ClinVar Miner

Variants with conflicting interpretations "likely pathogenic" and "risk factor"

Submission 1 (likely pathogenic) minimum review status: Submission 1 (likely pathogenic) method:
Submission 2 (risk factor) minimum review status: Submission 2 (risk factor) method:
ClinVar version:

Total variants with conflicting interpretations: 48

HGVS dbSNP gnomAD frequency
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358 0.16059
NM_016335.6(PRODH):c.1292G>A (p.Arg431His) rs2904552 0.06735
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly) rs1799807 0.01259
NM_001379610.1(SPINK1):c.101A>G (p.Asn34Ser) rs17107315 0.00797
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961 0.00434
NM_012452.3(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412 0.00403
NM_032782.5(HAVCR2):c.291A>G (p.Ile97Met) rs35960726 0.00270
NM_000350.3(ABCA4):c.5882G>A (p.Gly1961Glu) rs1800553 0.00269
NM_000552.5(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386 0.00237
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111 0.00208
NM_000157.4(GBA1):c.1226A>G (p.Asn409Ser) rs76763715 0.00191
NM_001354604.2(MITF):c.1273G>A (p.Glu425Lys) rs149617956 0.00160
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155 0.00116
NM_004972.4(JAK2):c.1849G>T (p.Val617Phe) rs77375493 0.00036
NM_001982.4(ERBB3):c.4009G>A (p.Ala1337Thr) rs755855285 0.00014
NM_014625.4(NPHS2):c.868G>A (p.Val290Met) rs200482683 0.00011
NM_023110.3(FGFR1):c.1409G>T (p.Arg470Leu) rs121909637 0.00010
NM_016222.4(DDX41):c.415_418dup (p.Asp140delinsGlyTer) rs762890562 0.00007
NM_001256071.3(RNF213):c.14429G>A (p.Arg4810Lys) rs112735431 0.00004
NM_002016.2(FLG):c.7661C>G (p.Ser2554Ter) rs121909626 0.00003
NM_005085.4(NUP214):c.112C>T (p.Arg38Cys) rs143595616 0.00003
NM_000218.3(KCNQ1):c.1747C>T (p.Arg583Cys) rs17221854 0.00002
NM_002878.4(RAD51D):c.363del (p.Ala122fs) rs730881935 0.00002
NM_058216.3(RAD51C):c.837+1G>A rs760235677 0.00002
NM_000540.3(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397 0.00001
NM_000540.3(RYR1):c.7373G>A (p.Arg2458His) rs121918594 0.00001
NM_001256071.3(RNF213):c.12037G>A (p.Asp4013Asn) rs397514563 0.00001
NM_006267.5(RANBP2):c.1754C>T (p.Thr585Met) rs121434502 0.00001
NM_058216.3(RAD51C):c.414G>C (p.Leu138Phe) rs267606999 0.00001
NM_058216.3(RAD51C):c.904+5G>T rs587782702 0.00001
NM_172351.3(CD46):c.104G>A (p.Cys35Tyr) rs121909591 0.00001
NM_178857.6(RP1L1):c.133C>T (p.Arg45Trp) rs267607017 0.00001
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000540.3(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.3(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.3(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.3(RYR1):c.7039GAG[1] (p.Glu2348del) rs121918596
NM_000540.3(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_002016.2(FLG):c.2282_2285del (p.Ser761fs) rs558269137
NM_002691.4(POLD1):c.1421T>C (p.Leu474Pro) rs587777627
NM_002691.4(POLD1):c.1433G>A (p.Ser478Asn) rs397514632
NM_002878.4(RAD51D):c.345G>C (p.Gln115His) rs1555568469
NM_002878.4(RAD51D):c.480+1G>A rs1597862471
NM_003924.4(PHOX2B):c.299G>T (p.Arg100Leu) rs104893855
NM_020975.6(RET):c.95C>T (p.Ser32Leu) rs76764689
NM_023110.3(FGFR1):c.709G>A (p.Gly237Ser) rs121909635
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.