p.Phe183Ile) rs587780353
NM_001142446.2(ANK1):c.127-39509T>C rs77173848
NM_001142446.2(ANK1):c.127-39554G>A rs183894680
NM_001142800.2(EYS):c.3329C>G (p.Thr1110Ser) rs143327210
NM_001142800.2(EYS):c.9209T>C (p.Ile3070Thr) rs183589498
NM_001145809.2(MYH14):c.1150G>T (p.Gly384Cys) rs119103280
NM_001148.6(ANK2):c.11218C>A (p.Leu3740Ile) rs35530544
NM_001160301.1(DPYD):c.85T>C (p.Cys29Arg) rs1801265
NM_001165963.4(SCN1A):c.1625G>A (p.Arg542Gln) rs121918817
NM_001165963.4(SCN1A):c.3521C>G (p.Thr1174Ser) rs121918799
NM_001167.4(XIAP):c.1045_1047GAG[1] (p.Glu350del) rs199683465
NM_001168338.1(PLG):c.112A>G (p.Lys38Glu) rs73015965
NM_001171.5(ABCC6):c.*38G>A rs59461468
NM_001171.5(ABCC6):c.1077A>G (p.Ser359=) rs72664283
NM_001171.5(ABCC6):c.2904G>A (p.Leu968=) rs72664287
NM_001171.5(ABCC6):c.3507-3C>T rs41278172
NM_001171.5(ABCC6):c.3803G>A (p.Arg1268Gln) rs2238472
NM_001171.5(ABCC6):c.3871G>A (p.Ala1291Thr) rs58694313
NM_001171.5(ABCC6):c.3978C>T (p.Asp1326=) rs57499803
NM_001171.5(ABCC6):c.4069C>T (p.Arg1357Trp) rs63750428
NM_001171.5(ABCC6):c.4254G>A (p.Arg1418=) rs58668703
NM_001171.5(ABCC6):c.487G>A (p.Asp163Asn) rs192110266
NM_001171.5(ABCC6):c.955A>G (p.Ile319Val) rs72657699
NM_001184880.2(PCDH19):c.3319C>G (p.Arg1107Gly) rs191333060
NM_001190919.1(THRA):c.54-1G>A rs199530759
NM_001194998.2(CEP152):c.2000A>G (p.Lys667Arg) rs200879436
NM_001194998.2(CEP152):c.4378_4379del (p.Val1460fs) rs141600901
NM_001195129.2(PRSS56):c.1795C>G (p.Pro599Ala) rs61744404
NM_001198800.3(ASCC1):c.869A>G (p.Asn290Ser) rs146370051
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520
NM_001202.6(BMP4):c.272C>G (p.Ser91Cys) rs121912767
NM_001202.6(BMP4):c.860G>A (p.Arg287His) rs121912768
NM_001211.5(BUB1B):c.119C>T (p.Thr40Met) rs56079734
NM_001211.5(BUB1B):c.1649G>A (p.Arg550Gln) rs28989187
NM_001242897.2(DEPDC5):c.1870+3481C>T rs181347577
NM_001242897.2(DEPDC5):c.1901C>T (p.Ser634Phe) rs16989535
NM_001243766.1(POMGNT1):c.1666G>A (p.Asp556Asn) rs74374973
NM_001256047.1(C19orf12):c.391A>G (p.Lys131Glu) rs146170087
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001271.4(CHD2):c.4058C>T (p.Pro1353Leu) rs755088564
NM_001273.5(CHD4):c.4822G>A (p.Val1608Ile) rs201992075
NM_001282225.2(ADA2):c.1045G>A (p.Val349Ile) rs74317375
NM_001289808.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929
NM_001308.3(CPN1):c.533G>A (p.Gly178Asp) rs61751507
NM_001330260.2(SCN8A):c.1588C>T (p.Arg530Trp) rs761336234
NM_001360016.2(G6PD):c.1311= (p.Tyr437=) rs2230037
NM_001360016.2(G6PD):c.486-60C>G rs2515904
NM_001363.5(DKC1):c.838A>C (p.Ser280Arg) rs146700772
NM_001365536.1(SCN9A):c.1828C>A (p.Pro610Thr) rs41268673
NM_001365536.1(SCN9A):c.1997A>G (p.Lys666Arg) rs121908919
NM_001365536.1(SCN9A):c.2248A>G (p.Ile750Val) rs182650126
NM_001365536.1(SCN9A):c.3002A>G (p.Tyr1001Cys) rs199692186
NM_001365536.1(SCN9A):c.554G>A (p.Arg185His) rs73969684
NM_001370658.1(BTD):c.152T>C (p.Leu51Pro) rs397514333
NM_001370658.1(BTD):c.820A>G (p.Ile274Val) rs35976361
NM_001371279.1(REEP1):c.837G>T (p.Ser279=) rs377637314
NM_001374353.1(GLI2):c.4507G>A (p.Asp1503Asn) rs114814747
NM_001374353.1(GLI2):c.4612T>C (p.Ser1538Pro) rs144372453
NM_001377.3(DYNC2H1):c.3097-4A>G rs368802969
NM_001378373.1(MBL2):c.170G>A (p.Gly57Glu) rs1800451
NM_001399.5(EDA):c.1001G>A (p.Arg334His) rs142948132
NM_001399.5(EDA):c.206G>T (p.Arg69Leu) rs132630309
NM_001429.4(EP300):c.6798_6800del (p.Gln2268del) rs533875300
NM_001453.3(FOXC1):c.-244C>T rs185790394
NM_001453.3(FOXC1):c.889C>T (p.Pro297Ser) rs79691946
NM_001492.6(GDF1):c.1091T>C (p.Met364Thr) rs374016704
NM_001492.6(GDF1):c.485G>A (p.Gly162Asp) rs121434424
NM_001710.6(CFB):c.26T>A (p.Leu9His) rs4151667
NM_001715.3(BLK):c.*338T>G rs1042695
NM_001715.3(BLK):c.211G>A (p.Ala71Thr) rs55758736
NM_001715.3(BLK):c.713G>A (p.Arg238Gln) rs141865425
NM_001876.4(CPT1A):c.1436C>T (p.Pro479Leu) rs80356779
NM_001876.4(CPT1A):c.823G>A (p.Ala275Thr) rs2229738
NM_001918.4(DBT):c.1150G>A (p.Gly384Ser) rs12021720
NM_001927.4(DES):c.1353C>G (p.Ile451Met) rs121913002
NM_001927.4(DES):c.638C>T (p.Ala213Val) rs41272699
NM_001953.4(TYMP):c.929-6_929-3del rs201685922
NM_001983.4(ERCC1):c.*863T>C rs3212989
NM_002047.4(GARS1):c.1904C>T (p.Ser635Leu) rs201358272
NM_002052.5(GATA4):c.*1256A>T rs12458
NM_002052.5(GATA4):c.*852G>A rs804290
NM_002052.5(GATA4):c.1037C>T (p.Ala346Val) rs115372595
NM_002052.5(GATA4):c.1146+129C>T rs116052854
NM_002052.5(GATA4):c.1146+177C>T rs12156163
NM_002052.5(GATA4):c.1147-107A>G rs745379
NM_002052.5(GATA4):c.1220C>A (p.Pro407Gln) rs115099192
NM_002052.5(GATA4):c.1273G>A (p.Asp425Asn) rs56208331
NM_002052.5(GATA4):c.617-116T>C rs3735819
NM_002052.5(GATA4):c.617-64G>C rs10503425
NM_002052.5(GATA4):c.997+200G>A rs3729851
NM_002111.8(HTT):c.3785C>T (p.Thr1262Met) rs34315806
NM_002150.3(HPD):c.1005C>G (p.Ile335Met) rs137852868
NM_002150.3(HPD):c.97= (p.Thr33=) rs1154510
NM_002283.4(KRT85):c.233G>A (p.Arg78His) rs61630004
NM_002335.4(LRP5):c.1999G>A (p.Val667Met) rs4988321
NM_002386.3(MC1R):c.451C>T (p.Arg151Cys) rs1805007
NM_002386.3(MC1R):c.464T>C (p.Ile155Thr) rs1110400
NM_002386.3(MC1R):c.880G>C (p.Asp294His) rs1805009
NM_002470.4(MYH3):c.-9+1G>A rs557849165
NM_002485.5(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.5(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002529.3(NTRK1):c.1810C>T (p.His604Tyr) rs6336
NM_002529.3(NTRK1):c.1838G>T (p.Gly613Val) rs6339
NM_002661.5(PLCG2):c.2542C>T (p.Leu848Phe) rs114618894
NM_002739.5(PRKCG):c.2075T>G (p.Val692Gly) rs78437096
NM_002769.5(PRSS1):c.161A>G (p.Asn54Ser) rs144422014
NM_002769.5(PRSS1):c.623G>C (p.Gly208Ala) rs189270875
NM_002769.5(PRSS1):c.86A>C (p.Asn29Thr) rs111033566
NM_002769.5(PRSS1):c.86A>T (p.Asn29Ile) rs111033566
NM_002875.5(RAD51):c.449G>A (p.Arg150Gln) rs121917739
NM_003000.3(SDHB):c.32G>A (p.Arg11His) rs111430410
NM_003052.5(SLC34A1):c.272_292del (p.Val91_Ala97del) rs876661296
NM_003060.4(SLC22A5):c.1463G>A (p.Arg488His) rs28383481
NM_003122.4(SPINK1):c.163C>T (p.Pro55Ser) rs111966833
NM_003126.4(SPTA1):c.2373C>A (p.Asp791Glu) rs7418956
NM_003126.4(SPTA1):c.2909C>A (p.Ala970Asp) rs35948326
NM_003242.6(TGFBR2):c.944C>T (p.Thr315Met) rs34833812
NM_003244.3(TGIF1):c.320A>T (p.Gln107Leu) rs28939693
NM_003356.4(UCP3):c.304G>A (p.Val102Ile) rs2229707
NM_003356.4(UCP3):c.824+1G>A
NM_003413.4(ZIC3):c.49G>T (p.Gly17Cys) rs147232392
NM_003482.3(KMT2D):c.4163G>T (p.Arg1388Leu) rs202217665
NM_003597.5(KLF11):c.659C>T (p.Thr220Met) rs34336420
NM_003688.3(CASK):c.2506-2A>T rs398122845
NM_003688.3(CASK):c.82C>T (p.Arg28Ter) rs587783370
NM_003900.5(SQSTM1):c.1175C>T (p.Pro392Leu) rs104893941
NM_003977.4(AIP):c.911G>A (p.Arg304Gln) rs104894190
NM_003978.5(PSTPIP1):c.203C>T (p.Thr68Met) rs201872851
NM_004004.6(GJB2):c.-22-2A>C rs201895089
NM_004004.6(GJB2):c.101T>C (p.Met34Thr) rs35887622
NM_004004.6(GJB2):c.109G>A (p.Val37Ile) rs72474224
NM_004004.6(GJB2):c.269T>C (p.Leu90Pro) rs80338945
NM_004004.6(GJB2):c.416G>A (p.Ser139Asn) rs76434661
NM_004006.2(DMD):c.7555G>A (p.Asp2519Asn) rs771877780
NM_004064.4(CDKN1B):c.-80C>T rs551236750
NM_004168.4(SDHA):c.1523C>T (p.Thr508Ile) rs151266052
NM_004252.5(SLC9A3R1):c.328C>G (p.Leu110Val) rs35910969
NM_004360.5(CDH1):c.1018A>G (p.Thr340Ala) rs116093741
NM_004360.5(CDH1):c.1849G>A (p.Ala617Thr) rs33935154
NM_004360.5(CDH1):c.2494G>A (p.Val832Met) rs35572355
NM_004369.3(COL6A3):c.9128G>A (p.Arg3043His) rs552651651
NM_004369.3(COL6A3):c.9245C>G (p.Pro3082Arg) rs182976977
NM_004380.3(CREBBP):c.2728A>G (p.Thr910Ala) rs143247685
NM_004387.4(NKX2-5):c.355G>T (p.Ala119Ser) rs137852684
NM_004387.4(NKX2-5):c.73C>T (p.Arg25Cys) rs28936670
NM_004393.6(DAG1):c.331G>A (p.Asp111Asn) rs117209107
NM_004415.4(DSP):c.88G>A (p.Val30Met) rs121912998
NM_004442.7(EPHB2):c.835G>T (p.Ala279Ser) rs35882952
NM_004463.3(FGD1):c.935C>T (p.Pro312Leu) rs28935498
NM_004519.4(KCNQ3):c.1720C>T (p.Pro574Ser) rs74582884
NM_004519.4(KCNQ3):c.2462A>G (p.Asn821Ser) rs118192254
NM_004562.3(PRKN):c.245C>A (p.Ala82Glu) rs55774500
NM_004628.5(XPC):c.1001C>A (p.Pro334His) rs74737358
NM_004667.5(HERC2):c.12801T>A (p.Asp4267Glu) rs373175587
NM_004895.4(NLRP3):c.598G>A (p.Val200Met) rs121908147
NM_004937.3(CTNS):c.124G>A (p.Val42Ile) rs35086888
NM_004999.4(MYO6):c.647A>T (p.Glu216Val) rs121912559
NM_005045.4(RELN):c.10093G>A (p.Val3365Ile) rs115035120
NM_005045.4(RELN):c.2932A>G (p.Thr978Ala) rs3025962
NM_005045.4(RELN):c.3477C>A (p.Asn1159Lys) rs114684479
NM_005045.4(RELN):c.5284G>A (p.Val1762Ile) rs79499902
NM_005120.3(MED12):c.5922G>T (p.Gln1974His) rs879255528
NM_005210.4(CRYGB):c.10-38del rs3214759
NM_005257.5(GATA6):c.551G>A (p.Ser184Asn) rs387906816
NM_005259.3(MSTN):c.458A>G (p.Lys153Arg) rs1805086
NM_005357.4(LIPE):c.3203_3221del (p.Val1068fs) rs587777699
NM_005413.4(SIX3):c.109G>T (p.Gly37Cys) rs199823175
NM_005448.2(BMP15):c.538G>A (p.Ala180Thr) rs104894767
NM_005502.4(ABCA1):c.3865G>A (p.Asp1289Asn) rs137854500
NM_005555.4(KRT6B):c.1495G>A (p.Gly499Ser)
NM_005603.6(ATP8B1):c.1982T>C (p.Ile661Thr) rs121909100
NM_005609.4(PYGM):c.645G>A (p.Lys215=) rs116315896
NM_005710.2(PQBP1):c.334_354del (p.Gly113_Arg119del) rs606231198
NM_005726.6(TSFM):c.856C>T (p.Gln286Ter) rs201754030
NM_005912.3(MC4R):c.806T>A (p.Ile269Asn) rs79783591
NM_005957.5(MTHFR):c.665C>T (p.Ala222Val) rs1801133
NM_006005.3(WFS1):c.461-9A>G rs10010131
NM_006005.3(WFS1):c.713-1075C>G rs6446482
NM_006158.5(NEFL):c.1573_1575GAG[2] (p.Glu527del) rs3832558
NM_006172.4(NPPA):c.190A>C (p.Ser64Arg) rs61757261
NM_006269.2(RP1):c.1118C>T (p.Thr373Ile) rs77775126
NM_006329.3(FBLN5):c.268G>A (p.Gly90Ser) rs144288844
NM_006446.5(SLCO1B1):c.521T>C (p.Val174Ala) rs4149056
NM_006502.2(POLH):c.1603A>G (p.Lys535Glu) rs56307355
NM_006610.4(MASP2):c.359A>G (p.Asp120Gly) rs72550870
NM_006950.3(SYN1):c.1699A>G (p.Thr567Ala) rs200533370
NM_007194.4(CHEK2):c.254C>T (p.Pro85Leu) rs17883862
NM_007272.3(CTRC):c.703G>A (p.Val235Ile) rs140993290
NM_007272.3(CTRC):c.760C>T (p.Arg254Trp) rs121909293
NM_007294.4(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.4(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.4(BRCA1):c.594-2A>C rs80358033
NM_007315.3(STAT1):c.796G>A (p.Val266Ile) rs41473544
NM_012082.4(ZFPM2):c.1632G>A (p.Met544Ile) rs187043152
NM_012082.4(ZFPM2):c.1969A>G (p.Ser657Gly) rs28374544
NM_012082.4(ZFPM2):c.2107A>C (p.Met703Leu) rs121908603
NM_012082.4(ZFPM2):c.89A>G (p.Glu30Gly) rs121908601
NM_012415.3(RAD54B):c.1778A>G (p.Asn593Ser) rs114216685
NM_012452.2(TNFRSF13B):c.605G>A (p.Arg202His) rs104894649
NM_013444.3(UBQLN2):c.1573C>T (p.Pro525Ser) rs369947678
NM_014009.4(FOXP3):c.155G>T (p.Gly52Val)
NM_014049.5(ACAD9):c.-44_-41dup rs387906242
NM_014049.5(ACAD9):c.976G>C (p.Ala326Pro) rs115532916
NM_014141.6(CNTNAP2):c.755-5C>T rs369675346
NM_014208.3(DSPP):c.202A>T (p.Arg68Trp) rs36094464
NM_014236.4(GNPAT):c.1556A>G (p.Asp519Gly) rs11558492
NM_014336.5(AIPL1):c.1126C>T (p.Pro376Ser) rs61757484
NM_014336.5(AIPL1):c.905G>T (p.Arg302Leu) rs62637015
NM_014363.6(SACS):c.4076T>C (p.Met1359Thr) rs146451611
NM_014625.3(NPHS2):c.59C>T (p.Pro20Leu) rs74315344
NM_014845.5(FIG4):c.122T>C (p.Ile41Thr) rs121908287
NM_014874.3(MFN2):c.1403G>A (p.Arg468His) rs138382758
NM_014946.3(SPAST):c.131C>T (p.Ser44Leu) rs121908515
NM_015141.4(GPD1L):c.370A>G (p.Ile124Val) rs72552293
NM_015272.5(RPGRIP1L):c.685G>A (p.Ala229Thr) rs61747071
NM_015375.3(DSTYK):c.86G>A (p.Arg29Gln) rs200780796
NM_015488.5(PNKD):c.97G>C (p.Ala33Pro) rs121434513
NM_015627.2(LDLRAP1):c.605C>A (p.Ser202Tyr) rs121908326
NM_015627.2(LDLRAP1):c.653C>T (p.Thr218Ile) rs114583297
NM_016233.2(PADI3):c.856A>G (p.Thr286Ala) rs139426141
NM_016239.4(MYO15A):c.5925G>A (p.Trp1975Ter) rs375290498
NM_016239.4(MYO15A):c.6614C>T (p.Thr2205Ile) rs121908970
NM_016327.3(UPB1):c.254C>A (p.Ala85Glu) rs34035085
NM_016327.3(UPB1):c.917-1G>A rs143493067
NM_016335.6(PRODH):c.1357C>T (p.Arg453Cys) rs3970559
NM_016335.6(PRODH):c.1562= (p.Arg521=) rs450046
NM_016373.4(WWOX):c.754C>G (p.Pro252Ala) rs75559202
NM_016599.5(MYOZ2):c.738A>G (p.Ile246Met) rs140126678
NM_016616.4(NME8):c.271-27C>T rs117149381
NM_016729.3(FOLR1):c.493+2T>C rs144637717
NM_017570.5(OPLAH):c.3265G>A (p.Val1089Ile) rs185836803
NM_017617.5(NOTCH1):c.5965G>A (p.Asp1989Asn) rs587777734
NM_017721.5(CC2D1A):c.1739C>T (p.Thr580Ile) rs202057391
NM_017721.5(CC2D1A):c.2657G>A (p.Arg886His) rs201921029
NM_017882.3(CLN6):c.486+8C>T rs149692285
NM_017890.4(VPS13B):c.8978A>G (p.Asn2993Ser) rs28940272
NM_017986.4(SLC52A1):c.1134+11G>A rs141935493
NM_018127.7(ELAC2):c.1621G>A (p.Ala541Thr) rs5030739
NM_018127.7(ELAC2):c.1865A>T (p.Glu622Val) rs119484087
NM_018127.7(ELAC2):c.650C>T (p.Ser217Leu) rs4792311
NM_018136.5(ASPM):c.9539A>C (p.Gln3180Pro) rs193251130
NM_018451.5(CENPJ):c.2462C>T (p.Thr821Met) rs144938364
NM_018897.3(DNAH7):c.11947C>T (p.Arg3983Trp) rs114621989
NM_019098.4(CNGB3):c.1208G>A rs147876778
NM_020208.4(SLC6A20):c.596C>T (p.Thr199Met) rs17279437
NM_020247.5(COQ8A):c.993C>T (p.Phe331=) rs41303129
NM_020361.5(CPA6):c.809C>T (p.Ala270Val) rs114402678
NM_020366.3(RPGRIP1):c.1639G>T (p.Ala547Ser) rs10151259
NM_020366.3(RPGRIP1):c.3341A>G (p.Asp1114Gly) rs17103671
NM_020632.3(ATP6V0A4):c.1739T>C (p.Met580Thr) rs3807153
NM_020822.3(KCNT1):c.3641G>A (p.Arg1214Gln) rs138282349
NM_020949.3(SLC7A14):c.1391G>T (p.Cys464Phe) rs79668755
NM_020949.3(SLC7A14):c.988G>A (p.Gly330Arg) rs2276717
NM_020975.6(RET):c.1942G>A (p.Val648Ile) rs77711105
NM_020975.6(RET):c.2342A>G (p.Gln781Arg) rs377767416
NM_020975.6(RET):c.2372A>T (p.Tyr791Phe) rs77724903
NM_020975.6(RET):c.341G>A (p.Arg114His) rs76397662
NM_021625.4(TRPV4):c.649G>T (p.Ala217Ser) rs187864727
NM_021870.3(FGG):c.571G>A (p.Gly191Arg) rs6063
NM_022124.6(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.6(CDH23):c.9569C>T (p.Ala3190Val) rs111033536
NM_022367.4(SEMA4A):c.2138G>A (p.Arg713Gln) rs41265017
NM_022437.3(ABCG8):c.55G>C (p.Asp19His) rs11887534
NM_024006.6(VKORC1):c.196G>A (p.Val66Met)
NM_024009.3(GJB3):c.547G>A (p.Glu183Lys) rs74315318
NM_024301.5(FKRP):c.235G>A (p.Val79Met) rs104894683
NM_024312.5(GNPTAB):c.1042A>C (p.Ile348Leu) rs7958709
NM_024649.5(BBS1):c.700G>A (p.Glu234Lys) rs35520756
NM_024728.2(SUGCT):c.895C>T (p.Arg299Trp) rs137852860
NM_024824.5(ZC3H14):c.2204+17_2204+41del rs571303442
NM_024921.4(POF1B):c.986G>A (p.Arg329Gln) rs75398746
NM_025216.3(WNT10A):c.1087A>C (p.Asn363His) rs34972707
NM_025216.3(WNT10A):c.637G>A (p.Gly213Ser) rs147680216
NM_025216.3(WNT10A):c.682T>A (p.Phe228Ile) rs121908120
NM_030582.4(COL18A1):c.4309G>A (p.Asp1437Asn) rs12483377
NM_030751.6(ZEB1):c.233A>C (p.Asn78Thr) rs80194531
NM_030787.4(CFHR5):c.486dup (p.Glu163fs) rs565457964
NM_030964.4(SPRY4):c.910G>A (p.Val304Ile) rs142439525
NM_031220.4(PITPNM3):c.1878G>C (p.Gln626His) rs76024428
NM_031885.4(BBS2):c.209A>G (p.Asn70Ser) rs4784677
NM_032119.4(ADGRV1):c.12269C>A (p.Thr4090Asn) rs199839743
NM_032578.4(MYPN):c.3335C>T (p.Pro1112Leu) rs71534278
NM_032601.4(MCEE):c.427C>T (p.Arg143Cys) rs138436961
NM_033056.4(PCDH15):c.5598_5600AAC[1] (p.Thr1869del) rs113363047
NM_033100.4(CDHR1):c.783G>A (p.Pro261=) rs147346345
NM_033118.4(MYLK2):c.284C>A (p.Ala95Glu) rs121908108
NM_033164.4(FGF8):c.77C>T (p.Pro26Leu) rs137852660
NM_033337.2(CAV3):c.216C>G (p.Cys72Trp) rs116840776
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668
NM_033380.3(COL4A5):c.2692A>G (p.Met898Val) rs104886192
NM_033409.4(SLC52A3):c.1048T>A (p.Leu350Met) rs76947760
NM_033409.4(SLC52A3):c.568-16_568-15insCTGATTGAC rs3833341
NM_033629.6(TREX1):c.-26-1G>A rs749323787
NM_033629.6(TREX1):c.341G>A (p.Arg114His) rs72556554
NM_052845.4(MMAB):c.403G>A (p.Ala135Thr) rs35648932
NM_054035.2(UNC119):c.65G>T (p.Gly22Val) rs199714731
NM_080647.1(TBX1):c.928G>A (p.Gly310Ser) rs41298838
NM_080916.3(DGUOK):c.509A>G (p.Gln170Arg) rs74874677
NM_133433.4(NIPBL):c.5329-15A>G rs587783968
NM_138715.3(MSR1):c.877C>T (p.Arg293Ter) rs41341748
NM_139025.4(ADAMTS13):c.1423C>T (p.Pro475Ser) rs11575933
NM_139025.4(ADAMTS13):c.3541G>A (p.Gly1181Arg) rs192619276
NM_144499.3(GNAT1):c.904C>T (p.Gln302Ter) rs374913800
NM_144573.4(NEXN):c.835C>T (p.Arg279Cys) rs146245480
NM_144588.7(ZFYVE27):c.572G>T (p.Gly191Val) rs35077384
NM_144773.3(PROKR2):c.743G>A (p.Arg248Gln) rs376142095
NM_144966.5(FREM1):c.1493G>A (p.Arg498Gln) rs184394424
NM_144991.3(TSPEAR):c.1915G>A (p.Asp639Asn) rs138480801
NM_144997.7(FLCN):c.1333G>A (p.Ala445Thr) rs41419545
NM_152299.4(NCAPH2):c.*696C>T rs145100473
NM_152419.3(HGSNAT):c.1843G>A (p.Ala615Thr) rs112029032
NM_152467.5(KLHL10):c.647A>C (p.Gln216Pro) rs116420871
NM_152709.5(STOX1):c.1824A>C (p.Glu608Asp) rs10509305
NM_152778.3(MFSD8):c.1006G>C (p.Glu336Gln) rs150418024
NM_153026.3(PRICKLE1):c.370G>A (p.Ala124Thr) rs79087668
NM_153223.3(CEP120):c.2134C>T (p.Leu712Phe) rs114280473
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_172107.4(KCNQ2):c.1118+1G>A rs397507449
NM_172107.4(KCNQ2):c.1632-1G>T rs118192233
NM_172107.4(KCNQ2):c.1657C>T (p.Arg553Trp) rs759584387
NM_172107.4(KCNQ2):c.1689C>T (p.Asp563=) rs35450031
NM_172107.4(KCNQ2):c.2613G>T (p.Arg871Ser) rs587780369
NM_172107.4(KCNQ2):c.910_912TTC[1] (p.Phe305del) rs118192212
NM_172201.1(KCNE2):c.161T>C (p.Met54Thr) rs74315447
NM_173076.3(ABCA12):c.7093G>A (p.Asp2365Asn) rs726070
NM_173170.1(IL36RN):c.115+6T>C rs148755083
NM_173551.5(ANKS6):c.1322A>G (p.Gln441Arg) rs377750405
NM_173689.7(CRB2):c.3746G>A (p.Arg1249Gln) rs147412276
NM_174936.3(PCSK9):c.-861G>A rs2479409
NM_174936.3(PCSK9):c.1327G>A (p.Ala443Thr) rs28362263
NM_174936.3(PCSK9):c.137G>T (p.Arg46Leu) rs11591147
NM_174936.3(PCSK9):c.1405C>T (p.Arg469Trp) rs141502002
NM_174936.3(PCSK9):c.1487G>A (p.Arg496Gln) rs139669564
NM_174936.3(PCSK9):c.1856A>C (p.Gln619Pro) rs28362277
NM_174936.3(PCSK9):c.2037C>A (p.Cys679Ter) rs28362286
NM_174936.3(PCSK9):c.385G>A (p.Asp129Asn) rs778738291
NM_174936.4(PCSK9):c.1274A>G (p.Asn425Ser) rs28362261
NM_175053.4(KRT74):c.821T>C (p.Phe274Ser) rs147962513
NM_181507.2(HPS5):c.3293C>T (p.Thr1098Ile) rs61884288
NM_181776.3(SLC36A2):c.260G>T (p.Gly87Val) rs77010315
NM_181798.1(KCNQ1):c.517G>A (p.Ala173Thr) rs120074187
NM_182925.5(FLT4):c.2860C>T (p.Pro954Ser) rs34255532
NM_194248.3(OTOF):c.4023+1G>A rs186810296
NM_197947.3(CLEC7A):c.714T>G (p.Tyr238Ter) rs16910526
NM_198056.2(SCN5A):c.5455G>A (p.Asp1819Asn) rs137854619
NM_198253.3(TERT):c.1234C>T (p.His412Tyr) rs34094720
NM_198253.3(TERT):c.3184G>A (p.Ala1062Thr) rs35719940
NM_198253.3(TERT):c.604G>A (p.Ala202Thr) rs121918661
NM_198253.3(TERT):c.835G>A (p.Ala279Thr) rs61748181
NM_198525.3(KIF7):c.2981A>G (p.Gln994Arg) rs138410949
NM_198578.4(LRRK2):c.1256C>T (p.Ala419Val) rs34594498
NM_198578.4(LRRK2):c.2264C>T (p.Pro755Leu) rs34410987
NM_198578.4(LRRK2):c.4883G>C (p.Arg1628Pro) rs33949390
NM_198578.4(LRRK2):c.7153G>A (p.Gly2385Arg) rs34778348
NM_199161.5(SAA1):c.269G>A (p.Gly90Asp) rs79681911
NM_201253.3(CRB1):c.2843G>A (p.Cys948Tyr) rs62645748
NM_206933.4(USH2A):c.12575G>A (p.Arg4192His) rs199605265
NM_207034.3(EDN3):c.565dup (p.Thr189fs) rs11570344
NM_207352.4(CYP4V2):c.64C>G (p.Leu22Val) rs1055138
NM_213720.3(CHCHD10):c.100C>T (p.Pro34Ser) rs551521196
NM_213720.3(CHCHD10):c.239C>T (p.Pro80Leu) rs775332895
NR_001566.1(TERC):n.228G>A rs141686314
NR_001566.1(TERC):n.58G>A rs113487931
Single allele
UGT1A1*28 rs3064744
UGT1A1*6 rs4148323
m.10044A>G rs41362547
m.10237T>C rs1556423787
m.11084A>G rs199476113
m.11253T>C rs200145866
m.11696G>A rs200873900
m.12192G>A rs3134560
m.12297T>C rs121434464
m.12338T>C rs201863060
m.12811T>C rs199974018
m.13637A>G rs200855215
m.13708G>A rs28359178
m.14325T>C rs397515505
m.14831G>A rs199795644
m.15257G>A rs41518645
m.15812G>A rs200336777
m.3290T>C rs199474665
m.3308T>C rs28358582
m.3388C>A rs387906730
m.3394T>C rs41460449
m.3397A>G rs199476120
m.3796A>G rs28357970
m.4025C>T rs397515509
m.4136A>G rs199476121
m.4216T>C rs1599988
m.4295A>G rs121434467
m.4317A>G rs121434465
m.4336T>C rs41456348
m.4640C>A rs387906426
m.5814T>C rs200077222
m.5843A>G rs118203894
m.6480G>A rs199476128
m.6489C>A rs28461189
m.8296A>G rs118192102
m.9101T>C rs199476134
m.9438G>A rs267606611
m.9804G>A rs200613617

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.