ClinVar Miner

Variants with conflicting interpretations "pathogenic" and "uncertain significance"

Submission 1 (pathogenic) minimum review status: Submission 1 (pathogenic) method:
Submission 2 (uncertain significance) minimum review status: Submission 2 (uncertain significance) method:
ClinVar version:

Total variants with conflicting interpretations: 3038

BRCA2: exon 2 deletion
FH Bologna 2
FH Vancouver 4
GRCh37/hg19 15q11.2(chr15:22770421-23195725)x1
GRCh37/hg19 15q11.2(chr15:22770421-23283811)x1
GRCh37/hg19 15q13.2-13.3(chr15:31073735-32444044)x3
GRCh37/hg19 16p11.2(chr16:28819028-29051191)x3
GRCh37/hg19 22q11.21-11.22(chr22:21029655-22481498)x1
GRCh38/hg38 15q13.1-13.2(chr15:28694893-30073921)x3
GRCh38/hg38 15q13.2-13.3(chr15:30438310-32607357)x3
GRCh38/hg38 16p13.11(chr16:14816348-16580464)x3
GRCh38/hg38 1q21.1(chr1:145705541-146009831)x1
GRCh38/hg38 1q21.1(chr1:146987841-148234205)x1
GRCh38/hg38 22q11.21(chr22:18339130-21151128)x1
GRCh38/hg38 22q11.21(chr22:20400132-21086225)x1
GRCh38/hg38 22q11.21(chr22:20400132-21151128)x3
GRCh38/hg38 22q11.21(chr22:20726972-21151128)x3
GRCh38/hg38 22q11.22-11.23(chr22:22669543-24563859)x3
GRCh38/hg38 22q11.23(chr22:23377984-24563859)x3
GRCh38/hg38 2p25.3(chr2:30341-507042)x3
GRCh38/hg38 7q11.1-11.21(chr7:61006478-62410831)x3
GRCh38/hg38 7q11.23(chr7:73040501-75255046)x3
Multiple alleles
NM_000016.5(ACADM):c.1189T>A (p.Tyr397Asn) rs759158371
NM_000016.5(ACADM):c.1247T>C (p.Ile416Thr) rs760892123
NM_000016.5(ACADM):c.1257C>A (p.Tyr419Ter) rs753928772
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.5(ACADM):c.253G>T (p.Gly85Cys) rs398123075
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.387+1delG rs786204424
NM_000016.5(ACADM):c.388-5G>A rs759254037
NM_000016.5(ACADM):c.447G>T (p.Met149Ile) rs121434277
NM_000016.5(ACADM):c.580A>G (p.Asn194Asp) rs773677327
NM_000016.5(ACADM):c.928G>A (p.Gly310Arg) rs747268471
NM_000017.2(ACADS):c.1112G>T (p.Gly371Val) rs796051905
NM_000017.2(ACADS):c.1153G>T (p.Ala385Ser) rs202124189
NM_000017.3(ACADS):c.1058C>T (p.Ser353Leu) rs28941773
NM_000017.3(ACADS):c.268G>A (p.Gly90Ser) rs121908005
NM_000017.3(ACADS):c.323G>A (p.Gly108Asp) rs387906951
NM_000017.3(ACADS):c.575C>T (p.Ala192Val) rs28940874
NM_000017.3(ACADS):c.820G>A (p.Gly274Ser) rs746368198
NM_000017.3(ACADS):c.973C>T (p.Arg325Trp) rs121908006
NM_000018.3(ACADVL):c.1096C>T (p.Arg366Cys) rs771874163
NM_000018.3(ACADVL):c.538G>A (p.Ala180Thr) rs727503791
NM_000018.3(ACADVL):c.637G>A (p.Ala213Thr) rs140629318
NM_000018.3(ACADVL):c.896_898delAGA (p.Lys299del) rs387906252
NM_000018.4(ACADVL):c.1226C>T (p.Thr409Met) rs113994169
NM_000018.4(ACADVL):c.1316G>A (p.Gly439Asp) rs533055438
NM_000018.4(ACADVL):c.364A>G (p.Asn122Asp) rs1057520088
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu) rs200573371
NM_000020.2(ACVRL1):c.1219G>A (p.Glu407Lys) rs1057521203
NM_000021.3(PSEN1):c.998A>G (p.Asp333Gly) rs121917809
NM_000022.2(ADA):c.226C>T (p.Arg76Trp) rs121908736
NM_000022.2(ADA):c.454C>A (p.Leu152Met) rs121908728
NM_000022.2(ADA):c.631C>T (p.Arg211Cys) rs121908740
NM_000022.2(ADA):c.845G>A (p.Arg282Gln) rs751635016
NM_000022.3(ADA):c.301C>T (p.Arg101Trp) rs121908717
NM_000022.3(ADA):c.446G>A (p.Arg149Gln) rs121908737
NM_000022.3(ADA):c.643G>A (p.Ala215Thr) rs114025668
NM_000022.3(ADA):c.821C>T (p.Pro274Leu) rs121908738
NM_000023.2(SGCA):c.402C>G (p.Tyr134Ter) rs780264754
NM_000023.3(SGCA):c.157G>A (p.Ala53Thr) rs60407644
NM_000026.2(ADSL):c.1342T>C (p.Ser448Pro) rs771121666
NM_000026.2(ADSL):c.153+1G>T rs1555903969
NM_000026.3(ADSL):c.1264G>T (p.Asp422Tyr) rs119450943
NM_000027.3(AGA):c.179G>A (p.Gly60Asp) rs121964907
NM_000030.2(AGXT):c.352C>T (p.Arg118Cys) rs376844297
NM_000030.2(AGXT):c.822G>C (p.Glu274Asp) rs146525143
NM_000030.2(AGXT):c.866G>A (p.Arg289His) rs61729604
NM_000031.5(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000032.4(ALAS2):c.-258C>G rs140772352
NM_000032.4(ALAS2):c.1757A>T (p.Tyr586Phe) rs139596860
NM_000035.4(ALDOB):c.1027T>C (p.Tyr343His) rs369586696
NM_000035.4(ALDOB):c.136A>T (p.Arg46Trp) rs41281039
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.1373G>A (p.Arg458His) rs121912682
NM_000038.5(APC):c.1121G>A (p.Arg374Gln) rs141582813
NM_000038.5(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.5(APC):c.1440A>C (p.Gln480His) rs863224537
NM_000038.5(APC):c.1744-2A>G rs587783035
NM_000038.5(APC):c.2105G>A (p.Gly702Glu) rs876658289
NM_000038.5(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.5(APC):c.3920_3924delTAAAA (p.Ile1307Argfs) rs1064794229
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.5(APC):c.4666dup (p.Thr1556Asnfs) rs587783031
NM_000038.5(APC):c.6510delA (p.Glu2172Argfs) rs1554087474
NM_000038.5(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000038.5(APC):c.8416C>G (p.Pro2806Ala) rs587780608
NM_000038.5(APC):c.937_938delGA (p.Glu313Asnfs) rs387906239
NM_000044.4(AR):c.1174C>T (p.Pro392Ser) rs201934623
NM_000044.4(AR):c.2659A>G (p.Met887Val) rs755226547
NM_000046.4(ARSB):c.1178A>C (p.His393Pro) rs118203944
NM_000046.4(ARSB):c.1214G>A (p.Cys405Tyr) rs118203941
NM_000046.4(ARSB):c.1325C>T (p.Thr442Met) rs1057520739
NM_000046.4(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.4(ARSB):c.288C>G (p.Ser96Arg) rs1554032095
NM_000046.4(ARSB):c.410G>T (p.Gly137Val) rs118203938
NM_000046.4(ARSB):c.707T>C (p.Leu236Pro) rs118203940
NM_000047.2(ARSE):c.36G>C (p.Arg12Ser) rs122460151
NM_000047.2(ARSE):c.410G>C (p.Gly137Ala) rs80338711
NM_000048.3(ASL):c.1079T>C (p.Met360Thr) rs875989948
NM_000048.3(ASL):c.718+5G>A rs869312990
NM_000049.2(ASPA):c.427A>T (p.Ile143Phe) rs199565861
NM_000050.4(ASS1):c.1088G>A (p.Arg363Gln) rs771937610
NM_000050.4(ASS1):c.470G>A (p.Arg157His) rs121908637
NM_000050.4(ASS1):c.53C>T (p.Ser18Leu) rs121908643
NM_000050.4(ASS1):c.805G>A (p.Val269Met) rs370595480
NM_000050.4(ASS1):c.928A>C (p.Lys310Gln) rs121908648
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8578_8580delTCT (p.Ser2860del) rs786203976
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000052.6(ATP7A):c.1707+6T>A rs797045334
NM_000053.3(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.3(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.3(ATP7B):c.1969A>C (p.Ser657Arg) rs372436901
NM_000053.3(ATP7B):c.19_20delCA (p.Gln7Aspfs) rs749363958
NM_000053.3(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.3(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.3(ATP7B):c.2668G>A (p.Val890Met) rs786204718
NM_000053.3(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.3(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000055.2(BCHE):c.1072T>A (p.Leu358Ile) rs121918557
NM_000055.2(BCHE):c.1253G>T (p.Gly418Val) rs28933390
NM_000055.3(BCHE):c.1177G>C (p.Gly393Arg) rs115129687
NM_000057.3(BLM):c.3558+1G>T rs148969222
NM_000059.3(BRCA2):c.-39-2A>G rs1555280053
NM_000059.3(BRCA2):c.1763A>G (p.Asn588Ser) rs373400041
NM_000059.3(BRCA2):c.1799A>G (p.Tyr600Cys) rs397507276
NM_000059.3(BRCA2):c.2254_2257delGACT (p.Asp752Phefs) rs80359326
NM_000059.3(BRCA2):c.316+5G>A rs81002840
NM_000059.3(BRCA2):c.3904_3906delACT (p.Thr1302del) rs80359414
NM_000059.3(BRCA2):c.425G>A (p.Ser142Asn) rs397507713
NM_000059.3(BRCA2):c.4478_4481delAAAG (p.Glu1493Valfs) rs80359454
NM_000059.3(BRCA2):c.475+3A>G rs81002795
NM_000059.3(BRCA2):c.475+3A>T rs81002795
NM_000059.3(BRCA2):c.516G>A (p.Lys172=) rs80359790
NM_000059.3(BRCA2):c.517G>C (p.Gly173Arg) rs397507768
NM_000059.3(BRCA2):c.5229_5231delTAG (p.Ser1744del) rs397507349
NM_000059.3(BRCA2):c.5428G>A (p.Val1810Ile) rs80358766
NM_000059.3(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.3(BRCA2):c.631+3A>G rs397507840
NM_000059.3(BRCA2):c.6449_6450insTA (p.Lys2150Asnfs) rs276174872
NM_000059.3(BRCA2):c.6550C>T (p.Gln2184Ter) rs80358887
NM_000059.3(BRCA2):c.663T>G (p.Phe221Leu) rs80358891
NM_000059.3(BRCA2):c.68-1G>T rs1060502376
NM_000059.3(BRCA2):c.681+4A>G rs397507884
NM_000059.3(BRCA2):c.6937+1G>A rs886040935
NM_000059.3(BRCA2):c.7007+4A>G rs876661201
NM_000059.3(BRCA2):c.7235C>T (p.Thr2412Ile) rs397507384
NM_000059.3(BRCA2):c.7529T>C (p.Leu2510Pro) rs80358979
NM_000059.3(BRCA2):c.7795_7797delGAA (p.Glu2599del) rs80359682
NM_000059.3(BRCA2):c.7805+3A>C rs81002810
NM_000059.3(BRCA2):c.7806-9T>G rs397507939
NM_000059.3(BRCA2):c.7878G>A (p.Trp2626Ter) rs80359013
NM_000059.3(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.7976+5G>A rs786201180
NM_000059.3(BRCA2):c.7976G>A (p.Arg2659Lys) rs80359027
NM_000059.3(BRCA2):c.7976G>C (p.Arg2659Thr) rs80359027
NM_000059.3(BRCA2):c.7977-2A>T rs276174899
NM_000059.3(BRCA2):c.7978T>G (p.Tyr2660Asp) rs80359029
NM_000059.3(BRCA2):c.7985C>A (p.Thr2662Lys) rs431825362
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8168A>G (p.Asp2723Gly) rs41293513
NM_000059.3(BRCA2):c.8168A>T (p.Asp2723Val) rs41293513
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.3(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.3(BRCA2):c.8384_8395delTTCCTGACCCTA (p.Phe2795_Ser3133delinsTer) rs587781689
NM_000059.3(BRCA2):c.8395delA (p.Arg2799Aspfs) rs80359709
NM_000059.3(BRCA2):c.8486A>G (p.Gln2829Arg) rs80359100
NM_000059.3(BRCA2):c.8524C>T (p.Arg2842Cys) rs80359104
NM_000059.3(BRCA2):c.8754+4A>G rs81002893
NM_000059.3(BRCA2):c.8754+5G>A rs81002813
NM_000059.3(BRCA2):c.8755-1G>A rs81002812
NM_000059.3(BRCA2):c.8954-3C>G rs81002844
NM_000059.3(BRCA2):c.8954-5A>G rs886040949
NM_000059.3(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.3(BRCA2):c.9154C>T (p.Arg3052Trp) rs45580035
NM_000059.3(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.3(BRCA2):c.9466C>T (p.Gln3156Ter) rs276174925
NM_000059.3(BRCA2):c.9699_9702delTATG (p.Cys3233Trpfs) rs80359775
NM_000059.3(BRCA2):c.9945delA (p.Glu3316Asnfs) rs431825381
NM_000059.3(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000060.3(BTD):c.310-15delT rs587783008
NM_000069.2(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000070.2(CAPN3):c.1117T>C (p.Trp373Arg) rs775453643
NM_000070.2(CAPN3):c.1746-20C>G rs201892814
NM_000070.2(CAPN3):c.2148G>T (p.Glu716Asp) rs770894443
NM_000070.2(CAPN3):c.566T>C (p.Leu189Pro) rs758795961
NM_000070.2(CAPN3):c.956C>T (p.Pro319Leu) rs121434547
NM_000071.2(CBS):c.1265C>T (p.Pro422Leu) rs28934892
NM_000071.2(CBS):c.1280C>T (p.Pro427Leu) rs863223434
NM_000071.2(CBS):c.1397C>T (p.Ser466Leu) rs121964971
NM_000071.2(CBS):c.1616T>C (p.Leu539Ser) rs121964968
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000071.2(CBS):c.667-14_667-7del8 rs764160782
NM_000073.2(CD3G):c.213delA (p.Lys71Asnfs) rs570768621
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000080.3(CHRNE):c.103T>C (p.Tyr35His) rs144169073
NM_000080.3(CHRNE):c.37G>A (p.Gly13Arg) rs372635387
NM_000080.3(CHRNE):c.488C>T (p.Ser163Leu) rs121909516
NM_000082.3(ERCC8):c.479C>T (p.Ala160Val) rs121434325
NM_000082.3(ERCC8):c.613G>C (p.Ala205Pro) rs121434326
NM_000083.2(CLCN1):c.1283T>C (p.Phe428Ser) rs774843953
NM_000083.2(CLCN1):c.1437_1450delACCCTGCGGAGGCT (p.Pro480Hisfs) rs768119034
NM_000083.2(CLCN1):c.2795C>T (p.Pro932Leu) rs80356706
NM_000083.2(CLCN1):c.2831dupC (p.Gly945Argfs) rs755176513
NM_000083.2(CLCN1):c.2926C>T (p.Arg976Ter) rs142539932
NM_000083.2(CLCN1):c.501C>G (p.Phe167Leu) rs149729531
NM_000083.2(CLCN1):c.568G>A (p.Gly190Arg) rs369773321
NM_000083.2(CLCN1):c.568_569delGGinsTC (p.Gly190Ser) rs797045032
NM_000083.2(CLCN1):c.592C>G (p.Leu198Val) rs80356685
NM_000085.4(CLCNKB):c.1312C>T (p.Arg438Cys) rs121909133
NM_000088.3(COL1A1):c.3226G>A (p.Gly1076Ser) rs67394386
NM_000088.3(COL1A1):c.4239T>A (p.Asp1413Glu) rs754555549
NM_000090.3(COL3A1):c.2959G>A (p.Gly987Ser) rs587779583
NM_000090.3(COL3A1):c.3256-43T>G (p.Pro1085_Gly1086insVCVYMTSIQNMFLK) rs587779667
NM_000090.3(COL3A1):c.674G>C (p.Gly225Ala) rs587779533
NM_000090.3(COL3A1):c.709G>A (p.Gly237Arg) rs587779625
NM_000091.4(COL4A3):c.2954G>T (p.Gly985Val) rs121912827
NM_000091.4(COL4A3):c.4981C>T (p.Arg1661Cys) rs201697532
NM_000091.4(COL4A3):c.765G>A (p.Thr255=) rs869025328
NM_000093.4(COL5A1):c.4474G>A (p.Gly1492Ser) rs863223458
NM_000095.2(COMP):c.1586C>T (p.Thr529Ile) rs312262903
NM_000096.3(CP):c.2158C>T (p.Arg720Trp) rs145784949
NM_000096.3(CP):c.2684G>C (p.Gly895Ala) rs139633388
NM_000098.2(CPT2):c.1342T>C (p.Phe448Leu) rs74315297
NM_000098.2(CPT2):c.1646G>A (p.Gly549Asp) rs186044004
NM_000098.2(CPT2):c.1657G>A (p.Asp553Asn) rs28936376
NM_000098.2(CPT2):c.534_558del25insT (p.Leu178_Ile186delinsPhe) rs515726173
NM_000102.3(CYP17A1):c.1435_1438dupATCC (p.Pro480Hisfs) rs556794126
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1120G>A (p.Asp374Asn) rs104893622
NM_000104.3(CYP1B1):c.1168C>T (p.Arg390Cys) rs148542782
NM_000104.3(CYP1B1):c.155C>T (p.Pro52Leu) rs201824781
NM_000104.3(CYP1B1):c.182G>A (p.Gly61Glu) rs28936700
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000104.3(CYP1B1):c.868dupC (p.Arg290Profs) rs587778875
NM_000109.3(DMD):c.1700T>C (p.Leu567Pro) rs370644567
NM_000110.3(DPYD):c.1905+1G>A rs3918290
NM_000110.3(DPYD):c.2657G>A (p.Arg886His) rs1801267
NM_000112.3(SLC26A2):c.2144C>T (p.Ala715Val) rs104893918
NM_000112.3(SLC26A2):c.764G>A (p.Gly255Glu) rs104893917
NM_000113.2(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000113.2(TOR1A):c.863G>A (p.Arg288Gln) rs727502811
NM_000118.3(ENG):c.1586G>A (p.Arg529His) rs863223538
NM_000118.3(ENG):c.1633G>A (p.Gly545Ser) rs142896669
NM_000118.3(ENG):c.640G>A (p.Gly214Ser) rs150932144
NM_000119.2(EPB42):c.424G>A (p.Ala142Thr) rs104894487
NM_000123.3(ERCC5):c.2375C>T (p.Ala792Val) rs121434571
NM_000123.3(ERCC5):c.2620G>A (p.Ala874Thr) rs121434576
NM_000124.3(ERCC6):c.2551T>C (p.Trp851Arg) rs368728467
NM_000124.3(ERCC6):c.2599-26A>G rs4253196
NM_000126.3(ETFA):c.2T>C (p.Met1Thr) rs727503918
NM_000126.3(ETFA):c.667C>T (p.Arg223Ter) rs769976586
NM_000128.3(F11):c.400C>T (p.Gln134Ter) rs756908183
NM_000128.3(F11):c.809A>T (p.Lys270Ile) rs121965070
NM_000129.3(F13A1):c.782G>A (p.Arg261His) rs121913071
NM_000132.3(F8):c.3169G>A (p.Glu1057Lys) rs28933673
NM_000135.3(FANCA):c.4261-2A>C rs915983602
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000137.2(FAH):c.607-6T>G rs80338896
NM_000138.4(FBN1):c.1453C>T (p.Arg485Cys) rs137854485
NM_000138.4(FBN1):c.1837+5G>A rs1445085747
NM_000138.4(FBN1):c.185G>A (p.Arg62His) rs145942328
NM_000138.4(FBN1):c.1904A>G (p.Tyr635Cys) rs1555399816
NM_000138.4(FBN1):c.3037G>A (p.Gly1013Arg) rs140593
NM_000138.4(FBN1):c.3379G>A (p.Gly1127Ser) rs137854468
NM_000138.4(FBN1):c.3476G>A (p.Cys1159Tyr) rs1555398524
NM_000138.4(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.4(FBN1):c.3974A>C (p.Glu1325Ala) rs794728331
NM_000138.4(FBN1):c.4747+5G>C rs193922209
NM_000138.4(FBN1):c.5513G>A (p.Gly1838Asp) rs78970689
NM_000138.4(FBN1):c.6163+2dupT rs794728315
NM_000138.4(FBN1):c.640G>A (p.Gly214Ser) rs794728162
NM_000138.4(FBN1):c.6453C>T (p.Cys2151=) rs794728251
NM_000138.4(FBN1):c.6496G>A (p.Asp2166Asn) rs794728252
NM_000138.4(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.4(FBN1):c.7726C>T (p.Arg2576Cys) rs147195031
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.4(FBN1):c.8416dup (p.Ile2806Asnfs) rs1555393538
NM_000138.4(FBN1):c.8488C>T (p.Gln2830Ter) rs886038795
NM_000138.4(FBN1):c.8525_8529delTTAAC (p.Leu2842Profs) rs1064794130
NM_000140.3(FECH):c.315-48T>C rs2272783
NM_000142.4(FGFR3):c.1118A>G (p.Tyr373Cys) rs121913485
NM_000142.4(FGFR3):c.1138G>A (p.Gly380Arg) rs28931614
NM_000142.4(FGFR3):c.1619A>G (p.Asn540Ser) rs77722678
NM_000143.3(FH):c.1301G>A (p.Cys434Tyr) rs398123164
NM_000143.3(FH):c.1431_1433dupAAA (p.Lys477_Asn478insLys) rs367543046
NM_000143.3(FH):c.40dupC (p.Leu14Profs) rs1060500900
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000143.3(FH):c.6C>G (p.Tyr2Ter) rs199971078
NM_000143.3(FH):c.700A>G (p.Thr234Ala) rs372505976
NM_000144.4(FXN):c.118C>T (p.Arg40Cys) rs145854903
NM_000150.2(FUT6):c.739G>A (p.Glu247Lys) rs17855739
NM_000151.3(G6PC):c.965T>A (p.Phe322Tyr) rs863224022
NM_000152.3(GAA):c.1099T>C (p.Trp367Arg) rs1555600061
NM_000152.3(GAA):c.1552-3C>G rs375470378
NM_000152.3(GAA):c.670C>T (p.Arg224Trp) rs757700700
NM_000152.3(GAA):c.853C>T (p.Pro285Ser) rs886042086
NM_000152.3(GAA):c.953T>C (p.Met318Thr) rs121907936
NM_000152.4(GAA):c.1447G>A (p.Gly483Arg) rs770590394
NM_000152.4(GAA):c.1841C>A (p.Thr614Lys) rs369531647
NM_000152.4(GAA):c.710C>T (p.Ala237Val) rs121907944
NM_000153.3(GALC):c.1158_1161+6delCATGGTAAAC rs759068540
NM_000153.3(GALC):c.266C>T (p.Pro89Leu) rs201422931
NM_000153.3(GALC):c.349A>G (p.Met117Val) rs145580093
NM_000153.3(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000154.1(GALK1):c.593C>T (p.Ala198Val) rs80084721
NM_000154.1(GALK1):c.94G>A (p.Val32Met) rs104894576
NM_000155.3(GALT):c.1006A>T (p.Met336Leu) rs111033810
NM_000155.3(GALT):c.100T>A (p.Tyr34Asn) rs111033836
NM_000155.3(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.3(GALT):c.107C>T (p.Pro36Leu) rs111033645
NM_000155.3(GALT):c.134C>T (p.Ser45Leu) rs111033652
NM_000155.3(GALT):c.152G>A (p.Arg51Gln) rs111033648
NM_000155.3(GALT):c.197C>T (p.Pro66Leu) rs111033656
NM_000155.3(GALT):c.241G>A (p.Ala81Thr) rs111033665
NM_000155.3(GALT):c.247G>A (p.Gly83Arg) rs111033660
NM_000155.3(GALT):c.27G>C (p.Gln9His) rs111033637
NM_000155.3(GALT):c.292G>C (p.Asp98His) rs111033670
NM_000155.3(GALT):c.367C>G (p.Arg123Gly) rs111033674
NM_000155.3(GALT):c.379A>G (p.Lys127Glu) rs111033682
NM_000155.3(GALT):c.389G>A (p.Cys130Tyr) rs367543255
NM_000155.3(GALT):c.394C>T (p.His132Tyr) rs111033688
NM_000155.3(GALT):c.496C>G (p.Pro166Ala) rs367543257
NM_000155.3(GALT):c.547C>A (p.Pro183Thr) rs111033721
NM_000155.3(GALT):c.552C>A (p.His184Gln) rs111033717
NM_000155.3(GALT):c.554C>T (p.Pro185Leu) rs111033722
NM_000155.3(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.3(GALT):c.652C>G (p.Leu218Val) rs2070075
NM_000155.3(GALT):c.676C>G (p.Leu226Val) rs111033751
NM_000155.3(GALT):c.752A>C (p.Tyr251Ser) rs111033755
NM_000155.3(GALT):c.752A>G (p.Tyr251Cys) rs111033755
NM_000155.3(GALT):c.772C>T (p.Arg258Cys) rs368166217
NM_000155.3(GALT):c.779_790delATGTGCGGCGGC (p.His260_Arg263del) rs111033762
NM_000155.3(GALT):c.793C>G (p.Pro265Ala) rs111033764
NM_000155.3(GALT):c.815G>A (p.Arg272His) rs111033831
NM_000155.3(GALT):c.82G>A (p.Asp28Asn) rs111033636
NM_000155.3(GALT):c.857A>G (p.Tyr286Cys) rs367543262
NM_000155.3(GALT):c.883C>A (p.Pro295Thr) rs111033783
NM_000155.3(GALT):c.91C>A (p.His31Asn) rs111033643
NM_000155.3(GALT):c.958G>A (p.Ala320Thr) rs111033795
NM_000155.3(GALT):c.961C>T (p.His321Tyr) rs367543266
NM_000155.3(GALT):c.970C>T (p.Pro324Ser) rs111033798
NM_000158.3(GBE1):c.1883A>G (p.His628Arg) rs137852891
NM_000158.3(GBE1):c.785G>A (p.Arg262His) rs369574719
NM_000158.3(GBE1):c.986A>G (p.Tyr329Cys) rs80338671
NM_000158.3(GBE1):c.998A>T (p.Glu333Val) rs1553684545
NM_000159.2(GCDH):c.1144G>A (p.Ala382Thr) rs567564095
NM_000159.3(GCDH):c.1168G>C (p.Gly390Arg) rs372983141
NM_000159.3(GCDH):c.1286C>T (p.Thr429Met) rs745360675
NM_000159.3(GCDH):c.356C>T (p.Ser119Leu) rs886043840
NM_000159.3(GCDH):c.479A>G (p.Gln160Arg) rs1176799813
NM_000159.3(GCDH):c.877G>A (p.Ala293Thr) rs121434371
NM_000159.4(GCDH):c.416C>T (p.Ser139Leu) rs139851890
NM_000161.2(GCH1):c.671A>G (p.Lys224Arg) rs41298442
NM_000161.2(GCH1):c.747G>C (p.Arg249Ser) rs104894442
NM_000163.4(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000163.4(GHR):c.718T>C (p.Tyr240His) rs143814221
NM_000165.5(GJA1):c.1085G>A (p.Arg362Gln) rs2227885
NM_000165.5(GJA1):c.605G>A (p.Arg202His) rs750294638
NM_000165.5(GJA1):c.65G>A (p.Gly22Glu) rs104893964
NM_000165.5(GJA1):c.681A>T (p.Glu227Asp) rs875989815
NM_000166.5(GJB1):c.-17G>A rs879254047
NM_000166.5(GJB1):c.425G>A (p.Arg142Gln) rs786204123
NM_000166.5(GJB1):c.478T>C (p.Tyr160His) rs1555937197
NM_000168.5(GLI3):c.2119C>T (p.Pro707Ser) rs121917716
NM_000169.2(GLA):c.1085C>T (p.Pro362Leu) rs730880441
NM_000169.2(GLA):c.1088G>A (p.Arg363His) rs111422676
NM_000169.2(GLA):c.124A>C (p.Met42Leu) rs797044613
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000169.2(GLA):c.724A>G (p.Ile242Val) rs397515873
NM_000169.2(GLA):c.758T>C (p.Ile253Thr) rs727505292
NM_000170.2(GLDC):c.1117C>T (p.Arg373Trp) rs150171524
NM_000170.2(GLDC):c.1940C>T (p.Pro647Leu) rs201135624
NM_000171.3(GLRA1):c.299G>A (p.Arg100His) rs281864914
NM_000178.2(GSS):c.4delG (p.Ala2Profs) rs752560204
NM_000178.4(GSS):c.941C>T (p.Pro314Leu) rs75863437
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1618_1620delCTT (p.Leu540del) rs1064793600
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2300C>T (p.Thr767Ile) rs587781462
NM_000179.2(MSH6):c.2342C>T (p.Pro781Leu) rs1553413710
NM_000179.2(MSH6):c.3188T>G (p.Leu1063Arg) rs1060502901
NM_000179.2(MSH6):c.3386_3388delGTG (p.Cys1129_Val1130delinsLeu) rs587776705
NM_000179.2(MSH6):c.3632T>C (p.Leu1211Pro) rs864622041
NM_000179.2(MSH6):c.3744_3773del30 (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4004_4007dupAAGT (p.Cys1337Serfs) rs876658497
NM_000179.2(MSH6):c.4028C>G (p.Ser1343Ter) rs863225420
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000191.2(HMGCL):c.208G>C (p.Val70Leu) rs121964996
NM_000191.2(HMGCL):c.602C>A (p.Ser201Tyr) rs760106433
NM_000193.3(SHH):c.1147G>A (p.Ala383Thr) rs137853341
NM_000196.3(HSD11B2):c.343_348del (p.Glu115_Leu116del) rs794726669
NM_000196.3(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000199.3(SGSH):c.1063G>A (p.Glu355Lys) rs766938111
NM_000199.3(SGSH):c.675C>G (p.Phe225Leu) rs34520362
NM_000203.4(IDUA):c.1855C>G (p.Arg619Gly) rs121965031
NM_000203.4(IDUA):c.300-3C>G rs1226056948
NM_000203.4(IDUA):c.898G>A (p.Ala300Thr) rs121965030
NM_000207.2(INS):c.-152C>G rs748749585
NM_000208.2(INSR):c.1195C>T (p.Arg399Ter) rs121913151
NM_000214.3(JAG1):c.2429C>T (p.Pro810Leu) rs769531968
NM_000215.3(JAK3):c.1765G>A (p.Gly589Ser) rs886039394
NM_000218.2(KCNQ1):c.1135T>C (p.Trp379Arg) rs199472768
NM_000218.2(KCNQ1):c.1552C>T (p.Arg518Ter) rs17215500
NM_000218.2(KCNQ1):c.1597C>T (p.Arg533Trp) rs199472793
NM_000218.2(KCNQ1):c.160_168dupATCGCGCCC (p.Pro56_Gly57insIleAlaPro) rs397515877
NM_000218.2(KCNQ1):c.1876G>A (p.Gly626Ser) rs199472821
NM_000218.2(KCNQ1):c.19C>T (p.Pro7Ser) rs199473443
NM_000218.2(KCNQ1):c.211_219delGCCGCGCCC (p.Ala71_Pro73del) rs397508107
NM_000218.2(KCNQ1):c.355G>C (p.Gly119Arg)
NM_000218.2(KCNQ1):c.532G>A (p.Ala178Thr) rs120074177
NM_000218.2(KCNQ1):c.535G>A (p.Gly179Ser) rs199473394
NM_000218.2(KCNQ1):c.560T>C (p.Leu187Pro) rs199473399
NM_000218.2(KCNQ1):c.575G>A (p.Arg192His) rs199472698
NM_000218.2(KCNQ1):c.742T>C (p.Trp248Arg) rs199473459
NM_000218.2(KCNQ1):c.898G>A (p.Ala300Thr) rs120074187
NM_000218.2(KCNQ1):c.905C>A (p.Ala302Glu) rs193922365
NM_000218.2(KCNQ1):c.958C>T (p.Pro320Ser) rs199472753
NM_000219.5(KCNE1):c.221C>T (p.Ser74Leu) rs74315446
NM_000219.5(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.5(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.5(KCNE1):c.292C>T (p.Arg98Trp) rs199473362
NM_000222.2(KIT):c.1964A>G (p.Asn655Ser) rs1057519707
NM_000222.2(KIT):c.1965T>G (p.Asn655Lys) rs1057519708
NM_000222.2(KIT):c.2089C>T (p.His697Tyr) rs763308199
NM_000222.2(KIT):c.2447A>T (p.Asp816Val) rs121913507
NM_000222.2(KIT):c.2466T>A (p.Asn822Lys) rs121913514
NM_000226.3(KRT9):c.488G>A (p.Arg163Gln) rs57758262
NM_000228.2(LAMB3):c.596G>C (p.Gly199Ala) rs121912486
NM_000232.4(SGCB):c.-10_22dup rs1553940963
NM_000236.2(LIPC):c.866C>T (p.Ser289Phe) rs121912502
NM_000238.3(KCNH2):c.1496T>G (p.Leu499Arg) rs794728370
NM_000238.3(KCNH2):c.167G>T (p.Arg56Leu) rs199472845
NM_000238.3(KCNH2):c.1684C>T (p.His562Tyr) rs794728481
NM_000238.3(KCNH2):c.1711A>G (p.Ile571Val) rs199472928
NM_000238.3(KCNH2):c.1814C>T (p.Pro605Leu) rs199472938
NM_000238.3(KCNH2):c.1918T>C (p.Phe640Leu) rs199473529
NM_000238.3(KCNH2):c.1979C>T (p.Ser660Leu) rs199472979
NM_000238.3(KCNH2):c.2131A>G (p.Ile711Val) rs199473532
NM_000238.3(KCNH2):c.2145G>A (p.Ala715=) rs794728384
NM_000238.3(KCNH2):c.215C>A (p.Pro72Gln) rs199473421
NM_000238.3(KCNH2):c.2246G>T (p.Gly749Val) rs199472989
NM_000238.3(KCNH2):c.2255G>A (p.Arg752Gln) rs121912512
NM_000238.3(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.3(KCNH2):c.2771G>A (p.Gly924Glu) rs199473009
NM_000238.3(KCNH2):c.2785dupG (p.Glu929Glyfs) rs794728458
NM_000238.3(KCNH2):c.298C>G (p.Arg100Gly) rs121912515
NM_000238.3(KCNH2):c.934C>T (p.Arg312Cys) rs199472885
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.2082G>A (p.Met694Ile) rs28940578
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000246.3(CIITA):c.2888+1G>A rs372826934
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.-27C>A rs587779001
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.109G>A (p.Glu37Lys) rs63751012
NM_000249.3(MLH1):c.116G>A (p.Cys39Tyr) rs63751701
NM_000249.3(MLH1):c.1500_1502delCAT (p.Ile501del) rs587778920
NM_000249.3(MLH1):c.1731+5G>A rs267607850
NM_000249.3(MLH1):c.1865T>C (p.Leu622Pro) rs63750693
NM_000249.3(MLH1):c.1989+5G>C rs267607878
NM_000249.3(MLH1):c.2038T>C (p.Cys680Arg) rs63750809
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.207+5G>C rs587781518
NM_000249.3(MLH1):c.2104_2105delAG (p.Ser702Terfs) rs63751651
NM_000249.3(MLH1):c.218T>G (p.Leu73Arg) rs397514684
NM_000249.3(MLH1):c.2250C>G (p.Tyr750Ter) rs267607893
NM_000249.3(MLH1):c.2252_2253dupAA (p.Val752Lysfs) rs267607901
NM_000249.3(MLH1):c.55A>T (p.Ile19Phe) rs63750648
NM_000249.3(MLH1):c.790+3A>T rs267607792
NM_000249.3(MLH1):c.790+4A>G rs267607786
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000249.3(MLH1):c.85G>T (p.Ala29Ser) rs63750656
NM_000249.3(MLH1):c.884+3A>G rs267607803
NM_000249.3(MLH1):c.918T>A (p.Asn306Lys) rs587779054
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1660A>G (p.Ser554Gly) rs63751656
NM_000251.2(MSH2):c.1661+5G>C rs267607972
NM_000251.2(MSH2):c.1784T>G (p.Leu595Arg) rs786201590
NM_000251.2(MSH2):c.2006-5T>A rs267607990
NM_000251.2(MSH2):c.2006G>T (p.Gly669Val) rs63751640
NM_000251.2(MSH2):c.2047G>A (p.Gly683Arg) rs267607995
NM_000251.2(MSH2):c.2087C>T (p.Pro696Leu) rs267607994
NM_000251.2(MSH2):c.2680dupA (p.Met894Asnfs) rs876658211
NM_000251.2(MSH2):c.301_306delGAAGTT (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.482T>A (p.Val161Asp) rs63750126
NM_000251.2(MSH2):c.490G>T (p.Gly164Trp) rs63750582
NM_000251.2(MSH2):c.929T>G (p.Leu310Arg) rs63750640
NM_000252.2(MTM1):c.1367T>C (p.Phe456Ser) rs587783783
NM_000252.2(MTM1):c.1406A>G (p.His469Arg) rs587783789
NM_000252.2(MTM1):c.688T>C (p.Trp230Arg) rs398123274
NM_000254.2(MTR):c.2758C>G (p.His920Asp) rs121913579
NM_000255.3(MMUT):c.1084-10A>G rs777031588
NM_000255.3(MMUT):c.1852_1854delCTT (p.Leu618del) rs398123277
NM_000255.3(MMUT):c.1956+2T>C rs750619189
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965
NM_000256.3(MYBPC3):c.1227-13G>A rs397515893
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1458-6G>A rs375347534
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1483C>T (p.Arg495Trp) rs397515905
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1790G>A (p.Arg597Gln) rs727503195
NM_000256.3(MYBPC3):c.1829A>T (p.Asp610Val) rs730880554
NM_000256.3(MYBPC3):c.1831G>A (p.Glu611Lys) rs730880555
NM_000256.3(MYBPC3):c.2234A>G (p.Asp745Gly) rs727503190
NM_000256.3(MYBPC3):c.2449C>T (p.Arg817Trp) rs727503188
NM_000256.3(MYBPC3):c.2458C>T (p.Arg820Trp) rs775404728
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2618C>T (p.Pro873Leu) rs371401403
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3407_3409delACT (p.Tyr1136del) rs730880674
NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC rs36212066
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000257.2(MYH7):c.1681G>A (p.Ala561Thr) rs730880878
NM_000257.2(MYH7):c.2845G>A (p.Glu949Lys) rs121913629
NM_000257.2(MYH7):c.4300C>T (p.Arg1434Cys) rs730880800
NM_000257.2(MYH7):c.5647G>A (p.Glu1883Lys) rs121913652
NM_000257.2(MYH7):c.709C>T (p.Arg237Trp) rs45516091
NM_000257.3(MYH7):c.1046T>C (p.Met349Thr) rs121913640
NM_000257.3(MYH7):c.1063G>A (p.Ala355Thr) rs397516088
NM_000257.3(MYH7):c.1322C>T (p.Thr441Met) rs121913653
NM_000257.3(MYH7):c.1324C>T (p.Arg442Cys) rs148808089
NM_000257.3(MYH7):c.1357C>A (p.Arg453Ser) rs121913625
NM_000257.3(MYH7):c.1436A>G (p.Asn479Ser) rs727504236
NM_000257.3(MYH7):c.2011C>T (p.Arg671Cys) rs727503263
NM_000257.3(MYH7):c.2069T>C (p.Met690Thr) rs397516128
NM_000257.3(MYH7):c.2081G>A (p.Arg694His) rs886039030
NM_000257.3(MYH7):c.2093T>C (p.Val698Ala) rs397516130
NM_000257.3(MYH7):c.2129C>A (p.Pro710His) rs727504272
NM_000257.3(MYH7):c.2168G>A (p.Arg723His) rs397516135
NM_000257.3(MYH7):c.2536G>C (p.Glu846Gln) rs730880748
NM_000257.3(MYH7):c.2543A>G (p.Glu848Gly) rs727504311
NM_000257.3(MYH7):c.2602G>C (p.Ala868Pro) rs727504356
NM_000257.3(MYH7):c.2710C>T (p.Arg904Cys) rs727503253
NM_000257.3(MYH7):c.2711G>A (p.Arg904His) rs397516165
NM_000257.3(MYH7):c.2714G>C (p.Cys905Ser) rs730880757
NM_000257.3(MYH7):c.2792A>G (p.Glu931Gly) rs730880760
NM_000257.3(MYH7):c.2858A>T (p.Asp953Val) rs730880901
NM_000257.3(MYH7):c.3134G>T (p.Arg1045Leu) rs397516178
NM_000257.3(MYH7):c.4835T>C (p.Leu1612Pro) rs587779392
NM_000257.3(MYH7):c.4855G>A (p.Glu1619Lys) rs45442096
NM_000257.3(MYH7):c.5134C>T (p.Arg1712Trp) rs121913650
NM_000257.3(MYH7):c.5399C>T (p.Ala1800Val) rs730880817
NM_000257.3(MYH7):c.5458C>T (p.Arg1820Trp) rs145734640
NM_000257.3(MYH7):c.5561C>T (p.Thr1854Met) rs372381770
NM_000257.3(MYH7):c.5807A>G (p.Ter1936Trp) rs367543053
NM_000257.3(MYH7):c.610C>T (p.Arg204Cys) rs397516259
NM_000257.3(MYH7):c.611G>A (p.Arg204His) rs397516260
NM_000257.3(MYH7):c.611G>T (p.Arg204Leu) rs397516260
NM_000257.3(MYH7):c.677C>T (p.Ala226Val) rs876657887
NM_000257.3(MYH7):c.727C>T (p.Arg243Cys) rs397516265
NM_000257.3(MYH7):c.728G>A (p.Arg243His) rs267606910
NM_000257.3(MYH7):c.740T>G (p.Phe247Cys) rs730880922
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.3133C>T (p.Arg1045Cys) rs45611033
NM_000257.4(MYH7):c.3578G>A (p.Arg1193His) rs397516187
NM_000257.4(MYH7):c.4066G>A (p.Glu1356Lys) rs727503246
NM_000257.4(MYH7):c.4130C>T (p.Thr1377Met) rs397516201
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225
NM_000257.4(MYH7):c.5329G>A (p.Ala1777Thr) rs200939753
NM_000258.2(MYL3):c.170C>G (p.Ala57Gly) rs139794067
NM_000258.2(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000258.2(MYL3):c.461G>A (p.Arg154His) rs104893749
NM_000260.3(MYO7A):c.1849T>C (p.Ser617Pro) rs782063761
NM_000260.3(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.3(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.3(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.3(MYO7A):c.4505A>G (p.Asp1502Gly) rs757460257
NM_000262.2(NAGA):c.986G>A (p.Arg329Gln) rs121434533
NM_000263.3(NAGLU):c.1562C>T (p.Pro521Leu) rs104894595
NM_000263.3(NAGLU):c.1928G>A (p.Arg643His) rs104894593
NM_000263.3(NAGLU):c.934G>A (p.Asp312Asn) rs1052471595
NM_000264.3(PTCH1):c.2183C>T (p.Thr728Met) rs115556836
NM_000264.3(PTCH1):c.2479A>G (p.Ser827Gly) rs199476092
NM_000264.3(PTCH1):c.3155C>T (p.Thr1052Met) rs138911275
NM_000264.3(PTCH1):c.395-1G>A rs368869806
NM_000264.4(PTCH1):c.1526G>A (p.Gly509Asp) rs1060502268
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.1527+5G>A rs1060500352
NM_000267.3(NF1):c.2339C>G (p.Thr780Arg) rs199474746
NM_000267.3(NF1):c.2533T>C (p.Cys845Arg) rs1060500254
NM_000267.3(NF1):c.2798T>C (p.Leu933Pro) rs1555614342
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3790G>A (p.Glu1264Lys) rs863224660
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.4289A>T (p.Asn1430Ile) rs199474754
NM_000267.3(NF1):c.4973_4978delTCTATA (p.Ile1658_Tyr1659del) rs1135402868
NM_000267.3(NF1):c.5446G>A (p.Asp1816Asn) rs771597781
NM_000267.3(NF1):c.980T>C (p.Leu327Pro) rs201624827
NM_000271.4(NPC1):c.2972_2973delAG (p.Gln991Argfs) rs756815030
NM_000271.4(NPC1):c.2974G>T (p.Gly992Trp) rs80358254
NM_000271.4(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.4(NPC1):c.3107C>T (p.Thr1036Met) rs28942104
NM_000271.4(NPC1):c.3281T>C (p.Ile1094Thr) rs1338658857
NM_000271.4(NPC1):c.688_693delTCTGTG (p.Ser230_Val231del) rs758687942
NM_000274.3(OAT):c.192_193delAG (p.Gly65Lysfs) rs386833600
NM_000275.2(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.2(OCA2):c.79G>A (p.Gly27Arg) rs61738394
NM_000276.3(OCRL):c.1498C>G (p.Arg500Gly) rs398123287
NM_000277.2(PAH):c.1357_*2delTAAAG (p.Ter453Profs) rs794727086
NM_000277.2(PAH):c.601C>T (p.His201Tyr) rs62517205
NM_000277.2(PAH):c.965C>G (p.Ala322Gly) rs62514958
NM_000277.3(PAH):c.1065+3A>G rs62508689
NM_000277.3(PAH):c.293T>C (p.Leu98Ser) rs62517167
NM_000277.3(PAH):c.500A>T (p.Asn167Ile) rs77554925
NM_000277.3(PAH):c.734T>C (p.Val245Ala) rs76212747
NM_000277.3(PAH):c.800A>G (p.Gln267Arg) rs778154939
NM_000277.3(PAH):c.805A>C (p.Ile269Leu) rs62508692
NM_000282.3(PCCA):c.1676G>T (p.Trp559Leu) rs118169528
NM_000282.3(PCCA):c.2040G>A (p.Ala680=) rs369982920
NM_000286.2(PEX12):c.681-2A>C rs187526749
NM_000286.2(PEX12):c.949C>T (p.Leu317Phe) rs61752112
NM_000286.2(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000287.3(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.3(PEX6):c.654C>G (p.Phe218Leu) rs886037779
NM_000287.3(PEX6):c.659G>T (p.Gly220Val) rs267608203
NM_000288.3(PEX7):c.340-10A>G rs267608255
NM_000290.3(PGAM2):c.268C>T (p.Arg90Trp) rs104894034
NM_000290.3(PGAM2):c.290G>A (p.Gly97Asp) rs77938727
NM_000293.2(PHKB):c.352G>C (p.Ala118Pro) rs121918022
NM_000293.3(PHKB):c.1546C>T (p.Gln516Ter) rs758004953
NM_000294.2(PHKG2):c.926G>A (p.Arg309Gln) rs572115942
NM_000295.4(SERPINA1):c.1078G>A (p.Ala360Thr) rs1802959
NM_000295.4(SERPINA1):c.1177C>T (p.Pro393Ser) rs61761869
NM_000296.3(PKD1):c.2180T>C (p.Leu727Pro)
NM_000297.3(PKD2):c.1094+3_1094+6delAAGT rs1553925470
NM_000301.3(PLG):c.1858G>A (p.Ala620Thr) rs121918027
NM_000302.3(PLOD1):c.2032G>A (p.Gly678Arg) rs121913551
NM_000303.2(PMM2):c.317A>T (p.Tyr106Phe) rs387906824
NM_000303.2(PMM2):c.368G>A (p.Arg123Gln) rs141498002
NM_000304.3(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.3(PMP22):c.448G>T (p.Gly150Cys) rs104894624
NM_000304.4(PMP22):c.469C>T (p.Arg157Trp) rs28936682
NM_000307.4(POU3F4):c.845G>T (p.Arg282Leu) rs1060499806
NM_000311.4(PRNP):c.623G>A (p.Arg208His) rs74315412
NM_000311.4(PRNP):c.695T>G (p.Met232Arg) rs74315409
NM_000312.3(PROC):c.565C>T (p.Arg189Trp) rs146922325
NM_000312.3(PROC):c.577_579delAAG (p.Lys193del) rs199469469
NM_000312.3(PROC):c.629C>T (p.Pro210Leu) rs121918145
NM_000313.3(PROS1):c.1501T>C (p.Ser501Pro) rs121918472
NM_000314.4(PTEN):c.-764G>A rs587776674
NM_000314.4(PTEN):c.493G>A (p.Gly165Arg) rs587782603
NM_000314.6(PTEN):c.284C>T (p.Pro95Leu) rs786204856
NM_000314.6(PTEN):c.320A>T (p.Asp107Val) rs786204858
NM_000314.6(PTEN):c.464A>G (p.Tyr155Cys) rs1060500126
NM_000314.6(PTEN):c.470A>G (p.Glu157Gly) rs1085308051
NM_000314.6(PTEN):c.521A>G (p.Tyr174Cys) rs864622341
NM_000314.6(PTEN):c.634+5G>C rs138336847
NM_000314.6(PTEN):c.635-3C>G rs1085308056
NM_000314.7(PTEN):c.1027-1G>A rs1057517809
NM_000314.7(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.7(PTEN):c.278A>G (p.His93Arg) rs121909238
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000314.7(PTEN):c.722T>C (p.Phe241Ser) rs121909240
NM_000314.7(PTEN):c.79+7A>G rs374331677
NM_000316.3(PTH1R):c.103G>A (p.Glu35Lys)
NM_000317.2(PTS):c.155A>G (p.Asn52Ser) rs104894275
NM_000317.2(PTS):c.347A>G (p.Asp116Gly) rs104894279
NM_000317.2(PTS):c.46C>T (p.Arg16Cys) rs104894274
NM_000321.2(RB1):c.1472T>C (p.Leu491Pro) rs587778848
NM_000321.2(RB1):c.2325+5G>A rs886042249
NM_000321.2(RB1):c.78_80delGCC (p.Pro29del) rs587778823
NM_000334.4(SCN4A):c.2095G>A (p.Ala699Thr) rs1057518865
NM_000334.4(SCN4A):c.3205G>A (p.Asp1069Asn) rs373150395
NM_000334.4(SCN4A):c.3386G>A (p.Arg1129Gln) rs527236149
NM_000334.4(SCN4A):c.3424C>T (p.Arg1142Ter) rs912001256
NM_000335.4(SCN5A):c.1282G>A (p.Glu428Lys) rs199473111
NM_000335.4(SCN5A):c.1844G>A (p.Gly615Glu) rs12720452
NM_000335.4(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.4(SCN5A):c.3908C>T (p.Thr1303Met) rs199473603
NM_000335.4(SCN5A):c.4531C>T (p.Arg1511Trp) rs137854602
NM_000335.4(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.4(SCN5A):c.5474G>A (p.Arg1825His) rs137854610
NM_000335.4(SCN5A):c.5504T>C (p.Ile1835Thr) rs45563942
NM_000335.4(SCN5A):c.5690G>A (p.Arg1897His) rs370694515
NM_000335.4(SCN5A):c.5708C>T (p.Ser1903Leu) rs150264233
NM_000335.4(SCN5A):c.5958C>A (p.Asn1986Lys) rs199473335
NM_000335.4(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000335.4(SCN5A):c.673C>T (p.Arg225Trp) rs199473072
NM_000336.2(SCNN1B):c.109G>A (p.Gly37Ser) rs137852706
NM_000336.2(SCNN1B):c.245C>G (p.Ser82Cys) rs35731153
NM_000336.2(SCNN1B):c.880G>A (p.Gly294Ser) rs72654338
NM_000337.5(SGCD):c.4-1G>A rs1554094927
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000339.2(SLC12A3):c.1928C>T (p.Pro643Leu) rs140012781
NM_000339.2(SLC12A3):c.1964G>A (p.Arg655His) rs121909380
NM_000339.2(SLC12A3):c.2221G>A (p.Gly741Arg) rs138977195
NM_000339.2(SLC12A3):c.2573T>A (p.Leu858His) rs185927948
NM_000340.1(SLC2A2):c.589G>A (p.Val197Ile) rs121909741
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.3(SLC4A1):c.2573C>A (p.Ala858Asp) rs121912751
NM_000344.3(SMN1):c.419A>T (p.Asp140Val) rs1554081968
NM_000344.3(SMN1):c.821C>T (p.Thr274Ile) rs1554066666
NM_000344.3(SMN1):c.835-3C>T rs772466166
NM_000345.3(SNCA):c.150T>G (p.His50Gln) rs201106962
NM_000346.3(SOX9):c.507C>G (p.His169Gln) rs2229989
NM_000348.3(SRD5A2):c.586G>A (p.Gly196Ser) rs121434250
NM_000349.2(STAR):c.466-11T>A rs1053284504
NM_000350.2(ABCA4):c.1622T>C (p.Leu541Pro) rs61751392
NM_000350.2(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.3385C>T (p.Arg1129Cys) rs779426136
NM_000350.2(ABCA4):c.4610C>T (p.Thr1537Met) rs62642575
NM_000350.2(ABCA4):c.4685T>C (p.Ile1562Thr) rs1762111
NM_000350.2(ABCA4):c.4919G>A (p.Arg1640Gln) rs61751403
NM_000350.2(ABCA4):c.5056G>A (p.Val1686Met) rs61753019
NM_000350.2(ABCA4):c.5338C>G (p.Pro1780Ala) rs121909207
NM_000350.2(ABCA4):c.5693G>A (p.Arg1898His) rs1800552
NM_000350.2(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.2(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.2(ABCA4):c.6286G>A (p.Glu2096Lys) rs61750646
NM_000350.2(ABCA4):c.6320G>A (p.Arg2107His) rs62642564
NM_000350.2(ABCA4):c.6729+5_6729+19delGTTGGCCCTGGGGCA rs749526785
NM_000352.4(ABCC8):c.2992C>T (p.Arg998Ter) rs769518471
NM_000352.4(ABCC8):c.4132G>C (p.Gly1378Arg) rs925231098
NM_000352.4(ABCC8):c.4376T>G (p.Leu1459Arg) rs971604271
NM_000354.5(SERPINA7):c.631G>A (p.Ala211Thr) rs2234036
NM_000355.3(TCN2):c.497_498del (p.Leu166Profs) rs778381859
NM_000355.3(TCN2):c.562C>T (p.Gln188Ter) rs1456983114
NM_000359.2(TGM1):c.1075G>A (p.Val359Met) rs202037016
NM_000359.2(TGM1):c.1469A>G (p.Asp490Gly) rs121918724
NM_000359.2(TGM1):c.281G>A (p.Gly94Asp) rs121918729
NM_000359.2(TGM1):c.376C>T (p.Arg126Cys) rs397514524
NM_000363.4(TNNI3):c.484C>T (p.Arg162Trp) rs368861241
NM_000363.4(TNNI3):c.497C>T (p.Ser166Phe) rs727504242
NM_000363.4(TNNI3):c.610C>T (p.Arg204Cys) rs727504243
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000364.3(TNNT2):c.853C>T (p.Arg285Cys) rs121964857
NM_000368.4(TSC1):c.610C>T (p.Arg204Cys) rs1060505021
NM_000368.4(TSC1):c.64C>T (p.Arg22Trp) rs749030456
NM_000370.3(TTPA):c.175C>T (p.Arg59Trp) rs397515522
NM_000370.3(TTPA):c.358G>A (p.Ala120Thr) rs143010236
NM_000370.3(TTPA):c.661C>T (p.Arg221Trp) rs35916840
NM_000371.3(TTR):c.130C>T (p.Pro44Ser) rs11541790
NM_000371.3(TTR):c.190T>C (p.Phe64Leu) rs138065384
NM_000371.3(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000372.4(TYR):c.1064C>T (p.Ala355Val) rs151206295
NM_000372.4(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000375.2(UROS):c.244G>T (p.Val82Phe) rs121908016
NM_000380.3(XPA):c.323G>T (p.Cys108Phe) rs104894131
NM_000384.2(APOB):c.10579C>T (p.Arg3527Trp) rs144467873
NM_000384.2(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.2(APOB):c.10672C>T (p.Arg3558Cys) rs12713559
NM_000384.2(APOB):c.10700C>T (p.Thr3567Met) rs368278927
NM_000384.2(APOB):c.10708C>T (p.His3570Tyr) rs201736972
NM_000384.2(APOB):c.10780T>C (p.Trp3594Arg) rs61744288
NM_000384.2(APOB):c.13028_13029delAT (p.Tyr4343Cysfs) rs760832994
NM_000384.2(APOB):c.3337G>C (p.Asp1113His) rs12713844
NM_000384.2(APOB):c.9175C>T (p.Arg3059Cys) rs146377316
NM_000388.3(CASR):c.1394G>A (p.Arg465Gln) rs104893716
NM_000388.3(CASR):c.1745G>A (p.Cys582Tyr) rs104893690
NM_000388.3(CASR):c.2405A>G (p.Asn802Ser) rs140022350
NM_000388.3(CASR):c.2641T>C (p.Phe881Leu) rs104893704
NM_000388.3(CASR):c.2915C>T (p.Thr972Met) rs200620134
NM_000388.3(CASR):c.848T>C (p.Ile283Thr) rs142745096
NM_000391.3(TPP1):c.1016G>A (p.Arg339Gln) rs765380155
NM_000391.3(TPP1):c.887-10A>G rs755445790
NM_000392.3(ABCC2):c.2362_2363delCT (p.Leu788Valfs) rs772673105
NM_000392.5(ABCC2):c.1325G>A (p.Trp442Ter)
NM_000392.5(ABCC2):c.2273G>T (p.Gly758Val) rs786205465
NM_000393.3(COL5A2):c.2627G>A (p.Gly876Glu) rs886039694
NM_000397.3(CYBB):c.389G>C (p.Arg130Pro) rs193922448
NM_000400.3(ERCC2):c.776G>A (p.Cys259Tyr) rs370454709
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000404.2(GLB1):c.75+1G>C rs398123358
NM_000404.3(GLB1):c.1223A>C (p.Gln408Pro) rs72555369
NM_000404.3(GLB1):c.1444C>T (p.Arg482Cys) rs72555365
NM_000404.3(GLB1):c.145C>T (p.Arg49Cys) rs72555358
NM_000404.3(GLB1):c.1769G>A (p.Arg590His) rs398123351
NM_000404.3(GLB1):c.1772A>G (p.Tyr591Cys) rs72555371
NM_000404.3(GLB1):c.203G>A (p.Arg68Gln) rs572237881
NM_000404.3(GLB1):c.446C>T (p.Ser149Phe) rs778700089
NM_000409.4(GUCA1A):c.149C>T (p.Pro50Leu) rs104893968
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000414.3(HSD17B4):c.101C>T (p.Ala34Val) rs587777442
NM_000414.3(HSD17B4):c.1538C>T (p.Pro513Leu) rs587777444
NM_000414.3(HSD17B4):c.1628G>C (p.Arg543Pro) rs201009485
NM_000426.3(LAMA2):c.1467+1G>A rs1554234161
NM_000426.3(LAMA2):c.1580G>A (p.Cys527Tyr) rs121913574
NM_000426.3(LAMA2):c.2049_2050delAG rs202247790
NM_000426.3(LAMA2):c.2584T>C (p.Cys862Arg) rs121913573
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.7888C>T (p.Arg2630Ter) rs727502851
NM_000426.3(LAMA2):c.8244+3_8244+6delAAGT rs746678525
NM_000426.3(LAMA2):c.9253C>T rs121913571
NM_000429.2(MAT1A):c.964A>T (p.Ile322Phe) rs1057517759
NM_000432.3(MYL2):c.141C>A (p.Asn47Lys) rs199474808
NM_000432.3(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.3(MYL2):c.484G>A (p.Gly162Arg) rs199474814
NM_000435.2(NOTCH3):c.1426A>T (p.Ser476Cys) rs886054260
NM_000435.2(NOTCH3):c.3691C>T (p.Arg1231Cys) rs201680145
NM_000435.2(NOTCH3):c.451C>G (p.Gln151Glu) rs371491165
NM_000441.1(SLC26A4):c.-103T>C rs60284988
NM_000441.1(SLC26A4):c.349C>T rs145254330
NM_000441.1(SLC26A4):c.554G>C (p.Arg185Thr) rs542620119
NM_000443.3(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636
NM_000443.3(ABCB4):c.959C>T (p.Ser320Phe) rs72552778
NM_000444.5(PHEX):c.1586+3_1586+6delGAGT rs886042234
NM_000445.4(PLEC):c.2677_2685delCAGGAGGCC (p.Gln893_Ala895del) rs786205252
NM_000447.2(PSEN2):c.1316A>C (p.Asp439Ala) rs63750110
NM_000447.2(PSEN2):c.389C>T (p.Ser130Leu) rs63750197
NM_000449.3(RFX5):c.446G>A (p.Arg149Gln) rs137853099
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000455.4(STK11):c.542A>G (p.Asn181Ser) rs886037859
NM_000455.4(STK11):c.841_842delCC (p.Pro281Alafs) rs121913321
NM_000456.2(SUOX):c.228G>T (p.Arg76Ser) rs202085145
NM_000457.4(HNF4A):c.998G>A (p.Arg333His) rs1375557127
NM_000461.4(THRB):c.1029T>G (p.Asn343Lys) rs1354053223
NM_000463.2(UGT1A1):c.1084G>A (p.Gly362Ser) rs755218546
NM_000463.2(UGT1A1):c.1198A>G (p.Asn400Asp) rs28934877
NM_000465.3(BARD1):c.2148_2149delCA (p.Ile717Glnfs) rs786203811
NM_000465.3(BARD1):c.2300_2301delTG (p.Val767Aspfs) rs750413473
NM_000465.3(BARD1):c.55G>T (p.Glu19Ter) rs752514155
NM_000466.2(PEX1):c.2114T>G (p.Leu705Trp) rs863225084
NM_000466.2(PEX1):c.2966T>C (p.Ile989Thr) rs61750427
NM_000475.4(NR0B1):c.1142T>C (p.Leu381Pro) rs104894899
NM_000478.4(ALPL):c.529G>A (p.Ala177Thr) rs199669988
NM_000478.5(ALPL):c.485G>T (p.Gly162Val) rs121918012
NM_000478.5(ALPL):c.746G>T (p.Gly249Val) rs121918018
NM_000481.3(AMT):c.139G>A (p.Gly47Arg) rs121964982
NM_000481.3(AMT):c.350C>T (p.Ser117Leu) rs769468125
NM_000481.3(AMT):c.887G>A (p.Arg296His) rs386833690
NM_000481.3(AMT):c.958C>T (p.Arg320Cys) rs866625610
NM_000484.3(APP):c.1995G>C (p.Glu665Asp) rs63750363
NM_000484.3(APP):c.2137G>A (p.Ala713Thr) rs63750066
NM_000487.5(ARSA):c.*96A>G rs6151429
NM_000487.5(ARSA):c.1115G>A (p.Arg372Gln) rs74315477
NM_000487.5(ARSA):c.1174C>T (p.Arg392Trp) rs74315480
NM_000487.5(ARSA):c.370G>A (p.Gly124Ser) rs74315461
NM_000487.5(ARSA):c.413C>T (p.Pro138Leu) rs74315462
NM_000487.5(ARSA):c.511G>A (p.Asp171Asn) rs74315466
NM_000487.5(ARSA):c.674A>G (p.Tyr225Cys) rs527640350
NM_000487.5(ARSA):c.677C>T (p.Ala226Val) rs74315468
NM_000487.5(ARSA):c.917C>T (p.Thr306Met) rs199476359
NM_000487.5(ARSA):c.931G>A (p.Gly311Ser) rs74315459
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.1256C>T (p.Ala419Val) rs121909568
NM_000488.3(SERPINC1):c.218C>T (p.Pro73Leu) rs121909551
NM_000488.3(SERPINC1):c.236G>A (p.Arg79His) rs121909552
NM_000488.3(SERPINC1):c.482G>A (p.Arg161Gln) rs121909563
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1052C>G (p.Thr351Ser) rs1800086
NM_000492.3(CFTR):c.1054C>T (p.Arg352Trp) rs193922497
NM_000492.3(CFTR):c.1210-11T>G rs73715573
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.3(CFTR):c.14C>T (p.Pro5Leu) rs193922501
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1601C>A (p.Ala534Glu) rs387906368
NM_000492.3(CFTR):c.164+2dup rs1554375870
NM_000492.3(CFTR):c.1658G>A (p.Arg553Gln) rs121909044
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.1766G>A (p.Ser589Asn) rs397508300
NM_000492.3(CFTR):c.1841A>G (p.Asp614Gly) rs201124247
NM_000492.3(CFTR):c.1853T>C (p.Ile618Thr) rs139468767
NM_000492.3(CFTR):c.220C>T (p.Arg74Trp) rs115545701
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.2657+2_2657+3insA rs397508414
NM_000492.3(CFTR):c.2813T>G (p.Val938Gly) rs193922511
NM_000492.3(CFTR):c.2856G>C (p.Met952Ile) rs151048781
NM_000492.3(CFTR):c.2900T>C (p.Leu967Ser) rs1800110
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.3(CFTR):c.305T>G (p.Leu102Arg) rs397508490
NM_000492.3(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.3(CFTR):c.3199G>A (p.Ala1067Thr) rs121909020
NM_000492.3(CFTR):c.3205G>A (p.Gly1069Arg) rs200321110
NM_000492.3(CFTR):c.3208C>T (p.Arg1070Trp) rs202179988
NM_000492.3(CFTR):c.3209G>A (p.Arg1070Gln) rs78769542
NM_000492.3(CFTR):c.330C>A (p.Asp110Glu) rs397508537
NM_000492.3(CFTR):c.3468G>A (p.Leu1156=) rs139729994
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3717+40A>G rs397508595
NM_000492.3(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.3(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.38C>T (p.Ser13Phe) rs397508635
NM_000492.3(CFTR):c.4004T>C (p.Leu1335Pro) rs397508658
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.410T>C (p.Leu137Pro)
NM_000492.3(CFTR):c.4357C>T (p.Arg1453Trp) rs4148725
NM_000492.3(CFTR):c.443T>A (p.Ile148Asn) rs35516286
NM_000492.3(CFTR):c.509G>A (p.Arg170His) rs1800079
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.3(CFTR):c.772A>G (p.Arg258Gly) rs191456345
NM_000492.3(CFTR):c.941G>A (p.Gly314Glu) rs75763344
NM_000495.4(COL4A5):c.1032+5G>T rs104886315
NM_000503.5(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000505.3(F12):c.158A>G (p.Tyr53Cys) rs118204455
NM_000506.4(F2):c.1787G>T (p.Arg596Leu) rs387907201
NM_000512.4(GALNS):c.953T>G (p.Met318Arg) rs746756997
NM_000516.5(GNAS):c.772C>T (p.Arg258Trp) rs137854535
NM_000518.4(HBB):c.-82C>T rs34500389
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.374C>A (p.Pro125Gln) rs33983276
NM_000518.5(HBB):c.-142C>T rs34883338
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.315G>C (p.Arg105Ser) rs33914944
NM_000518.5(HBB):c.316-7C>G rs34483965
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000520.5(HEXA):c.1351C>G (p.Leu451Val) rs28940871
NM_000520.5(HEXA):c.1453T>C (p.Trp485Arg) rs121907968
NM_000520.5(HEXA):c.1496G>A (p.Arg499His) rs121907956
NM_000520.5(HEXA):c.590A>C (p.Lys197Thr) rs121907973
NM_000520.5(HEXA):c.611A>G (p.His204Arg) rs121907976
NM_000520.5(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.5(HEXA):c.748G>A (p.Gly250Ser) rs1057521137
NM_000520.5(HEXA):c.806-7G>A rs770932296
NM_000521.3(HEXB):c.1367A>C (p.Tyr456Ser) rs121907982
NM_000521.3(HEXB):c.1509-26G>A rs201580118
NM_000523.3(HOXD13):c.32G>C (p.Gly11Ala) rs536639583
NM_000523.3(HOXD13):c.820C>T (p.Arg274Ter) rs200750564
NM_000527.4(LDLR):c.-187_-185del rs1270618112
NM_000527.4(LDLR):c.-188C>T rs878854023
NM_000527.4(LDLR):c.1003G>A (p.Gly335Ser) rs544453230
NM_000527.4(LDLR):c.1024G>A (p.Asp342Asn) rs139361635
NM_000527.4(LDLR):c.1027G>A (p.Gly343Ser) rs730882096
NM_000527.4(LDLR):c.1045C>T (p.Gln349Ter) rs748300548
NM_000527.4(LDLR):c.1049G>C (p.Arg350Pro) rs875989914
NM_000527.4(LDLR):c.1057G>A (p.Glu353Lys) rs370471092
NM_000527.4(LDLR):c.1066G>A (p.Asp356Asn) rs767767730
NM_000527.4(LDLR):c.1066G>T (p.Asp356Tyr) rs767767730
NM_000527.4(LDLR):c.1069G>A (p.Glu357Lys) rs879254781
NM_000527.4(LDLR):c.1090T>C (p.Cys364Arg) rs879254787
NM_000527.4(LDLR):c.1103G>A (p.Cys368Tyr) rs768430352
NM_000527.4(LDLR):c.1133A>C (p.Gln378Pro) rs730882098
NM_000527.4(LDLR):c.1156G>T (p.Asp386Tyr) rs1402951356
NM_000527.4(LDLR):c.1166C>T (p.Thr389Met) rs149227308
NM_000527.4(LDLR):c.1175G>A (p.Cys392Tyr) rs1060500986
NM_000527.4(LDLR):c.1186+5G>A rs879254821
NM_000527.4(LDLR):c.1186+5G>C rs879254821
NM_000527.4(LDLR):c.1199_1207delACCTCTTCT (p.Tyr400_Phe402del) rs879254826
NM_000527.4(LDLR):c.1201C>G (p.Leu401Val) rs146200173
NM_000527.4(LDLR):c.1217G>A (p.Arg406Gln) rs552422789
NM_000527.4(LDLR):c.1238C>T (p.Thr413Met) rs368562025
NM_000527.4(LDLR):c.1284C>G (p.Asn428Lys) rs368708058
NM_000527.4(LDLR):c.1285G>C (p.Val429Leu) rs28942078
NM_000527.4(LDLR):c.1294C>G (p.Leu432Val) rs730882100
NM_000527.4(LDLR):c.1301C>G (p.Thr434Arg) rs745343524
NM_000527.4(LDLR):c.1307T>C (p.Val436Ala) rs779732323
NM_000527.4(LDLR):c.1328G>C (p.Trp443Ser) rs879254866
NM_000527.4(LDLR):c.1359-31_1359-23delinsCGGCT rs879254876
NM_000527.4(LDLR):c.1359-5C>G rs531005522
NM_000527.4(LDLR):c.1367T>C (p.Leu456Pro) rs200143634
NM_000527.4(LDLR):c.1393T>A (p.Tyr465Asn) rs730882101
NM_000527.4(LDLR):c.1394A>G (p.Tyr465Cys) rs879254889
NM_000527.4(LDLR):c.139G>A (p.Asp47Asn) rs778284147
NM_000527.4(LDLR):c.1429G>A (p.Asp477Asn) rs780316072
NM_000527.4(LDLR):c.1432G>A (p.Gly478Arg) rs144614838
NM_000527.4(LDLR):c.1444G>A (p.Asp482Asn) rs139624145
NM_000527.4(LDLR):c.1449G>C (p.Trp483Cys) rs879254907
NM_000527.4(LDLR):c.1449G>T (p.Trp483Cys) rs879254907
NM_000527.4(LDLR):c.1463T>C (p.Ile488Thr) rs879254913
NM_000527.4(LDLR):c.1468T>C (p.Trp490Arg) rs730880130
NM_000527.4(LDLR):c.1474G>A (p.Asp492Asn) rs373646964
NM_000527.4(LDLR):c.1474G>C (p.Asp492His) rs373646964
NM_000527.4(LDLR):c.1504G>T (p.Asp502Tyr) rs879254925
NM_000527.4(LDLR):c.1510A>G (p.Lys504Glu) rs730882103
NM_000527.4(LDLR):c.1516G>A (p.Val506Met) rs373848925
NM_000527.4(LDLR):c.1549T>C (p.Ser517Pro) rs879254936
NM_000527.4(LDLR):c.1576C>T (p.Pro526Ser) rs730882106
NM_000527.4(LDLR):c.1586+5G>A rs781362878
NM_000527.4(LDLR):c.1588T>G (p.Phe530Val) rs875989924
NM_000527.4(LDLR):c.1598G>A (p.Trp533Ter) rs746939188
NM_000527.4(LDLR):c.1618G>T (p.Ala540Ser) rs769370816
NM_000527.4(LDLR):c.1658A>G (p.Tyr553Cys) rs879254974
NM_000527.4(LDLR):c.1658_1660delACT (p.Tyr553del) rs1555806019
NM_000527.4(LDLR):c.1690A>C (p.Asn564His) rs397509365
NM_000527.4(LDLR):c.1720C>T (p.Arg574Cys) rs185098634
NM_000527.4(LDLR):c.1731G>T (p.Trp577Cys) rs875989928
NM_000527.4(LDLR):c.1761C>G (p.Ser587Arg) rs753430282
NM_000527.4(LDLR):c.1765G>A (p.Asp589Asn) rs201971888
NM_000527.4(LDLR):c.1783C>T (p.Arg595Trp) rs373371572
NM_000527.4(LDLR):c.1784G>A (p.Arg595Gln) rs201102492
NM_000527.4(LDLR):c.1793T>A (p.Ile598Asn) rs879255024
NM_000527.4(LDLR):c.1796T>C (p.Leu599Ser) rs879255025
NM_000527.4(LDLR):c.1836C>A (p.Ala612=) rs143872778
NM_000527.4(LDLR):c.1837G>A (p.Val613Ile) rs148181903
NM_000527.4(LDLR):c.1845+15C>A rs759867686
NM_000527.4(LDLR):c.1855T>C (p.Phe619Leu) rs747134711
NM_000527.4(LDLR):c.185C>T (p.Thr62Met) rs376207800
NM_000527.4(LDLR):c.1867A>G (p.Ile623Val) rs555292896
NM_000527.4(LDLR):c.1876G>A (p.Glu626Lys) rs139791325
NM_000527.4(LDLR):c.1898G>A (p.Arg633His) rs754536745
NM_000527.4(LDLR):c.190+4A>T rs769446356
NM_000527.4(LDLR):c.1916T>A (p.Val639Asp) rs794728584
NM_000527.4(LDLR):c.1946C>T (p.Pro649Leu) rs879255081
NM_000527.4(LDLR):c.1955T>C (p.Met652Thr) rs875989936
NM_000527.4(LDLR):c.2026G>A (p.Gly676Ser) rs745753810
NM_000527.4(LDLR):c.2068C>G (p.His690Asp) rs757009067
NM_000527.4(LDLR):c.2096C>T (p.Pro699Leu) rs201573863
NM_000527.4(LDLR):c.2099A>G (p.Asp700Gly) rs879255139
NM_000527.4(LDLR):c.2101G>A (p.Gly701Ser) rs368838866
NM_000527.4(LDLR):c.2106G>A (p.Met702Ile) rs140731590
NM_000527.4(LDLR):c.2113G>C (p.Ala705Pro) rs193922570
NM_000527.4(LDLR):c.2206G>A (p.Val736Ile) rs547268730
NM_000527.4(LDLR):c.2215C>T (p.Gln739Ter) rs370018159
NM_000527.4(LDLR):c.2242G>A (p.Asp748Asn) rs150104358
NM_000527.4(LDLR):c.2252G>A (p.Arg751Gln) rs200142970
NM_000527.4(LDLR):c.2282C>T (p.Thr761Met) rs138477254
NM_000527.4(LDLR):c.2297C>T (p.Thr766Ile) rs879255173
NM_000527.4(LDLR):c.232C>T (p.Arg78Cys) rs370860696
NM_000527.4(LDLR):c.2389G>A (p.Val797Met) rs750518671
NM_000527.4(LDLR):c.2389G>T (p.Val797Leu) rs750518671
NM_000527.4(LDLR):c.2397_2405delCGTCTTCCT (p.Val800_Leu802del) rs875989944
NM_000527.4(LDLR):c.2397_2412del16 (p.Val800Glyfs) rs879255197
NM_000527.4(LDLR):c.2407_2424dup (p.Leu808_Leu809insCysLeuGlyValPheLeu) rs879255201
NM_000527.4(LDLR):c.2411T>C (p.Leu804Pro) rs879255203
NM_000527.4(LDLR):c.2416dupG (p.Val806Glyfs) rs773618064
NM_000527.4(LDLR):c.241C>T (p.Arg81Cys) rs730882078
NM_000527.4(LDLR):c.2441G>A (p.Arg814Gln) rs5928
NM_000527.4(LDLR):c.2448G>C (p.Lys816Asn) rs1399689294
NM_000527.4(LDLR):c.2506G>A (p.Val836Ile) rs879255220
NM_000527.4(LDLR):c.274C>G (p.Gln92Glu) rs774467219
NM_000527.4(LDLR):c.283T>G (p.Cys95Gly) rs879254456
NM_000527.4(LDLR):c.314-3C>T rs879254469
NM_000527.4(LDLR):c.337G>A (p.Glu113Lys) rs769383881
NM_000527.4(LDLR):c.343C>T (p.Arg115Cys) rs774723292
NM_000527.4(LDLR):c.344G>A (p.Arg115His) rs201102461
NM_000527.4(LDLR):c.352G>T (p.Asp118Tyr) rs730882080
NM_000527.4(LDLR):c.451G>C (p.Ala151Pro) rs763233960
NM_000527.4(LDLR):c.508G>A (p.Asp170Asn) rs139089530
NM_000527.4(LDLR):c.542C>G (p.Pro181Arg) rs557344672
NM_000527.4(LDLR):c.551G>C (p.Cys184Ser) rs121908039
NM_000527.4(LDLR):c.58G>A (p.Gly20Arg) rs147509697
NM_000527.4(LDLR):c.631C>G (p.His211Asp) rs771917370
NM_000527.4(LDLR):c.631C>T (p.His211Tyr) rs771917370
NM_000527.4(LDLR):c.664T>C (p.Cys222Arg) rs577934998
NM_000527.4(LDLR):c.718G>A (p.Glu240Lys) rs768563000
NM_000527.4(LDLR):c.757C>T (p.Arg253Trp) rs150673992
NM_000527.4(LDLR):c.769C>T (p.Arg257Trp) rs200990725
NM_000527.4(LDLR):c.798T>A (p.Asp266Glu) rs139043155
NM_000527.4(LDLR):c.799G>A (p.Glu267Lys) rs879254679
NM_000527.4(LDLR):c.806G>A (p.Gly269Asp) rs143992984
NM_000527.4(LDLR):c.829G>A (p.Glu277Lys) rs148698650
NM_000527.4(LDLR):c.846C>A (p.Phe282Leu) rs730882090
NM_000527.4(LDLR):c.853C>T (p.His285Tyr) rs730882091
NM_000527.4(LDLR):c.859G>A (p.Gly287Ser) rs375495026
NM_000527.4(LDLR):c.862G>A (p.Glu288Lys) rs368657165
NM_000527.4(LDLR):c.889A>C (p.Asn297His) rs879254709
NM_000527.4(LDLR):c.898A>G (p.Arg300Gly) rs767618089
NM_000527.4(LDLR):c.907C>T (p.Arg303Trp) rs151207122
NM_000527.4(LDLR):c.914G>C (p.Trp305Ser) rs879254717
NM_000527.4(LDLR):c.91G>A (p.Glu31Lys) rs776421777
NM_000527.4(LDLR):c.932A>G (p.Lys311Arg) rs761765254
NM_000527.4(LDLR):c.937T>C (p.Cys313Arg) rs879254728
NM_000527.4(LDLR):c.941-12G>A rs879254734
NM_000527.4(LDLR):c.970G>A (p.Gly324Ser) rs72658860
NM_000527.4(LDLR):c.979C>T (p.His327Tyr) rs747507019
NM_000528.3(MAN2B1):c.1067C>G (p.Pro356Arg) rs121434333
NM_000528.3(MAN2B1):c.215A>T (p.His72Leu) rs387906261
NM_000528.3(MAN2B1):c.2248C>T (p.Arg750Trp) rs80338680
NM_000528.3(MAN2B1):c.2398G>C (p.Gly800Arg) rs398123456
NM_000528.3(MAN2B1):c.2426T>C (p.Leu809Pro) rs80338681
NM_000530.6(MPZ):c.337G>T (p.Val113Phe) rs281865126
NM_000530.7(MPZ):c.103G>T (p.Asp35Tyr) rs121913596
NM_000530.7(MPZ):c.389A>G (p.Lys130Arg) rs281865127
NM_000531.5(OTC):c.140A>C (p.Asn47Thr) rs67939655
NM_000531.5(OTC):c.292G>A (p.Glu98Lys) rs72554347
NM_000531.5(OTC):c.298+5G>C rs72554348
NM_000531.5(OTC):c.374C>T (p.Thr125Met) rs72554356
NM_000531.5(OTC):c.572T>G (p.Leu191Arg) rs72556297
NM_000531.5(OTC):c.817_819delGAG (p.Glu273del) rs72558452
NM_000532.4(PCCB):c.183+5G>A rs879253813
NM_000533.4(PLP1):c.409C>T (p.Arg137Trp) rs132630295
NM_000535.5(PMS2):c.2186_2187delTC (p.Leu729Glnfs) rs587779335
NM_000535.5(PMS2):c.2192_2196delTAACT (p.Leu731Cysfs) rs63750695
NM_000535.5(PMS2):c.2521delT (p.Trp841Glyfs) rs886039646
NM_000535.6(PMS2):c.1237_1239del (p.Lys413del) rs267608159
NM_000535.6(PMS2):c.137G>A (p.Ser46Asn) rs121434629
NM_000535.6(PMS2):c.2113G>A (p.Glu705Lys) rs267608161
NM_000536.3(RAG2):c.1352G>C (p.Gly451Ala) rs121918575
NM_000536.3(RAG2):c.1433G>A (p.Cys478Tyr) rs121918573
NM_000536.3(RAG2):c.644C>T (p.Thr215Ile) rs35691292
NM_000536.3(RAG2):c.686G>A (p.Arg229Gln) rs121917894
NM_000540.2(RYR1):c.10204T>G (p.Cys3402Gly) rs367543058
NM_000540.2(RYR1):c.11315G>A (p.Arg3772Gln) rs193922839
NM_000540.2(RYR1):c.13673G>A (p.Arg4558Gln) rs118192130
NM_000540.2(RYR1):c.13910C>T (p.Thr4637Ile) rs118192134
NM_000540.2(RYR1):c.13934G>A (p.Arg4645Gln) rs193922860
NM_000540.2(RYR1):c.14378T>C (p.Leu4793Pro) rs118192179
NM_000540.2(RYR1):c.14416A>G (p.Asn4806Asp) rs886039586
NM_000540.2(RYR1):c.14471T>C (p.Leu4824Pro) rs193922874
NM_000540.2(RYR1):c.14524G>A rs193922879
NM_000540.2(RYR1):c.14555A>G (p.Tyr4852Cys) rs886042826
NM_000540.2(RYR1):c.14645C>T rs193922884
NM_000540.2(RYR1):c.14717C>T (p.Ala4906Val) rs118192153
NM_000540.2(RYR1):c.14814C>G (p.Ile4938Met) rs118192159
NM_000540.2(RYR1):c.14928C>G (p.Phe4976Leu) rs368874586
NM_000540.2(RYR1):c.1589G>A (p.Arg530His) rs111888148
NM_000540.2(RYR1):c.212C>A (p.Ser71Tyr) rs118192113
NM_000540.2(RYR1):c.4729G>A (p.Ala1577Thr) rs118192120
NM_000540.2(RYR1):c.97A>G (p.Lys33Glu) rs193922746
NM_000543.4(SMPD1):c.1556A>G (p.Tyr519Cys) rs371837210
NM_000545.6(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000546.5(TP53):c.1040C>A (p.Ala347Asp) rs397516434
NM_000546.5(TP53):c.358A>G (p.Lys120Glu) rs121912658
NM_000546.5(TP53):c.427G>A (p.Val143Met) rs587782620
NM_000546.5(TP53):c.530C>G (p.Pro177Arg) rs751477326
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.646G>A (p.Val216Met) rs730882025
NM_000546.5(TP53):c.700T>C (p.Tyr234His) rs864622237
NM_000546.5(TP53):c.706T>C (p.Tyr236His) rs587782289
NM_000546.5(TP53):c.713G>A (p.Cys238Tyr) rs730882005
NM_000546.5(TP53):c.746G>T (p.Arg249Met) rs587782329
NM_000546.5(TP53):c.747G>T (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.770T>A (p.Leu257Gln) rs28934577
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.826G>C (p.Ala276Pro) rs1131691029
NM_000546.5(TP53):c.832C>T (p.Pro278Ser) rs17849781
NM_000546.5(TP53):c.836G>A (p.Gly279Glu) rs1064793881
NM_000546.5(TP53):c.839G>C (p.Arg280Thr) rs121912660
NM_000546.5(TP53):c.974G>T (p.Gly325Val) rs121912659
NM_000548.4(TSC2):c.1864C>T (p.Arg622Trp) rs397514914
NM_000548.4(TSC2):c.2666C>T (p.Ala889Val) rs137854155
NM_000548.4(TSC2):c.3106T>C (p.Ser1036Pro) rs45517281
NM_000548.4(TSC2):c.4639G>A (p.Val1547Ile) rs745895675
NM_000551.3(VHL):c.188T>C (p.Leu63Pro) rs104893827
NM_000551.3(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.3(VHL):c.376G>A (p.Asp126Asn) rs104893831
NM_000551.3(VHL):c.388G>T (p.Val130Phe) rs104893830
NM_000551.3(VHL):c.407T>G (p.Phe136Cys) rs5030833
NM_000551.3(VHL):c.463+3A>G rs1131690954
NM_000551.3(VHL):c.486C>G (p.Cys162Trp) rs5030622
NM_000551.3(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000551.3(VHL):c.574C>T (p.Pro192Ser) rs28940300
NM_000551.3(VHL):c.598C>T (p.Arg200Trp) rs28940298
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000593.5(TAP1):c.2156G>A (p.Arg719Gln) rs121917702
NM_000617.2(SLC11A2):c.1197G>C (p.Glu399Asp) rs121918365
NM_000639.2(FASLG):c.466A>G (p.Arg156Gly) rs80358238
NM_000642.2(AGL):c.3816_3817delAG (p.Gly1273Asnfs) rs867341758
NM_000642.2(AGL):c.4459C>T (p.Arg1487Ter) rs12118058
NM_000666.2(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000702.3(ATP1A2):c.1244C>T (p.Thr415Met) rs121918618
NM_000702.3(ATP1A2):c.1777C>T (p.Arg593Trp) rs886039530
NM_000702.3(ATP1A2):c.193C>T (p.Arg65Trp) rs121918619
NM_000709.3(BCKDHA):c.288+9C>T rs398123497
NM_000709.3(BCKDHA):c.788_790delTCT (p.Phe263del) rs398123505
NM_000709.3(BCKDHA):c.793C>T (p.Arg265Trp) rs137852873
NM_000719.6(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.6(CACNA1C):c.1553G>A (p.Arg518His) rs1057517711
NM_000719.6(CACNA1C):c.2573G>A (p.Arg858His) rs786205753
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000744.6(CHRNA4):c.1007G>A (p.Arg336His) rs281865068
NM_000747.2(CHRNB1):c.516C>G (p.Tyr172Ter) rs201033437
NM_000747.2(CHRNB1):c.727C>T (p.Arg243Cys) rs199875082
NM_000756.3(CRH):c.89C>G (p.Pro30Arg) rs748404250
NM_000782.4(CYP24A1):c.428_430delAAG (p.Glu143del) rs777676129
NM_000784.3(CYP27A1):c.1183C>A (p.Arg395Ser) rs121908096
NM_000784.3(CYP27A1):c.1184G>A (p.Arg395His) rs587778778
NM_000784.3(CYP27A1):c.1209C>G (p.Asn403Lys) rs587778781
NM_000784.3(CYP27A1):c.1435C>G (p.Arg479Gly) rs72551322
NM_000784.3(CYP27A1):c.409C>T (p.Arg137Trp) rs72551312
NM_000784.3(CYP27A1):c.410G>A (p.Arg137Gln) rs587778818
NM_000784.3(CYP27A1):c.435G>T (p.Gly145=) rs587778796
NM_000789.3(ACE):c.1522C>T (p.Arg508Ter) rs367797185
NM_000806.5(GABRA1):c.335G>A (p.Arg112Gln) rs587777308
NM_000806.5(GABRA1):c.640C>T (p.Arg214Cys) rs727503940
NM_000816.3(GABRG2):c.1336C>T (p.Arg446Trp) rs796052515
NM_000833.4(GRIN2A):c.2441T>C (p.Ile814Thr) rs780654733
NM_000833.4(GRIN2A):c.2927A>G (p.Asn976Ser) rs886039239
NM_000833.4(GRIN2A):c.547T>A (p.Phe183Ile) rs587780353
NM_000834.3(GRIN2B):c.2459G>C (p.Gly820Ala) rs797044849
NM_000834.4(GRIN2B):c.1547A>G (p.Asn516Ser) rs886041295
NM_000834.4(GRIN2B):c.1727_1732delTCTTTG (p.Val576_Phe577del) rs1555111511
NM_000834.4(GRIN2B):c.2002G>A (p.Asp668Asn) rs876661151
NM_000834.4(GRIN2B):c.2087G>A (p.Arg696His) rs1555103971
NM_000891.2(KCNJ2):c.277G>A (p.Val93Ile) rs147750704
NM_000891.2(KCNJ2):c.901A>C (p.Met301Leu) rs786205818
NM_000891.2(KCNJ2):c.901A>G (p.Met301Val) rs786205818
NM_000891.2(KCNJ2):c.935G>A (p.Arg312His) rs786205820
NM_000891.2(KCNJ2):c.953A>G (p.Asn318Ser) rs367560052
NM_000892.3(KLKB1):c.1643G>A (p.Cys548Tyr) rs121964951
NM_000920.3(PC):c.467G>A (p.Arg156Gln) rs119103241
NM_000969.5(RPL5):c.418G>A (p.Gly140Ser) rs121434406
NM_001001430.2(TNNT2):c.251dup (p.Val85Serfs) rs780087395
NM_001001430.2(TNNT2):c.281G>T (p.Arg94Leu) rs397516457
NM_001001430.2(TNNT2):c.416G>A (p.Arg139His) rs397516466
NM_001001430.2(TNNT2):c.430C>T (p.Arg144Trp) rs483352832
NM_001001430.2(TNNT2):c.613C>T (p.Arg205Trp) rs45586240
NM_001001430.2(TNNT2):c.822-2A>C rs111692981
NM_001001430.2(TNNT2):c.833G>C (p.Arg278Pro) rs397516484
NM_001001557.2(GDF6):c.746C>A (p.Ala249Glu) rs121909352
NM_001001557.2(GDF6):c.866T>C (p.Leu289Pro) rs63751220
NM_001001557.4(GDF6):c.1287C>A (p.Ser429Arg) rs1554571225
NM_001002261.3(ZFYVE27):c.572G>T (p.Gly191Val) rs35077384
NM_001004334.3(GPR179):c.984delC (p.Ser329Leufs) rs770066665
NM_001005271.2(CHD3):c.3130C>T (p.Arg1044Trp) rs1555611722
NM_001005741.2(GBA):c.1060G>C (p.Asp354His) rs398123526
NM_001005741.2(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_001005741.2(GBA):c.721G>A (p.Gly241Arg) rs409652
NM_001005741.2(GBA):c.882T>G (p.His294Gln) rs367968666
NM_001005862.2(ERBB2):c.2239G>T (p.Val747Leu) rs121913471
NM_001006657.1(WDR35):c.206G>A (p.Gly69Asp) rs765513105
NM_001006657.1(WDR35):c.3091C>T (p.His1031Tyr) rs1553316264
NM_001006657.1(WDR35):c.3203A>G (p.Tyr1068Cys) rs541910371
NM_001006658.2(CR2):c.2298G>A (p.Trp766Ter) rs151093663
NM_001007468.2(SMARCB1):c.158G>T (p.Arg53Leu) rs779769475
NM_001008211.1(OPTN):c.1634G>A (p.Arg545Gln) rs75654767
NM_001008212.1(OPTN):c.941A>T (p.Gln314Leu) rs142812715
NM_001009994.2(RIPPLY2):c.238A>T (p.Arg80Ter) rs201419367
NM_001009999.2(KDM1A):c.1739A>G (p.Asp580Gly) rs864309716
NM_001010892.2(RSPH4A):c.430C>T (p.Gln144Ter) rs756868889
NM_001012339.3(DNAJC21):c.983+1G>A rs368148362
NM_001017535.1(VDR):c.218G>A (p.Arg73Gln) rs121909791
NM_001018005.1(TPM1):c.240+1G>A rs730881146
NM_001018005.1(TPM1):c.475G>A (p.Asp159Asn) rs397516373
NM_001018005.1(TPM1):c.644C>T (p.Ser215Leu) rs199476316
NM_001018005.1(TPM1):c.842T>C (p.Met281Thr) rs199476321
NM_001018073.2(PCK2):c.577C>T (p.Arg193Ter) rs753706965
NM_001024630.3(RUNX2):c.217delG (p.Ala73Argfs) rs1554384228
NM_001024943.1(ASL):c.280C>T (p.Arg94Cys) rs374304304
NM_001031717.3(CRELD1):c.320G>A (p.Arg107His) rs28941780
NM_001031726.3(C19orf12):c.424A>G (p.Lys142Glu) rs146170087
NM_001032221.3(STXBP1):c.734A>G (p.His245Arg) rs587784453
NM_001033053.2(NLRP1):c.2176C>T (p.Arg726Trp) rs776245016
NM_001035.2(RYR2):c.11814C>A (p.Ser3938Arg) rs794728704
NM_001035.2(RYR2):c.12470G>A (p.Arg4157Gln) rs794728786
NM_001035.2(RYR2):c.1259G>A (p.Arg420Gln) rs794728721
NM_001035.2(RYR2):c.1298T>C (p.Leu433Pro) rs121918602
NM_001035.2(RYR2):c.14711G>A (p.Gly4904Asp) rs886038888
NM_001035.2(RYR2):c.3320C>T (p.Thr1107Met) rs200236750
NM_001037.4(SCN1B):c.457G>A (p.Asp153Asn) rs72550247
NM_001037333.3(CYFIP2):c.259C>T (p.Arg87Cys) rs1131692231
NM_001037811.2(HSD17B10):c.194T>C (p.Val65Ala) rs104886492
NM_001039141.2(TRIOBP):c.5014G>T (p.Gly1672Ter) rs200045032
NM_001039590.2(USP9X):c.7440dupA (p.Ala2481Serfs) rs774054468
NM_001040108.1(MLH3):c.2793_2794delGA (p.Asn932Trpfs) rs754716792
NM_001041.3(SI):c.5110C>T (p.Arg1704Ter) rs779803851
NM_001041.3(SI):c.5234T>G (p.Phe1745Cys) rs79717168
NM_001042472.2(ABHD12):c.557G>C (p.Arg186Pro) rs587777604
NM_001042492.2(NF1):c.1845G>T (p.Lys615Asn) rs1131691080
NM_001042492.2(NF1):c.245C>T (p.Ser82Phe) rs199474729
NM_001042492.2(NF1):c.278G>A (p.Cys93Tyr) rs199474728
NM_001042492.2(NF1):c.4352A>C (p.Asn1451Thr) rs199474754
NM_001063.3(TF):c.956A>G (p.His319Arg) rs41295774
NM_001065.3(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001065.3(TNFRSF1A):c.596T>C (p.Ile199Thr) rs104895247
NM_001077182.2(FSCN2):c.72delG (p.Thr25Glnfs) rs376633374
NM_001077399.2(PNKD):c.20C>T (p.Ala7Val) rs121434512
NM_001077416.2(TMEM231):c.784G>A (p.Asp262Asn) rs200799769
NM_001077494.3(NFKB2):c.2600C>T (p.Ala867Val) rs727502788
NM_001077620.2(PRCD):c.2T>C (p.Met1Thr) rs527236092
NM_001079802.1(FKTN):c.1112A>G (p.Tyr371Cys) rs119464998
NM_001079802.1(FKTN):c.340G>A (p.Ala114Thr) rs119463995
NM_001080114.1(LDB3):c.494C>T (p.Ala165Val) rs121908334
NM_001080116.1(LDB3):c.321+1523C>T rs45487699
NM_001080116.1(LDB3):c.440C>T (p.Ala147Val) rs281865143
NM_001080116.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335
NM_001080414.4(CCDC88C):c.1391G>A (p.Arg464His) rs587782989
NM_001080463.1(DYNC2H1):c.11284A>G (p.Met3762Val) rs137853026
NM_001080463.1(DYNC2H1):c.11747G>A (p.Gly3916Asp) rs201479015
NM_001080463.1(DYNC2H1):c.12431C>G (p.Pro4144Arg) rs761765709
NM_001080463.1(DYNC2H1):c.12460C>T (p.Arg4154Cys) rs755441612
NM_001080463.1(DYNC2H1):c.1540C>T (p.Arg514Ter)
NM_001080463.1(DYNC2H1):c.1757T>G (p.Val586Gly) rs864622357
NM_001080463.1(DYNC2H1):c.337C>T (p.Arg113Trp) rs745569868
NM_001080463.1(DYNC2H1):c.3682C>A (p.Leu1228Ile) rs189806840
NM_001080463.1(DYNC2H1):c.4073G>A (p.Arg1358His) rs184256941
NM_001080463.1(DYNC2H1):c.6047A>G (p.Tyr2016Cys) rs200190291
NM_001080463.1(DYNC2H1):c.624_625delGTinsAA (p.Phe209Ile) rs431905498
NM_001080463.1(DYNC2H1):c.6614G>A (p.Arg2205His) rs137853031
NM_001080463.1(DYNC2H1):c.6910G>A (p.Ala2304Thr) rs747348765
NM_001080463.1(DYNC2H1):c.7409C>G (p.Ala2470Gly) rs1555062849
NM_001080463.1(DYNC2H1):c.9044A>G (p.Asp3015Gly) rs137853027
NM_001080463.1(DYNC2H1):c.9045T>G (p.Asp3015Glu) rs794727767
NM_001080517.2(SETD5):c.3856del (p.Ser1286Leufs) rs587777329
NM_001080522.2(CC2D2A):c.3347C>T (p.Thr1116Met) rs267606709
NM_001080522.2(CC2D2A):c.3596T>C (p.Ile1199Thr) rs760918829
NM_001080522.2(CC2D2A):c.4340A>C (p.Glu1447Ala) rs387907058
NM_001080522.2(CC2D2A):c.4600T>G (p.Leu1534Val) rs778858648
NM_001080522.2(CC2D2A):c.4667A>T (p.Asp1556Val) rs201502401
NM_001081.3(CUBN):c.9524C>A (p.Ser3175Ter)
NM_001083116.1(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001083607.2(PTCH1):c.869G>A (p.Arg290His) rs767273237
NM_001083614.1(EARS2):c.322C>T (p.Arg108Trp) rs376103091
NM_001083961.1(WDR62):c.1576G>A (p.Glu526Lys) rs147875659
NM_001085.4(SERPINA3):c.1240A>G (p.Met414Val) rs116929575
NM_001085.4(SERPINA3):c.754C>G (p.Pro252Ala) rs17473
NM_001089.2(ABCA3):c.977T>C (p.Leu326Pro) rs121909185
NM_001097642.2(GJB1):c.572_580dup(p.Phe193_Met194insThrValPhe) rs116840823
NM_001098.2(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001099404.1(SCN5A):c.892G>A (p.Gly298Ser) rs137854608
NM_001101.3(ACTB):c.617G>A (p.Arg206Gln) rs886039472
NM_001101.5(ACTB):c.1097dup (p.Ser368Leufs) rs1554329078
NM_001101362.2(KBTBD13):c.244G>A (p.Val82Met) rs1303411209
NM_001101426.3(CRPPA):c.277_279delATT (p.Ile93del) rs397515398
NM_001101426.3(CRPPA):c.713C>T (p.Thr238Ile) rs397515409
NM_001103.3(ACTN2):c.1484C>T (p.Thr495Met) rs200248944
NM_001103.3(ACTN2):c.2578C>T (p.Gln860Ter) rs763078071
NM_001103.3(ACTN2):c.26A>G (p.Gln9Arg) rs121434525
NM_001104631.1(PDE4D):c.1762A>G (p.Met588Val) rs1554033934
NM_001110556.1(FLNA):c.586C>T (p.Arg196Trp) rs137853317
NM_001110556.1(FLNA):c.623-3C>G rs398123622
NM_001110792.1(MECP2):c.1A>T (p.Met1Leu) rs587783132
NM_001110792.1(MECP2):c.62+1G>A rs786205048
NM_001111.5(ADAR):c.577C>G (p.Pro193Ala) rs145588689
NM_001111035.2(ACP5):c.791T>A (p.Met264Lys) rs387906670
NM_001111125.2(IQSEC2):c.2587C>T (p.Arg863Trp) rs267607186
NM_001112741.1(KCNC1):c.1262C>T (p.Ala421Val) rs1554991378
NM_001113378.1(FANCI):c.3853C>T (p.Arg1285Ter) rs121918164
NM_001114636.1(FANCL):c.1111_1114dupATTA (p.Thr372Asnfs) rs759217526
NM_001114753.2(ENG):c.788T>A (p.Ile263Asn) rs1085307431
NM_001122757.2(POU1F1):c.889C>T (p.Arg297Trp) rs104893755
NM_001124758.3(SPNS2):c.955_957del (p.Ser319del) rs749994718
NM_001126115.1(TP53):c.318T>G (p.Cys106Trp) rs193920789
NM_001126115.1(TP53):c.401G>A (p.Gly134Glu) rs193920774
NM_001126335.1(SLC7A9):c.605-3C>A rs749913021
NM_001127178.2(PIGG):c.1515G>A (p.Trp505Ter) rs150259543
NM_001127180.1(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_001127221.1(CACNA1A):c.4058C>T (p.Pro1353Leu) rs1064794808
NM_001127221.1(CACNA1A):c.4177G>A (p.Val1393Met) rs794727411
NM_001127221.1(CACNA1A):c.4900G>A (p.Asp1634Asn) rs1555740805
NM_001127221.1(CACNA1A):c.4991G>A (p.Arg1664Gln) rs121908247
NM_001127464.2(ZNF469):c.2699C>T (p.Pro900Leu) rs273585618
NM_001127464.2(ZNF469):c.9047C>T (p.Thr3016Met) rs273585626
NM_001127593.1(FCGR3A):c.197T>A (p.Leu66His) rs10127939
NM_001127701.1(SERPINA1):c.1177C>A (p.Pro393Thr) rs61761869
NM_001127701.1(SERPINA1):c.17C>T (p.Ser6Leu) rs140814100
NM_001127701.1(SERPINA1):c.739C>T (p.Arg247Cys) rs28929470
NM_001128227.2(GNE):c.1472C>T (p.Ala491Val) rs121908631
NM_001128227.2(GNE):c.18T>A (p.Tyr6Ter)
NM_001128227.2(GNE):c.766G>A (p.Asp256Asn) rs121908630
NM_001128227.2(GNE):c.79C>T (p.Arg27Ter) rs794727279
NM_001128425.1(MUTYH):c.1118C>T (p.Ala373Val) rs35352891
NM_001128425.1(MUTYH):c.309G>A (p.Trp103Ter) rs748170941
NM_001128425.1(MUTYH):c.358delG (p.Glu120Argfs) rs786203213
NM_001128425.1(MUTYH):c.391T>A (p.Trp131Arg) rs730881832
NM_001128425.1(MUTYH):c.548G>A (p.Gly183Asp) rs587781864
NM_001128425.1(MUTYH):c.933+3A>C rs587780751
NM_001128425.1(MUTYH):c.934-2A>G rs77542170
NM_001130144.2(LTBP3):c.2087C>G (p.Ser696Cys) rs1554974135
NM_001130438.2(SPTAN1):c.3673C>T (p.Arg1225Trp) rs569997507
NM_001130438.2(SPTAN1):c.4283C>G (p.Ala1428Gly) rs143166100
NM_001130438.2(SPTAN1):c.6908_6916dupACCAGCTGG (p.Leu2305_Gly2306insAspGlnLeu) rs587784440
NM_001130966.3(TBXAS1):c.245T>C (p.Leu82Pro) rs140005285
NM_001130987.1(DYSF):c.1274_1276+4dup rs1553530017
NM_001134363.2(RBM20):c.1906C>T (p.Arg636Cys) rs267607002
NM_001134831.1(AHI1):c.2282C>T (p.Ser761Leu) rs794727174
NM_001135599.3(TGFB2):c.294_308del (p.Ala100_Tyr104del) rs398122883
NM_001139.3(ALOX12B):c.410T>A (p.Ile137Asn) rs397514530
NM_001142519.2(FAM111A):c.1531T>C (p.Tyr511His) rs587777012
NM_001142520.2(FAM111A):c.1706G>A (p.Arg569His) rs587777011
NM_001142800.1(EYS):c.6416G>A (p.Cys2139Tyr) rs749909863
NM_001143779.1(IFT81):c.1303_1305delCTT rs1555266475
NM_001143979.1(NDE1):c.1A>G (p.Met1Val) rs794727491
NM_001144967.2(NEDD4L):c.2677G>A (p.Glu893Lys) rs879255597
NM_001145.4(ANG):c.208A>G (p.Ile70Val) rs121909541
NM_001145026.1(PTPRQ):c.6881G>A (p.Trp2294Ter) rs1555214288
NM_001145079.1(COG6):c.1746+2T>G rs1555280464
NM_001145112.1(PATL2):c.1108G>A (p.Gly370Arg) rs1397500378
NM_001145112.1(PATL2):c.839G>A (p.Arg280Gln) rs569729547
NM_001145112.1(PATL2):c.953T>C (p.Ile318Thr) rs1011539285
NM_001148.4(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.4(ANK2):c.11716C>T (p.Arg3906Trp) rs121912706
NM_001148.4(ANK2):c.4373A>G (p.Glu1458Gly) rs72544141
NM_001151.3(SLC25A4):c.368C>A (p.Ala123Asp) rs121912683
NM_001160036.1(RHOBTB2):c.1528A>G (p.Asn510Asp) rs1554504678
NM_001163213.1(FGFR3):c.598C>T (p.Arg200Cys) rs886043613
NM_001163817.1(DHCR7):c.89G>C (p.Gly30Ala) rs200334114
NM_001164277.1(SLC37A4):c.287G>A (p.Trp96Ter) rs121908976
NM_001164675.1(SUMF1):c.836C>T (p.Ala279Val) rs137852849
NM_001164731.1(REEP1):c.524A>G (p.Ter175Trp) rs587781248
NM_001165963.1(SCN1A):c.1076A>G (p.Asn359Ser) rs794726713
NM_001165963.1(SCN1A):c.2985T>G (p.Phe995Leu) rs794726746
NM_001165963.1(SCN1A):c.5797delC (p.Arg1933Glufs) rs587780446
NM_001165963.1(SCN1A):c.602+2dupT rs796053054
NM_001165963.1(SCN1A):c.694+5G>C rs727504142
NM_001165963.2(SCN1A):c.4787G>A (p.Arg1596His) rs575368466
NM_001167.3(XIAP):c.1048_1050delGAG (p.Glu350del) rs199683465
NM_001170535.2(ATAD3A):c.158C>T (p.Thr53Ile) rs1057517687
NM_001171.5(ABCC6):c.1171A>G (p.Arg391Gly) rs72653762
NM_001171.5(ABCC6):c.2247+22T>G rs72664298
NM_001171.5(ABCC6):c.2428G>A (p.Val810Met) rs72653795
NM_001171.5(ABCC6):c.2848G>A (p.Ala950Thr) rs72657689
NM_001171.5(ABCC6):c.3941G>A (p.Arg1314Gln) rs63751086
NM_001171.5(ABCC6):c.4253G>A (p.Arg1418Gln) rs63751262
NM_001171.5(ABCC6):c.4375C>T (p.Arg1459Cys) rs72547524
NM_001171.5(ABCC6):c.496C>T (p.Arg166Cys) rs201766106
NM_001171.5(ABCC6):c.742C>T (p.Leu248Phe) rs72653756
NM_001172696.1(TSFM):c.57+4A>G rs587777689
NM_001173982.1(CHST11):c.467_481del (p.Leu156_Asn160del)
NM_001173990.2(TMEM216):c.217C>T (p.Arg73Cys) rs779526456
NM_001182.4(ALDH7A1):c.34delG (p.Ala12Leufs) rs750693623
NM_001184880.1(PCDH19):c.1114C>T (p.Arg372Trp) rs796052812
NM_001184880.1(PCDH19):c.1682C>G (p.Pro561Arg) rs796052819
NM_001184880.1(PCDH19):c.3319C>G (p.Arg1107Gly) rs191333060
NM_001190737.2(NFIB):c.265C>T (p.Arg89Ter) rs764333096
NM_001193466.1(KANSL1):c.868C>T (p.Arg290Ter) rs149830411
NM_001193466.1(KANSL1):c.985_986delTT (p.Leu329Glufs) rs281865473
NM_001195263.1(PDZD7):c.2107delA (p.Ser703Valfs) rs397516633
NM_001195263.2(PDZD7):c.197G>T (p.Arg66Leu) rs1426679303
NM_001195794.1(CLRN1):c.144T>G (p.Asn48Lys) rs111033258
NM_001197104.1(KMT2A):c.3461G>A (p.Arg1154Gln) rs1131691799
NM_001198896.1(ACY1):c.841C>T (p.Arg281Cys) rs121912698
NM_001199107.1(TBC1D24):c.1544C>T (p.Ala515Val) rs267607105
NM_001199107.1(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520
NM_001199107.1(TBC1D24):c.328G>A (p.Gly110Ser) rs747821285
NM_001202435.2(SCN1A):c.602+1G>A rs794726827
NM_001204.6(BMPR2):c.1509A>C (p.Glu503Asp) rs1060502583
NM_001204.6(BMPR2):c.545G>A (p.Gly182Asp) rs137852754
NM_001204.6(BMPR2):c.797G>C (p.Arg266Thr) rs374694591
NM_001204.6(BMPR2):c.968-5A>G rs1060502584
NM_001204824.1(KCNQ3):c.1043A>G (p.Asn348Ser) rs118192252
NM_001205293.1(CACNA1E):c.2104G>A (p.Ala702Thr) rs12131800
NM_001206927.1(DNAH8):c.2419C>T (p.Arg807Ter) rs567050969
NM_001211.5(BUB1B):c.2441G>A (p.Arg814His) rs28989182
NM_001211.5(BUB1B):c.2763G>C (p.Gln921His) rs28989183
NM_001242785.2(HLCS):c.1711G>A (p.Asp571Asn) rs119103228
NM_001242875.2(ELP2):c.1579C>T (p.Arg527Trp) rs767713084
NM_001242896.2(DEPDC5):c.2591C>T (p.Thr864Met) rs564667614
NM_001242896.2(DEPDC5):c.268G>A (p.Val90Ile) rs768456731
NM_001242896.2(DEPDC5):c.3241A>C (p.Thr1081Pro) rs142540948
NM_001242896.2(DEPDC5):c.3484A>G (p.Ser1162Gly) rs886039280
NM_001242896.2(DEPDC5):c.814G>T (p.Val272Leu) rs187334123
NM_001243133.1(NLRP3):c.592G>A (p.Val198Met) rs121908147
NM_001244008.1(KIF1A):c.31C>T (p.Arg11Trp) rs548204329
NM_001244008.1(KIF1A):c.757G>A (p.Glu253Lys) rs672601369
NM_001252634.1(THRB):c.959G>A (p.Arg320His) rs121918693
NM_001256714.1(DNAAF3):c.1201dupG (p.Asp401Glyfs) rs756430359
NM_001256850.1(TTN):c.102712C>T (p.Gln34238Ter) rs757082154
NM_001256850.1(TTN):c.39893-1G>A rs749705939
NM_001256850.1(TTN):c.39976C>T (p.Arg13326Ter) rs727505350
NM_001256850.1(TTN):c.49243C>T (p.Arg16415Ter) rs768431507
NM_001256850.1(TTN):c.50509+5G>C rs754717390
NM_001256850.1(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001256850.1(TTN):c.87361_87365dupAAAAG (p.Ser29122Argfs) rs756367933
NM_001256850.1(TTN):c.90203C>G (p.Pro30068Arg) rs869320739
NM_001258332.1(GALT):c.125T>C (p.Val42Ala) rs111033701
NM_001258332.1(GALT):c.485A>G (p.Glu162Gly) rs111033765
NM_001258332.1(GALT):c.805A>G (p.Ile269Val) rs111033819
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.102214T>C (p.Trp34072Arg) rs375159973
NM_001267550.2(TTN):c.107788T>C (p.Trp35930Arg) rs1018591024
NM_001267550.2(TTN):c.34612+1G>A rs577363824
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.76115dupA (p.Asn25372Lysfs) rs774604740
NM_001267550.2(TTN):c.9163+1G>C rs1060500549
NM_001267550.2(TTN):c.95372G>A (p.Gly31791Asp) rs869320744
NM_001270.2(CHD1):c.421A>G (p.Arg141Gly) rs1064795875
NM_001271.3(CHD2):c.4058C>T (p.Pro1353Leu) rs755088564
NM_001271.3(CHD2):c.4534C>T (p.Arg1512Trp) rs755898320
NM_001271208.1(NEB):c.19944G>A (p.Ser6648=) rs201553266
NM_001271208.1(NEB):c.2211+5G>A rs797045736
NM_001271208.1(NEB):c.24072_24075delACCT (p.Pro8025Serfs) rs756384471
NM_001271208.1(NEB):c.25319delG (p.Gly8440Valfs) rs1553520266
NM_001277115.1(DNAH11):c.7772C>T (p.Pro2591Leu) rs387907258
NM_001281723.2(BTD):c.106G>A (p.Gly36Ser) rs119103232
NM_001281723.2(BTD):c.1112C>T (p.Pro371Leu) rs397514400
NM_001281723.2(BTD):c.1211A>G (p.Asn404Ser) rs201023772
NM_001281723.2(BTD):c.1217C>T (p.Thr406Ile) rs397514405
NM_001281723.2(BTD):c.1315C>G (p.Leu439Val) rs1553654107
NM_001281723.2(BTD):c.1340G>A (p.Gly447Glu) rs397514402
NM_001281723.2(BTD):c.1472A>C (p.Asn491Thr) rs104893692
NM_001281723.2(BTD):c.1537C>G (p.Gln513Glu) rs397514427
NM_001281723.2(BTD):c.1618C>A (p.Arg540Ser) rs80338686
NM_001281723.2(BTD):c.1625A>G (p.Tyr542Cys) rs397514431
NM_001281723.2(BTD):c.218T>C (p.Leu73Pro) rs397514333
NM_001281723.2(BTD):c.242G>A (p.Arg81His) rs397514343
NM_001281723.2(BTD):c.251C>T (p.Ala84Val) rs397507171
NM_001281723.2(BTD):c.254T>C (p.Leu85Ser) rs397514347
NM_001281723.2(BTD):c.327T>G (p.Ile109Met) rs1024847163
NM_001281723.2(BTD):c.362A>G (p.Asn121Ser) rs397514353
NM_001281723.2(BTD):c.491C>T (p.Ala164Val) rs397514364
NM_001281723.2(BTD):c.517G>A (p.Ala173Thr) rs13073139
NM_001281723.2(BTD):c.521A>G (p.Asn174Ser) rs397514366
NM_001281723.2(BTD):c.589A>G (p.Asn197Asp) rs397514370
NM_001281723.2(BTD):c.647A>G (p.Asn216Ser) rs397514377
NM_001281723.2(BTD):c.688G>T (p.Asp230Tyr) rs397514380
NM_001281723.2(BTD):c.740G>A (p.Cys247Tyr) rs397507175
NM_001281723.2(BTD):c.763C>T (p.Pro255Ser) rs397514383
NM_001281723.2(BTD):c.770T>C (p.Ile257Thr) rs397514384
NM_001281723.2(BTD):c.839T>C (p.Leu280Pro) rs397514389
NM_001281723.2(BTD):c.940G>A (p.Gly314Ser) rs397514396
NM_001281723.2(BTD):c.941G>A (p.Gly314Asp) rs377651057
NM_001281723.2(BTD):c.974A>G (p.His325Arg) rs397507176
NM_001281724.2(BTD):c.1243G>A (p.Gly415Ser) rs374141881
NM_001281724.2(BTD):c.1258T>C (p.Cys420Arg) rs397514408
NM_001281724.2(BTD):c.1273T>C (p.Cys425Arg) rs397514412
NM_001281724.2(BTD):c.1336G>C (p.Asp446His) rs13078881
NM_001281724.2(BTD):c.370A>G (p.Arg124Gly) rs397514354
NM_001281724.2(BTD):c.749T>C (p.Ile250Thr) rs397514382
NM_001281725.2(BTD):c.1301A>G (p.Tyr434Cys) rs397514345
NM_001281725.2(BTD):c.1328G>A (p.Cys443Tyr) rs397514421
NM_001281725.2(BTD):c.1372G>A (p.Ala458Thr) rs181396238
NM_001281725.2(BTD):c.1395C>G (p.His465Gln) rs201604102
NM_001281725.2(BTD):c.239C>T (p.Ala80Val) rs1553652171
NM_001281725.2(BTD):c.565C>T (p.Arg189Cys) rs369102875
NM_001281725.2(BTD):c.73G>A (p.Gly25Arg) rs34885143
NM_001282225.1(ADA2):c.145C>T (p.Arg49Trp) rs199614299
NM_001286577.1(C2CD3):c.5267G>A (p.Gly1756Glu) rs150291837
NM_001291303.1(FAT4):c.12851C>T (p.Ser4284Phe) rs199682210
NM_001291415.1(KDM6A):c.3614G>A (p.Cys1205Tyr) rs1556350571
NM_001297.4(CNGB1):c.1589C>G (p.Pro530Arg) rs201553871
NM_001297.4(CNGB1):c.2957A>T (p.Asn986Ile) rs201162411
NM_001297.4(CNGB1):c.952C>T (p.Gln318Ter) rs372504780
NM_001298.2(CNGA3):c.101+1G>A rs147118493
NM_001298.2(CNGA3):c.1279C>T (p.Arg427Cys) rs141386891
NM_001298.2(CNGA3):c.1669G>A (p.Gly557Arg) rs104893615
NM_001298.2(CNGA3):c.682G>A (p.Glu228Lys) rs147415641
NM_001298.2(CNGA3):c.967G>C (p.Ala323Pro) rs146195955
NM_001301339.1(CHCHD10):c.44G>T (p.Arg15Leu) rs730880030
NM_001308117.1(RBFOX1):c.1186G>A (p.Gly396Ser) rs145873257
NM_001308240.1(MICOS13):c.110del (p.Gly37Glufs)
NM_001308240.1(MICOS13):c.326-2A>G rs1064797230
NM_001317040.1(GLB1):c.745C>T (p.Arg249Cys) rs72555360
NM_001321120.2(TBX4):c.702+1G>A rs1555883342
NM_001323582.1(BTD):c.1421A>G (p.Tyr474Cys) rs750598655
NM_001324312.1(SLC25A16):c.92G>T (p.Arg31Leu) rs771745123
NM_001348768.1(HECW2):c.4334A>G (p.Glu1445Gly) rs878854424
NM_001360.2(DHCR7):c.506C>T (p.Ser169Leu) rs80338855
NM_001360.2(DHCR7):c.841G>A (p.Val281Met) rs398123607
NM_001360.2(DHCR7):c.907G>A (p.Gly303Arg) rs142808899
NM_001360.2(DHCR7):c.970T>C (p.Tyr324His) rs1173707321
NM_001361.4(DHODH):c.454G>A (p.Gly152Arg) rs267606766
NM_001361.4(DHODH):c.56G>A (p.Gly19Glu) rs267606765
NM_001363.4(DKC1):c.-142C>G rs199422241
NM_001363.4(DKC1):c.472C>T (p.Arg158Trp) rs199422246
NM_001363.4(DKC1):c.838A>C (p.Ser280Arg) rs146700772
NM_001369.2(DNAH5):c.1121T>C (p.Ile374Thr) rs147499872
NM_001369.2(DNAH5):c.11653C>T (p.Arg3885Ter) rs756032160
NM_001369.2(DNAH5):c.8030G>A (p.Arg2677Gln) rs886043448
NM_001369.2(DNAH5):c.8642C>G (p.Ala2881Gly) rs727502973
NM_001382.3(DPAGT1):c.509A>G (p.Tyr170Cys) rs28934876
NM_001399.4(EDA):c.1069C>T (p.Arg357Trp) rs886039347
NM_001399.4(EDA):c.626C>T (p.Pro209Leu) rs132630315
NM_001414.3(EIF2B1):c.252+1G>A rs113994006
NM_001415.3(EIF2S3):c.324T>A (p.Ser108Arg) rs1057515578
NM_001429.3(EP300):c.4783T>G (p.Phe1595Val) rs1057517732
NM_001447.2(FAT2):c.10758G>C (p.Lys3586Asn) rs770597316
NM_001447.2(FAT2):c.10946G>A (p.Arg3649Gln) rs201335279
NM_001453.3(FOXC1):c.388C>T (p.Leu130Phe) rs121909338
NM_001458.4(FLNC):c.1444C>T (p.Arg482Ter) rs1420159591
NM_001458.4(FLNC):c.577G>A (p.Ala193Thr) rs387906587
NM_001458.4(FLNC):c.6893C>T (p.Pro2298Leu)
NM_001492.5(GDF1):c.485G>A (p.Gly162Asp) rs121434424
NM_001604.5(PAX6):c.192C>A (p.Asn64Lys) rs727504064
NM_001605.2(AARS):c.2251A>G (p.Arg751Gly) rs143370729
NM_001609.3(ACADSB):c.1159G>A (p.Glu387Lys) rs188094280
NM_001609.3(ACADSB):c.443C>T (p.Thr148Ile) rs58639322
NM_001613.2(ACTA2):c.116G>A (p.Arg39His) rs794728021
NM_001615.3(ACTG2):c.119G>A (p.Arg40His) rs587777386
NM_001698.2(AUH):c.991A>T (p.Lys331Ter) rs387906757
NM_001715.2(BLK):c.211G>A (p.Ala71Thr) rs55758736
NM_001715.2(BLK):c.713G>A (p.Arg238Gln) rs141865425
NM_001723.5(DST):c.3370C>T (p.Gln1124Ter) rs201045495
NM_001754.4(RUNX1):c.253C>A (p.His85Asn) rs121912500
NM_001756.3(SERPINA6):c.344T>A (p.Leu115His) rs113418909
NM_001814.5(CTSC):c.815G>A (p.Arg272His) rs587777534
NM_001830.3(CLCN4):c.1664C>T (p.Ala555Val) rs879255583
NM_001844.4(COL2A1):c.1962C>T (p.Gly654=) rs794727533
NM_001844.4(COL2A1):c.4148C>T (p.Thr1383Met) rs138498898
NM_001844.4(COL2A1):c.4316C>T (p.Thr1439Met) rs121912886
NM_001848.2(COL6A1):c.1425delA (p.Gly476Alafs) rs878854398
NM_001848.2(COL6A1):c.717+4A>G rs762867111
NM_001848.2(COL6A1):c.850G>A (p.Gly284Arg) rs121912938
NM_001849.3(COL6A2):c.1493G>A (p.Arg498His) rs267606749
NM_001849.3(COL6A2):c.1870G>A (p.Glu624Lys) rs387906607
NM_001849.3(COL6A2):c.2795C>T (p.Pro932Leu) rs117725825
NM_001849.3(COL6A2):c.847G>A (p.Gly283Arg) rs267606748
NM_001851.4(COL9A1):c.876+2T>A rs149830493
NM_001851.4(COL9A1):c.876+2dupT rs672601329
NM_001875.4(CPS1):c.2148T>A (p.Asn716Lys) rs369061090
NM_001876.3(CPT1A):c.1493A>G (p.Tyr498Cys) rs80356791
NM_001876.3(CPT1A):c.367C>T (p.Arg123Cys) rs80356775
NM_001876.3(CPT1A):c.946C>G (p.Arg316Gly) rs80356796
NM_001885.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929
NM_001902.5(CTH):c.200C>T (p.Thr67Ile) rs28941785
NM_001904.3(CTNNB1):c.101G>T (p.Gly34Val) rs28931589
NM_001904.3(CTNNB1):c.121A>G (p.Thr41Ala) rs121913412
NM_001918.3(DBT):c.1017_1018insNC_000001.11:g.100207187_100207312 rs796052135
NM_001918.3(DBT):c.1430T>G (p.Met477Arg) rs398123662
NM_001918.3(DBT):c.827T>G (p.Phe276Cys) rs121964999
NM_001927.3(DES):c.1353C>G (p.Ile451Met) rs121913002
NM_001927.3(DES):c.638C>T (p.Ala213Val) rs41272699
NM_001930.4(DHPS):c.1014+1G>A rs142633494
NM_001930.4(DHPS):c.1A>G (p.Met1Val)
NM_001930.4(DHPS):c.518A>G (p.Asn173Ser) rs758100382
NM_001930.4(DHPS):c.912_917del (p.Tyr305_Ile306del)
NM_001931.4(DLAT):c.470T>G (p.Val157Gly) rs797044957
NM_001943.4(DSG2):c.1487dupG (p.Cys496Trpfs) rs730880347
NM_001943.4(DSG2):c.166G>A (p.Val56Met) rs121913013
NM_001943.4(DSG2):c.593A>G (p.Tyr198Cys) rs786204291
NM_001943.4(DSG2):c.829_840delCTTGAAGGGATG (p.Leu277_Met280del) rs794728093
NM_001943.4(DSG2):c.991G>A (p.Glu331Lys) rs121913012
NM_001943.5(DSG2):c.3039C>A (p.Tyr1013Ter) rs539821357
NM_001953.4(TYMP):c.929-6_929-3del rs201685922
NM_001958.3(EEF1A2):c.1267C>T (p.Arg423Cys) rs886039346
NM_001972.2(ELANE):c.377C>T (p.Ser126Leu) rs137854450
NM_001972.2(ELANE):c.558C>A (p.Val186=) rs878855317
NM_001972.2(ELANE):c.598-1G>A rs201117839
NM_001976.4(ENO3):c.1121G>A (p.Gly374Glu) rs121918404
NM_001999.3(FBN2):c.3430G>A (p.Glu1144Lys) rs200060005
NM_001999.3(FBN2):c.3736T>C (p.Cys1246Arg) rs1554122857
NM_001999.3(FBN2):c.3740T>C (p.Met1247Thr) rs149054177
NM_001999.3(FBN2):c.4151G>A (p.Cys1384Tyr) rs794727560
NM_002016.1(FLG):c.2282_2285delCAGT (p.Ser761Cysfs) rs558269137
NM_002016.1(FLG):c.2476C>T (p.Arg826Ter) rs115746363
NM_002052.4(GATA4):c.1037C>T (p.Ala346Val) rs115372595
NM_002052.4(GATA4):c.1220C>A (p.Pro407Gln) rs115099192
NM_002052.4(GATA4):c.1273G>A (p.Asp425Asn) rs56208331
NM_002052.4(GATA4):c.127C>T (p.Arg43Trp) rs387906770
NM_002052.4(GATA4):c.487C>T (p.Pro163Ser) rs387906769
NM_002052.4(GATA4):c.909+25G>A rs147860174
NM_002052.4(GATA4):c.997+56C>A rs804280
NM_002055.4(GFAP):c.715C>G (p.Arg239Gly) rs58064122
NM_002055.4(GFAP):c.934G>T (p.Glu312Ter) rs763868966
NM_002056.3(GFPT1):c.*22C>A rs199678034
NM_002098.5(GUCA1B):c.469G>A (p.Gly157Arg) rs121909124
NM_002109.5(HARS):c.1361A>C (p.Tyr454Ser) rs387906639
NM_002109.5(HARS):c.410G>A (p.Arg137Gln) rs191391414
NM_002111.8(HTT):c.4469+1G>A rs1060505027
NM_002163.2(IRF8):c.602C>T (p.Ala201Val) rs144424711
NM_002180.2(IGHMBP2):c.1591C>A (p.Pro531Thr) rs756985703
NM_002180.2(IGHMBP2):c.1808G>A (p.Arg603His) rs151079750
NM_002180.2(IGHMBP2):c.2911_2912delAG (p.Arg971Glufs) rs724159994
NM_002185.3(IL7R):c.83-2A>T rs886060531
NM_002222.5(ITPR1):c.736G>A (p.Glu246Lys) rs1553666546
NM_002222.5(ITPR1):c.800C>T (p.Thr267Met) rs797044955
NM_002225.3(IVD):c.627delT (p.Ile209Metfs) rs781630355
NM_002225.4(IVD):c.1184G>A (p.Arg395Gln) rs1477527791
NM_002234.3(KCNA5):c.1580C>T (p.Thr527Met) rs121908591
NM_002234.3(KCNA5):c.913G>A (p.Ala305Thr) rs199794307
NM_002241.4(KCNJ10):c.1042C>T (p.Arg348Cys) rs137853074
NM_002247.3(KCNMA1):c.2984A>G (p.Asn995Ser) rs886039469
NM_002296.3(LBR):c.1535G>A (p.Arg512Gln) rs754049402
NM_002334.3(LRP4):c.3830G>A (p.Arg1277His) rs746136135
NM_002354.2(EPCAM):c.426-1G>A rs373597944
NM_002386.3(MC1R):c.456C>A (p.Tyr152Ter) rs201326893
NM_002386.3(MC1R):c.464T>C (p.Ile155Thr) rs1110400
NM_002420.5(TRPM1):c.2998C>T (p.Arg1000Ter) rs369742878
NM_002437.4(MPV17):c.271_273delTTG (p.Leu91del) rs267607264
NM_002437.4(MPV17):c.451dupC (p.Leu151Profs) rs267607267
NM_002465.3(MYBPC1):c.2566T>C (p.Tyr856His) rs387906658
NM_002468.5(MYD88):c.755T>C (p.Leu252Pro) rs387907272
NM_002470.3(MYH3):c.1986_1990delTTTAA (p.Asn662Lysfs) rs771300756
NM_002471.3(MYH6):c.3010G>T (p.Ala1004Ser) rs143978652
NM_002471.3(MYH6):c.3195G>C (p.Gln1065His) rs267606904
NM_002485.4(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.4(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002488.4(NDUFA2):c.225delG (p.Asn76Metfs) rs863224084
NM_002496.2(NDUFS8):c.229C>T (p.Arg77Trp) rs146766138
NM_002496.3(NDUFS8):c.305G>A (p.Arg102His) rs121912638
NM_002524.4(NRAS):c.181C>A (p.Gln61Lys) rs121913254
NM_002528.5(NTHL1):c.268C>T (p.Gln90Ter) rs150766139
NM_002591.3(PCK1):c.134T>C (p.Ile45Thr) rs202197769
NM_002591.3(PCK1):c.925G>A (p.Gly309Arg) rs201186470
NM_002609.3(PDGFRB):c.1696T>C (p.Trp566Arg) rs1060499542
NM_002642.3(PIGC):c.61C>T (p.Arg21Ter) rs115209243
NM_002693.2(POLG):c.1156C>T (p.Arg386Cys) rs199759055
NM_002693.2(POLG):c.1402A>G (p.Asn468Asp) rs145843073
NM_002693.2(POLG):c.1491G>C (p.Gln497His) rs121918052
NM_002693.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_002693.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_002693.2(POLG):c.1790G>A (p.Arg597Gln)
NM_002693.2(POLG):c.2209G>C (p.Gly737Arg) rs121918054
NM_002693.2(POLG):c.2243G>C (p.Trp748Ser) rs113994097
NM_002693.2(POLG):c.2246T>C (p.Phe749Ser) rs202037973
NM_002693.2(POLG):c.2293C>A (p.Pro765Thr) rs1003442806
NM_002693.2(POLG):c.2419C>T (p.Arg807Cys) rs769827124
NM_002693.2(POLG):c.2557C>T (p.Arg853Trp) rs121918053
NM_002693.2(POLG):c.2636A>G (p.Gln879Arg) rs368587966
NM_002693.2(POLG):c.2663G>A (p.Gly888Asp) rs878854560
NM_002693.2(POLG):c.2665G>A (p.Ala889Thr) rs763393580
NM_002693.2(POLG):c.2740A>C (p.Thr914Pro) rs139590686
NM_002693.2(POLG):c.2857C>T (p.Arg953Cys) rs11546842
NM_002693.2(POLG):c.2890C>T (p.Arg964Cys) rs201477273
NM_002693.2(POLG):c.3139C>T (p.Arg1047Trp) rs181860632
NM_002693.2(POLG):c.3151G>C (p.Gly1051Arg) rs121918049
NM_002693.2(POLG):c.3287G>A (p.Arg1096His) rs368435864
NM_002693.2(POLG):c.3573G>T (p.Lys1191Asn) rs1085307741
NM_002693.2(POLG):c.3640C>T (p.Gln1214Ter) rs781256643
NM_002693.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_002734.4(PRKAR1A):c.220C>T (p.Arg74Cys) rs137853303
NM_002739.3(PRKCG):c.2075T>G (p.Val692Gly) rs78437096
NM_002764.3(PRPS1):c.455T>C (p.Leu152Pro) rs80338676
NM_002769.4(PRSS1):c.235G>A (p.Glu79Lys) rs111033564
NM_002769.4(PRSS1):c.47C>T (p.Ala16Val) rs202003805
NM_002775.4(HTRA1):c.854C>T (p.Pro285Leu) rs587776446
NM_002834.4(PTPN11):c.166A>G (p.Ile56Val) rs397507504
NM_002834.4(PTPN11):c.215C>T (p.Ala72Val) rs121918454
NM_002834.4(PTPN11):c.794G>A (p.Arg265Gln) rs376607329
NM_002860.3(ALDH18A1):c.251G>A (p.Arg84Gln) rs121434582
NM_002860.3(ALDH18A1):c.383G>A (p.Arg128His) rs768323248
NM_002860.3(ALDH18A1):c.755G>A (p.Arg252Gln) rs864321670
NM_002863.4(PYGL):c.1900G>C (p.Asp634His) rs35026927
NM_002863.4(PYGL):c.2042A>C (p.Lys681Thr) rs113993987
NM_002863.4(PYGL):c.38A>C (p.Gln13Pro) rs113993972
NM_002880.3(RAF1):c.1877A>G (p.His626Arg) rs1553609795
NM_002880.3(RAF1):c.775T>G (p.Ser259Ala) rs3730271
NM_002894.2(RBBP8):c.1009A>G (p.Lys337Glu) rs121434388
NM_002921.3(RGR):c.196A>C (p.Ser66Arg) rs104894187
NM_002968.2(SALL1):c.3160C>T (p.Arg1054Ter) rs864321635
NM_002977.3(SCN9A):c.1846G>A (p.Gly616Arg) rs201338643
NM_002977.3(SCN9A):c.184A>G (p.Ile62Val) rs121908920
NM_002977.3(SCN9A):c.1921A>T (p.Asn641Tyr) rs121908918
NM_002977.3(SCN9A):c.1946C>T (p.Thr649Met) rs200965749
NM_002977.3(SCN9A):c.1964A>G (p.Lys655Arg) rs121908919
NM_002977.3(SCN9A):c.2159T>A (p.Ile720Lys) rs200945460
NM_002977.3(SCN9A):c.2215A>G (p.Ile739Val) rs182650126
NM_002977.3(SCN9A):c.2969A>G (p.Tyr990Cys) rs199692186
NM_002977.3(SCN9A):c.3316G>T (p.Val1106Leu) rs200817435
NM_002977.3(SCN9A):c.377+5C>T rs200972952
NM_002977.3(SCN9A):c.3799C>G (p.Leu1267Val) rs180922748
NM_002977.3(SCN9A):c.721T>A (p.Ser241Thr) rs80356470
NM_003000.2(SDHB):c.136C>T (p.Arg46Ter) rs74315370
NM_003000.2(SDHB):c.277T>C (p.Cys93Arg) rs727503415
NM_003000.2(SDHB):c.287G>A (p.Gly96Asp) rs778952116
NM_003000.2(SDHB):c.32G>A (p.Arg11His) rs111430410
NM_003000.2(SDHB):c.445C>T (p.Gln149Ter) rs876658451
NM_003000.2(SDHB):c.649C>G (p.Arg217Gly) rs200245469
NM_003000.2(SDHB):c.80G>A (p.Arg27Gln) rs373976827
NM_003001.3(SDHC):c.377A>G (p.Tyr126Cys) rs898854295
NM_003002.3(SDHD):c.205G>A (p.Glu69Lys) rs202198133
NM_003002.3(SDHD):c.209G>A (p.Arg70Lys) rs755047928
NM_003002.3(SDHD):c.479G>T (p.Ter160Leu) rs201372601
NM_003036.3(SKI):c.103C>T (p.Pro35Ser) rs397514590
NM_003042.3(SLC6A1):c.1531G>A (p.Val511Met) rs1064794981
NM_003051.3(SLC16A1):c.1414G>A (p.Gly472Arg) rs72552271
NM_003060.3(SLC22A5):c.1078_1083dupGGGCTT (p.Leu361_Ser362insGlyLeu) rs896634334
NM_003060.3(SLC22A5):c.1345T>G (p.Tyr449Asp) rs11568514
NM_003060.3(SLC22A5):c.1354G>A (p.Glu452Lys) rs72552734
NM_003060.3(SLC22A5):c.1409C>T (p.Ser470Phe) rs386134222
NM_003060.3(SLC22A5):c.364G>T (p.Asp122Tyr) rs201082652
NM_003060.3(SLC22A5):c.394-16T>A rs775097754
NM_003060.3(SLC22A5):c.56G>C (p.Arg19Pro) rs72552723
NM_003073.4(SMARCB1):c.110G>A (p.Arg37His) rs398122368
NM_003098.2(SNTA1):c.770C>G (p.Ala257Gly) rs56157422
NM_003106.3(SOX2):c.571G>A (p.Ala191Thr) rs104893808
NM_003119.2(SPG7):c.1529C>T rs61755320
NM_003119.3(SPG7):c.1454_1462delGGCGGGAGA (p.Arg485_Glu487del) rs768823392
NM_003119.3(SPG7):c.2084T>C (p.Leu695Pro) rs864622094
NM_003119.3(SPG7):c.2096dupT (p.Met699Ilefs) rs747503698
NM_003119.3(SPG7):c.233T>A (p.Leu78Ter) rs121918358
NM_003119.3(SPG7):c.637C>T (p.Arg213Ter) rs774774648
NM_003122.4(SPINK1):c.101A>G (p.Asn34Ser) rs17107315
NM_003122.4(SPINK1):c.199C>T (p.Arg67Cys) rs515726208
NM_003122.4(SPINK1):c.1A>T (p.Met1Leu) rs369163833
NM_003122.4(SPINK1):c.206C>T (p.Thr69Ile) rs576564400
NM_003159.2(CDKL5):c.2713+129C>T rs1555955296
NM_003159.2(CDKL5):c.872G>A (p.Cys291Tyr) rs267606714
NM_003165.3(STXBP1):c.874C>T (p.Arg292Cys) rs786205598
NM_003172.3(SURF1):c.809_826dup (p.Ile275_Val276insGluHisLeuGlnTyrIle)
NM_003227.3(TFR2):c.1403G>A (p.Arg468His) rs80338885
NM_003235.4(TG):c.638+5G>A rs774274702
NM_003235.5(TG):c.229G>A (p.Gly77Ser) rs142698837
NM_003235.5(TG):c.6379C>T (p.Arg2127Ter) rs375424292
NM_003239.4(TGFB3):c.-30G>A rs770828281
NM_003239.4(TGFB3):c.787G>C (p.Asp263His) rs796051886
NM_003239.4(TGFB3):c.973C>T (p.Arg325Ter) rs1555360229
NM_003242.5(TGFBR2):c.1489C>T (p.Arg497Ter) rs863223852
NM_003242.5(TGFBR2):c.1526G>T (p.Gly509Val) rs863223853
NM_003242.5(TGFBR2):c.1576G>C (p.Glu526Gln) rs121918714
NM_003280.2(TNNC1):c.23C>T (p.Ala8Val) rs267607125
NM_003280.2(TNNC1):c.430A>G (p.Asn144Asp) rs730881061
NM_003280.2(TNNC1):c.435C>A (p.Asp145Glu) rs267607124
NM_003280.2(TNNC1):c.86T>A (p.Leu29Gln) rs267607123
NM_003319.4(TTN):c.13250G>A (p.Ser4417Asn) rs147879266
NM_003380.4(VIM):c.623A>G (p.Gln208Arg) rs1085307141
NM_003384.2(VRK1):c.266G>A (p.Arg89Gln) rs773138218
NM_003384.2(VRK1):c.397C>T (p.Arg133Cys) rs387906830
NM_003384.2(VRK1):c.706G>A (p.Val236Met) rs771364038
NM_003392.4(WNT5A):c.206G>A (p.Cys69Tyr) rs786204837
NM_003406.3(YWHAZ):c.689C>G (p.Ser230Trp) rs1554612377
NM_003476.4(CSRP3):c.131T>C (p.Leu44Pro) rs104894205
NM_003476.4(CSRP3):c.136A>C (p.Ser46Arg) rs137852765
NM_003476.4(CSRP3):c.206A>G (p.Lys69Arg) rs137852764
NM_003476.4(CSRP3):c.233G>T (p.Gly78Val) rs963128995
NM_003477.2(PDHX):c.44G>A (p.Arg15His) rs387906998
NM_003482.3(KMT2D):c.15088C>T (p.Arg5030Cys) rs1555185875
NM_003482.3(KMT2D):c.15142C>T (p.Arg5048Cys) rs398123724
NM_003482.3(KMT2D):c.16295G>A (p.Arg5432Gln) rs398123734
NM_003482.3(KMT2D):c.16391C>T (p.Thr5464Met) rs267607238
NM_003491.3(NAA10):c.247C>T (p.Arg83Cys) rs797044868
NM_003494.3(DYSF):c.1180+5G>A rs766433603
NM_003494.3(DYSF):c.1555G>A (p.Gly519Arg) rs121908962
NM_003494.3(DYSF):c.4024C>T (p.Arg1342Trp) rs199870606
NM_003494.3(DYSF):c.407delC (p.Pro136Leufs) rs886043342
NM_003504.4(CDC45):c.1660C>T (p.Arg554Trp) rs778665661
NM_003560.2(PLA2G6):c.1904G>A (p.Arg635Gln) rs387906863
NM_003560.2(PLA2G6):c.2215G>C (p.Asp739His) rs587784349
NM_003560.3(PLA2G6):c.1501G>C (p.Glu501Gln) rs587784332
NM_003560.3(PLA2G6):c.238G>A (p.Ala80Thr) rs121908685
NM_003560.3(PLA2G6):c.991G>A (p.Asp331Asn) rs199935023
NM_003611.2(OFD1):c.1007dupA (p.Ser337Glufs) rs749448671
NM_003620.3(PPM1D):c.1714C>T (p.Arg572Ter) rs765769406
NM_003632.2(CNTNAP1):c.1163G>C (p.Arg388Pro) rs779027563
NM_003673.3(TCAP):c.208C>T (p.Arg70Trp) rs775636212
NM_003673.3(TCAP):c.458G>A (p.Arg153His) rs149585781
NM_003688.3(CASK):c.1186C>T (p.Pro396Ser) rs137852820
NM_003748.3(ALDH4A1):c.866+1G>A rs78532707
NM_003801.4(GPAA1):c.160_161delGCinsAA (p.Ala54Asn) rs1554763777
NM_003839.3(TNFRSF11A):c.385C>T (p.Arg129Cys) rs121908657
NM_003865.2(HESX1):c.509C>T (p.Ser170Leu) rs28936703
NM_003865.2(HESX1):c.541A>G (p.Thr181Ala) rs28936704
NM_003900.4(SQSTM1):c.1175C>T (p.Pro392Leu) rs104893941
NM_003900.4(SQSTM1):c.714_716delGAA (p.Lys238del) rs796052214
NM_003907.3(EIF2B5):c.318A>T (p.Leu106Phe) rs113994048
NM_003977.3(AIP):c.807C>T (p.Phe269=) rs139407567
NM_003977.3(AIP):c.911G>A (p.Arg304Gln) rs104894190
NM_003978.4(PSTPIP1):c.364G>A (p.Val122Ile) rs886041107
NM_004004.5(GJB2):c.-260C>T rs886037626
NM_004004.5(GJB2):c.101T>C (p.Met34Thr) rs35887622
NM_004004.5(GJB2):c.107T>C (p.Leu36Pro) rs587783644
NM_004004.5(GJB2):c.339T>G (p.Ser113Arg) rs80338946
NM_004004.5(GJB2):c.476A>T (p.Asp159Val) rs28931592
NM_004004.5(GJB2):c.487A>G (p.Met163Val) rs80338949
NM_004004.5(GJB2):c.563A>G (p.Lys188Arg) rs1131691709
NM_004004.5(GJB2):c.56G>C (p.Ser19Thr) rs80338941
NM_004004.6(GJB2):c.-22-2A>C rs201895089
NM_004004.6(GJB2):c.109G>A (p.Val37Ile) rs72474224
NM_004004.6(GJB2):c.571T>C (p.Phe191Leu) rs397516878
NM_004006.2(DMD):c.10262C>T (p.Ala3421Val) rs104894791
NM_004006.2(DMD):c.4675-11A>G rs1557316295
NM_004006.2(DMD):c.5324_5325delAGinsGT (p.Lys1775Ser) rs1557303381
NM_004006.2(DMD):c.5899C>T (p.Arg1967Ter) rs128626249
NM_004006.2(DMD):c.93+5590T>A rs1557211730
NM_004064.4(CDKN1B):c.-80C>T rs551236750
NM_004082.4(DCTN1):c.167A>G (p.Lys56Arg) rs566433112
NM_004086.3(COCH):c.355G>A (p.Ala119Thr) rs121908931
NM_004168.2(SDHA):c.775delT (p.Tyr259Thrfs) rs1553998606
NM_004168.3(SDHA):c.1471G>T (p.Glu491Ter) rs778207102
NM_004168.3(SDHA):c.1526C>T (p.Ser509Leu) rs397514541
NM_004168.3(SDHA):c.1571C>T (p.Ala524Val) rs137852767
NM_004168.3(SDHA):c.1660C>T (p.Arg554Trp) rs9809219
NM_004168.3(SDHA):c.1753C>T (p.Arg585Trp) rs200397144
NM_004168.3(SDHA):c.1765C>T (p.Arg589Trp) rs387906780
NM_004172.4(SLC1A3):c.1496G>A (p.Arg499Gln) rs138085358
NM_004183.3(BEST1):c.418C>G (p.Leu140Val) rs267606678
NM_004204.3(PIGQ):c.942+1G>A rs200661329
NM_004239.4(TRIP11):c.2102A>G (p.Asn701Ser) rs139539448
NM_004252.4(SLC9A3R1):c.458G>A (p.Arg153Gln) rs41282065
NM_004260.3(RECQL4):c.221_222delAG (p.Glu74Alafs) rs773325186
NM_004273.4(CHST3):c.475T>A (p.Phe159Ile) rs145538723
NM_004273.4(CHST3):c.911G>A (p.Arg304Gln) rs28937593
NM_004278.3(PIGL):c.500T>C (p.Leu167Pro) rs145303331
NM_004281.3(BAG3):c.211C>T (p.Arg71Trp) rs387906874
NM_004281.3(BAG3):c.652C>T (p.Arg218Trp) rs397514506
NM_004299.6(ABCB7):c.2047G>A (p.Gly683Ser) rs797044558
NM_004304.4(ALK):c.3260C>T (p.Thr1087Ile) rs113994090
NM_004304.4(ALK):c.3271G>A (p.Asp1091Asn) rs864309584
NM_004311.3(ARL3):c.269A>G (p.Tyr90Cys)
NM_004311.3(ARL3):c.446G>A (p.Arg149His) rs770782663
NM_004315.5(ASAH1):c.504A>C (p.Lys168Asn) rs200455852
NM_004315.5(ASAH1):c.668A>T (p.Tyr223Phe) rs150268016
NM_004315.5(ASAH1):c.677T>C (p.Met226Thr) rs141068211
NM_004320.4(ATP2A1):c.100G>T (p.Glu34Ter) rs141559558
NM_004328.4(BCS1L):c.547C>T (p.Arg183Cys) rs144885874
NM_004328.4(BCS1L):c.550C>T (p.Arg184Cys) rs121908578
NM_004328.4(BCS1L):c.871C>T (p.Arg291Ter) rs201454788
NM_004329.2(BMPR1A):c.1409T>C (p.Met470Thr) rs199476089
NM_004329.2(BMPR1A):c.1511G>A (p.Trp504Ter) rs878854664
NM_004333.4(BRAF):c.735A>T (p.Leu245Phe) rs397507466
NM_004333.5(BRAF):c.1390G>A (p.Gly464Arg) rs121913349
NM_004360.4(CDH1):c.2131C>G (p.Leu711Val) rs121964871
NM_004360.4(CDH1):c.715G>A (p.Gly239Arg) rs587780537
NM_004360.5(CDH1):c.1018A>G (p.Thr340Ala) rs116093741
NM_004360.5(CDH1):c.1679C>G (p.Thr560Arg) rs746481984
NM_004360.5(CDH1):c.2494G>A (p.Val832Met) rs35572355
NM_004360.5(CDH1):c.2512A>G (p.Ser838Gly) rs121964872
NM_004366.5(CLCN2):c.1795G>A (p.Asp599Asn) rs141242566
NM_004369.3(COL6A3):c.7447A>G (p.Lys2483Glu) rs139260335
NM_004369.3(COL6A3):c.7660G>A (p.Ala2554Thr) rs786205870
NM_004370.5(COL12A1):c.5893C>T (p.Arg1965Cys) rs200487396
NM_004376.6(COX15):c.396-3C>G rs200910834
NM_004376.6(COX15):c.452C>G (p.Ser151Ter) rs149718203
NM_004380.2(CREBBP):c.5356C>T (p.Arg1786Cys) rs1555471394
NM_004387.3(NKX2-5):c.334+1G>T rs876661380
NM_004387.3(NKX2-5):c.566G>C (p.Arg189Pro) rs786205824
NM_004387.3(NKX2-5):c.656C>T (p.Ala219Val) rs104893902
NM_004387.3(NKX2-5):c.73C>T (p.Arg25Cys) rs28936670
NM_004387.3(NKX2-5):c.783delC (p.Ala262Argfs) rs587784067
NM_004387.3(NKX2-5):c.848C>A (p.Pro283Gln) rs375086983
NM_004387.3(NKX2-5):c.871_873delAAC (p.Asn291del) rs756974215
NM_004415.2(DSP):c.88G>A (p.Val30Met) rs121912998
NM_004415.3(DSP):c.6091_6092delTT (p.Leu2031Glyfs) rs397514040
NM_004415.3(DSP):c.7096C>T (p.Arg2366Cys) rs28931610
NM_004453.3(ETFDH):c.1773_1774delAT (p.Cys592Terfs) rs767795266
NM_004463.2(FGD1):c.935C>T (p.Pro312Leu) rs28935498
NM_004519.3(KCNQ3):c.1885G>C (p.Val629Leu) rs185511111
NM_004519.3(KCNQ3):c.2263G>A (p.Asp755Asn) rs150821246
NM_004519.3(KCNQ3):c.2462A>G (p.Asn821Ser) rs118192254
NM_004523.3(KIF11):c.2830C>T (p.Arg944Cys) rs387906642
NM_004523.3(KIF11):c.2922G>A (p.Pro974=) rs1554863201
NM_004562.2(PRKN):c.245C>A (p.Ala82Glu) rs55774500
NM_004562.2(PRKN):c.719C>T (p.Thr240Met) rs137853054
NM_004580.4(RAB27A):c.259G>C (p.Ala87Pro) rs104894497
NM_004588.4(SCN2B):c.82C>T (p.Arg28Trp) rs17121819
NM_004614.4(TK2):c.191C>T (p.Thr64Met) rs281865487
NM_004614.4(TK2):c.547C>G (p.Arg183Gly) rs137886900
NM_004614.4(TK2):c.760C>T (p.Arg254Ter) rs281865498
NM_004615.3(TSPAN7):c.515C>A (p.Pro172His) rs104894951
NM_004628.4(XPC):c.566_567delAT (p.Tyr189Serfs) rs752088918
NM_004646.3(NPHS1):c.2464G>A (p.Val822Met) rs267606918
NM_004656.3(BAP1):c.1202_1203delAT (p.Tyr401Terfs) rs886058705
NM_004722.3(AP4M1):c.577G>A (p.Glu193Lys) rs387906838
NM_004752.3(GCM2):c.1181A>C (p.Tyr394Ser) rs142287570
NM_004771.3(MMP20):c.954-2A>T rs140213840
NM_004782.3(SNAP29):c.354dupG (p.Leu119Alafs) rs751575036
NM_004802.3(OTOF):c.3515G>A (p.Arg1172Gln) rs80356605
NM_004820.4(CYP7B1):c.1456C>T (p.Arg486Cys) rs116171274
NM_004870.3(MPDU1):c.218G>A (p.Gly73Glu) rs104894586
NM_004895.4(NLRP3):c.2759G>A (p.Arg920Gln) rs1553293095
NM_004928.2(CFAP410):c.182G>A (p.Cys61Tyr) rs1057518441
NM_004933.2(CDH15):c.274C>T (p.Arg92Trp) rs121434540
NM_004949.4(DSC2):c.2125+1delG rs794728072
NM_004958.3(MTOR):c.5395G>A (p.Glu1799Lys) rs863225264
NM_004959.4(NR5A1):c.274C>T (p.Arg92Trp) rs886039769
NM_004960.3(FUS):c.1292C>T (p.Pro431Leu) rs186547381
NM_004960.3(FUS):c.1564A>G (p.Arg522Gly) rs1555509693
NM_004974.3(KCNA2):c.881G>A (p.Arg294His) rs886041761
NM_004980.4(KCND3):c.1174G>A (p.Val392Ile) rs786205867
NM_004980.4(KCND3):c.1348C>T (p.Leu450Phe) rs150401343
NM_004980.4(KCND3):c.1798G>A (p.Gly600Arg) rs149344567
NM_004984.2(KIF5A):c.2263G>A (p.Glu755Lys) rs387907286
NM_004984.3(KIF5A):c.839G>A (p.Arg280His) rs387907288
NM_004985.4(KRAS):c.436G>A (p.Ala146Thr) rs121913527
NM_004990.3(MARS):c.1852C>T (p.Arg618Cys) rs587777718
NM_004992.3(MECP2):c.298C>G (p.Leu100Val) rs28935168
NM_004992.3(MECP2):c.301C>T (p.Pro101Ser) rs61754452
NM_004992.3(MECP2):c.302C>G (p.Pro101Arg) rs61754453
NM_004992.3(MECP2):c.364G>A (p.Val122Met) rs267608455
NM_004992.3(MECP2):c.397C>T (p.Arg133Cys) rs28934904
NM_004992.3(MECP2):c.398G>A (p.Arg133His) rs61748389
NM_004992.3(MECP2):c.401C>T (p.Ser134Phe) rs61748390
NM_004992.3(MECP2):c.403A>G (p.Lys135Glu) rs61748391
NM_004992.3(MECP2):c.455C>G (p.Pro152Arg) rs61748404
NM_004992.3(MECP2):c.472A>G (p.Thr158Ala) rs61748411
NM_004992.3(MECP2):c.499C>T (p.Arg167Trp) rs61748420
NM_004992.3(MECP2):c.568C>T (p.Arg190Cys) rs587783137
NM_004992.3(MECP2):c.905C>T (p.Pro302Leu) rs61749723
NM_004992.3(MECP2):c.925C>T (p.Arg309Trp) rs61751444
NM_004992.3(MECP2):c.965C>T (p.Pro322Leu) rs61751450
NM_004999.3(MYO6):c.647A>T (p.Glu216Val) rs121912559
NM_005045.3(RELN):c.10093G>A (p.Val3365Ile) rs115035120
NM_005045.3(RELN):c.139G>A (p.Glu47Lys) rs139648092
NM_005045.3(RELN):c.2015C>T (p.Pro672Leu) rs201044262
NM_005045.3(RELN):c.3477C>A (p.Asn1159Lys) rs114684479
NM_005045.3(RELN):c.8843+3A>C rs200124755
NM_005120.2(MED12):c.4147G>A (p.Ala1383Thr) rs863223696
NM_005120.2(MED12):c.5922G>T (p.Gln1974His) rs879255528
NM_005141.4(FGB):c.794C>T (p.Pro265Leu) rs6054
NM_005142.2(CBLIF):c.137C>T (p.Ser46Leu) rs121434322
NM_005148.3(UNC119):c.169A>T (p.Lys57Ter) rs267607166
NM_005149.2(TBX19):c.535C>T (p.Arg179Ter) rs200197424
NM_005159.4(ACTC1):c.268C>T (p.His90Tyr) rs121912676
NM_005159.4(ACTC1):c.968C>T (p.Ala323Val) rs730880404
NM_005188.3(CBL):c.1228-2A>G rs727504426
NM_005211.3(CSF1R):c.1879_1881delAAG (p.Lys627del) rs1554101963
NM_005214.5(CTLA4):c.208C>T (p.Arg70Trp) rs606231422
NM_005219.4(DIAPH1):c.3637C>T (p.Arg1213Ter) rs876657776
NM_005236.2(ERCC4):c.2395C>T (p.Arg799Trp) rs121913049
NM_005266.6(GJA5):c.286G>T (p.Ala96Ser) rs121434557
NM_005272.3(GNAT2):c.461+24G>A rs397515384
NM_005359.5(SMAD4):c.1139G>A (p.Arg380Lys) rs377767353
NM_005359.5(SMAD4):c.425-6A>G rs377767327
NM_005359.5(SMAD4):c.970T>C (p.Cys324Arg) rs377767339
NM_005422.2(TECTA):c.4085G>A (p.Trp1362Ter) rs199638531
NM_005422.2(TECTA):c.5597C>T (p.Thr1866Met) rs140236996
NM_005422.2(TECTA):c.6062G>A (p.Arg2021His) rs121909062
NM_005430.3(WNT1):c.1063G>T (p.Val355Phe) rs387907358
NM_005431.1(XRCC2):c.96delT (p.Phe32Leufs) rs730882048
NM_005448.2(BMP15):c.202C>T (p.Arg68Trp) rs104894763
NM_005472.4(KCNE3):c.296G>A (p.Arg99His) rs121908441
NM_005477.2(HCN4):c.1209_1209+1insGTGA rs786205418
NM_005477.2(HCN4):c.1441T>C (p.Tyr481His) rs1057519275
NM_005502.3(ABCA1):c.1769G>C (p.Trp590Ser) rs137854496
NM_005506.3(SCARB2):c.1010T>C (p.Met337Thr) rs147324129
NM_005506.3(SCARB2):c.80G>A (p.Arg27Gln) rs368906199
NM_005518.3(HMGCS2):c.1270C>T (p.Arg424Ter) rs137852637
NM_005518.3(HMGCS2):c.1499G>A (p.Arg500His) rs137852639
NM_005572.3(LMNA):c.1445G>T (p.Arg482Leu) rs11575937
NM_005572.3(LMNA):c.1711C>A (p.Arg571Ser) rs80338938
NM_005585.4(SMAD6):c.42G>A (p.Trp14Ter) rs1246889300
NM_005589.3(ALDH6A1):c.1603C>T (p.Arg535Cys) rs367863044
NM_005590.3(MRE11):c.229G>T (p.Glu77Ter) rs779269083
NM_005591.3(MRE11):c.140C>T (p.Ala47Val) rs730880378
NM_005591.3(MRE11):c.1516G>T (p.Glu506Ter) rs587781384
NM_005591.3(MRE11):c.350A>G (p.Asn117Ser) rs137852760
NM_005592.3(MUSK):c.2368G>A (p.Val790Met) rs199476083
NM_005603.6(ATP8B1):c.208G>A (p.Asp70Asn) rs34719006
NM_005609.2(PYGM):c.425_528del rs764313717
NM_005609.2(PYGM):c.645G>A (p.Lys215=) rs116315896
NM_005629.3(SLC6A8):c.1171C>T (p.Arg391Trp) rs1557045267
NM_005633.3(SOS1):c.1655G>T (p.Arg552Met) rs397517154
NM_005670.3(EPM2A):c.512G>A (p.Arg171His) rs137852916
NM_005687.4(FARSB):c.853G>A (p.Glu285Lys) rs767956337
NM_005709.3(USH1C):c.1480+1G>C rs1060499916
NM_005732.3(RAD50):c.3G>A (p.Met1Ile) rs377260382
NM_005751.4(AKAP9):c.4709C>T (p.Ser1570Leu) rs121908566
NM_005902.3(SMAD3):c.335C>T (p.Ala112Val) rs387906854
NM_005902.3(SMAD3):c.401-6G>A rs745672741
NM_005902.3(SMAD3):c.715G>A (p.Glu239Lys) rs387906853
NM_005902.3(SMAD3):c.788C>T (p.Pro263Leu) rs387906855
NM_005902.3(SMAD3):c.802C>T (p.Arg268Cys) rs794727798
NM_005902.3(SMAD3):c.859C>T (p.Arg287Trp) rs387906850
NM_005902.3(SMAD3):c.860G>A (p.Arg287Gln) rs730880214
NM_005902.4(SMAD3):c.803G>A (p.Arg268His) rs863223740
NM_005912.2(MC4R):c.105C>A (p.Tyr35Ter) rs13447324
NM_005912.2(MC4R):c.380C>T (p.Ser127Leu) rs13447331
NM_005912.2(MC4R):c.806T>A (p.Ile269Asn) rs79783591
NM_005932.3(MIPEP):c.1027A>G (p.Lys343Glu) rs1057518741
NM_005932.3(MIPEP):c.1534C>G (p.His512Asp) rs779598020
NM_005932.3(MIPEP):c.1745T>G (p.Leu582Arg) rs1057518739
NM_005932.3(MIPEP):c.212T>A (p.Leu71Gln) rs1057518740
NM_005932.3(MIPEP):c.916C>T (p.Leu306Phe) rs143912947
NM_005957.4(MTHFR):c.1004G>A (p.Arg335His) rs543016186
NM_005957.4(MTHFR):c.1129C>T (p.Arg377Cys) rs121434296
NM_005957.4(MTHFR):c.665C>T (p.Ala222Val) rs1801133
NM_005989.3(AKR1D1):c.593C>T (p.Pro198Leu) rs121918342
NM_005989.4(AKR1D1):c.583G>T (p.Glu195Ter)
NM_005994.3(TBX2):c.914G>A (p.Arg305His) rs1555877071
NM_006005.3(WFS1):c.1672C>T (p.Arg558Cys) rs199946797
NM_006005.3(WFS1):c.2096C>T (p.Thr699Met) rs28937894
NM_006005.3(WFS1):c.2171C>T (p.Pro724Leu) rs28937890
NM_006005.3(WFS1):c.2492G>A (p.Gly831Asp) rs28937895
NM_006005.3(WFS1):c.2576G>A (p.Arg859Gln) rs121912618
NM_006009.3(TUBA1A):c.1224C>A (p.Tyr408Ter) rs753719501
NM_006009.3(TUBA1A):c.53A>G (p.Asn18Ser) rs1064795213
NM_006009.4(TUBA1A):c.379G>A (p.Asp127Asn) rs1085308005
NM_006013.4(RPL10):c.232A>G (p.Lys78Glu) rs1131692040
NM_006017.2(PROM1):c.1579-1G>C rs372513650
NM_006019.3(TCIRG1):c.1297C>T (p.Gln433Ter) rs777785526
NM_006019.3(TCIRG1):c.2206C>A (p.Arg736Ser) rs587779413
NM_006086.3(TUBB3):c.292G>A (p.Gly98Ser) rs587784505
NM_006086.3(TUBB3):c.533C>T (p.Thr178Met) rs747480526
NM_006147.3(IRF6):c.1210G>A (p.Glu404Lys) rs769068305
NM_006172.3(NPPA):c.190A>C (p.Ser64Arg) rs61757261
NM_006194.3(PAX9):c.259A>T (p.Ile87Phe) rs104894468
NM_006194.3(PAX9):c.271A>G (p.Lys91Glu) rs28933373
NM_006208.3(ENPP1):c.1756G>A (p.Gly586Arg) rs777367269
NM_006208.3(ENPP1):c.913C>A (p.Pro305Thr) rs374270497
NM_006218.3(PIK3CA):c.1145G>A (p.Arg382Lys) rs587777794
NM_006231.3(POLE):c.1420G>A (p.Val474Ile) rs980578884
NM_006231.3(POLE):c.1A>T (p.Met1Leu) rs878854847
NM_006231.3(POLE):c.2049C>G (p.Tyr683Ter)
NM_006231.3(POLE):c.3019G>C (p.Ala1007Pro) rs747692201
NM_006231.3(POLE):c.5265del (p.Ile1756Serfs) rs1555222342
NM_006260.4(DNAJC3):c.580C>T (p.Arg194Ter) rs727502865
NM_006261.4(PROP1):c.296G>A (p.Arg99Gln) rs137853100
NM_006295.2(VARS):c.1210C>T (p.Arg404Trp) rs749228986
NM_006303.3(AIMP2):c.105C>A (p.Tyr35Ter) rs529613640
NM_006306.3(SMC1A):c.3146G>A (p.Arg1049Gln) rs587784416
NM_006329.3(FBLN5):c.268G>A (p.Gly90Ser) rs144288844
NM_006329.3(FBLN5):c.376G>A (p.Val126Met) rs61734479
NM_006329.3(FBLN5):c.604G>A (p.Gly202Arg) rs80338765
NM_006359.2(SLC9A6):c.430-9_430-5delTTTTA rs796053290
NM_006397.2(RNASEH2A):c.635A>T (p.Asn212Ile) rs377244188
NM_006412.3(AGPAT2):c.335C>T (p.Pro112Leu) rs886063722
NM_006412.3(AGPAT2):c.646A>T (p.Lys216Ter) rs138994150
NM_006432.3(NPC2):c.332delA (p.Asn111Ilefs) rs80358265
NM_006432.4(NPC2):c.190+5G>A rs80358268
NM_006432.4(NPC2):c.441+1G>A rs140130028
NM_006440.5(TXNRD2):c.1341T>G (p.Tyr447Ter) rs202059967
NM_006441.3(MTHFS):c.434G>A (p.Arg145Gln) rs753635972
NM_006441.3(MTHFS):c.484C>T (p.Gln162Ter) rs771379232
NM_006446.4(SLCO1B1):c.1738C>T (p.Arg580Ter) rs71581941
NM_006486.2(FBLN1):c.1190G>T (p.Cys397Phe) rs397509432
NM_006493.2(CLN5):c.1121A>G (p.Tyr374Cys) rs148862100
NM_006493.2(CLN5):c.335G>A (p.Arg112His) rs104894386
NM_006516.3(SLC2A1):c.766_767delAAinsGT (p.Lys256Val) rs80359822
NM_006567.4(FARS2):c.1082C>T (p.Pro361Leu) rs751459058
NM_006567.4(FARS2):c.521_523delTGG (p.Val174del) rs1554169392
NM_006567.4(FARS2):c.919C>T (p.Arg307Ter) rs148620369
NM_006603.4(STAG2):c.1811G>A (p.Arg604Gln)
NM_006618.4(KDM5B):c.4109T>G (p.Leu1370Ter)
NM_006623.3(PHGDH):c.403C>T (p.Arg135Trp) rs267606949
NM_006623.3(PHGDH):c.488G>A (p.Arg163Gln) rs587777483
NM_006651.4(CPLX1):c.382C>A (p.Leu128Met) rs371709824
NM_006657.2(FTCD):c.990dupG (p.Pro331Alafs) rs398124234
NM_006731.2(FKTN):c.1317_1318dupTC (p.Pro440Leufs) rs886042778
NM_006755.1(TALDO1):c.574C>T (p.Arg192Cys) rs751425603
NM_006765.3(TUSC3):c.992C>A (p.Ser331Ter) rs200667343
NM_006766.4(KAT6A):c.4108G>T (p.Glu1370Ter) rs138944476
NM_006767.4(LZTR1):c.1943-256C>T rs761685529
NM_006772.2(SYNGAP1):c.1685C>T (p.Pro562Leu) rs397514670
NM_006772.2(SYNGAP1):c.3583-6G>A rs869312674
NM_006783.4(GJB6):c.689dupA (p.Asn230Lysfs) rs398124237
NM_006790.2(MYOT):c.17G>A (p.Arg6His) rs387906882
NM_006846.3(SPINK5):c.3018T>A (p.Cys1006Ter) rs766978225
NM_006852.3(TLK2):c.2092C>T (p.Arg698Ter) rs1555669421
NM_006852.3(TLK2):c.890G>A (p.Gly297Asp) rs1555639254
NM_006859.3(LIAS):c.746G>A (p.Arg249His) rs144133667
NM_006894.5(FMO3):c.1302G>A (p.Met434Ile) rs72549332
NM_006912.5(RIT1):c.244T>A (p.Phe82Ile) rs869025194
NM_006912.5(RIT1):c.67A>C (p.Lys23Gln) rs869312687
NM_006920.4(SCN1A):c.1216G>T (p.Val406Phe) rs121918768
NM_006920.4(SCN1A):c.1625G>A (p.Arg542Gln) rs121918817
NM_006920.4(SCN1A):c.2552G>A (p.Arg851Gln) rs121918785
NM_006920.4(SCN1A):c.3488C>G (p.Thr1163Ser) rs121918799
NM_006920.5(SCN1A):c.4940C>T (p.Thr1647Met) rs121917922
NM_006929.5(SKIV2L):c.1120C>T (p.Arg374Ter) rs200818962
NM_007055.3(POLR3A):c.1674C>G (p.Phe558Leu) rs267608668
NM_007075.3(WDR45):c.503G>A (p.Gly168Glu) rs1131691592
NM_007077.4(AP4S1):c.289C>T (p.Arg97Ter) rs200440467
NM_007078.2(LDB3):c.1823C>T (p.Pro608Leu) rs145983824
NM_007078.2(LDB3):c.2017G>A (p.Asp673Asn) rs45514002
NM_007078.2(LDB3):c.690-4733G>A rs121908333
NM_007078.2(LDB3):c.690-4789A>T rs121908339
NM_007123.5(USH2A):c.3547_3548delAT (p.Ile1183Phefs) rs397518013
NM_007171.3(POMT1):c.2163C>A (p.Tyr721Ter) rs138902646
NM_007194.3(CHEK2):c.1100delC (p.Thr367Metfs) rs555607708
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011
NM_007194.4(CHEK2):c.3G>A (p.Met1Ile) rs786203977
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961
NM_007194.4(CHEK2):c.539G>A (p.Arg180His) rs137853009
NM_007194.4(CHEK2):c.541C>T (p.Arg181Cys) rs137853010
NM_007194.4(CHEK2):c.542G>A (p.Arg181His) rs121908701
NM_007194.4(CHEK2):c.715G>A (p.Glu239Lys) rs121908702
NM_007254.3(PNKP):c.1029+2T>C rs199919568
NM_007254.3(PNKP):c.1123G>T (p.Gly375Trp) rs786203983
NM_007294.3(BRCA1):c.1105G>A (p.Asp369Asn) rs56056711
NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys) rs80356880
NM_007294.3(BRCA1):c.115T>A (p.Cys39Ser) rs80357164
NM_007294.3(BRCA1):c.115T>C (p.Cys39Arg) rs80357164
NM_007294.3(BRCA1):c.115T>G (p.Cys39Gly) rs80357164
NM_007294.3(BRCA1):c.116G>A (p.Cys39Tyr) rs80357498
NM_007294.3(BRCA1):c.116G>T (p.Cys39Phe) rs80357498
NM_007294.3(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.3(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.3(BRCA1):c.131G>A (p.Cys44Tyr) rs80357446
NM_007294.3(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.3(BRCA1):c.132C>T (p.Cys44=) rs876658362
NM_007294.3(BRCA1):c.134+2delT rs273897657
NM_007294.3(BRCA1):c.134+3A>C rs80358064
NM_007294.3(BRCA1):c.140G>A (p.Cys47Tyr) rs80357150
NM_007294.3(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.3(BRCA1):c.1763_1764delGC (p.Ser588Lysfs) rs879254237
NM_007294.3(BRCA1):c.181T>C (p.Cys61Arg) rs28897672
NM_007294.3(BRCA1):c.182G>A (p.Cys61Tyr) rs80357093
NM_007294.3(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.3(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.3(BRCA1):c.192T>G (p.Cys64Trp) rs587781632
NM_007294.3(BRCA1):c.1961delA (p.Lys654Serfs) rs80357522
NM_007294.3(BRCA1):c.212+3A>G rs80358083
NM_007294.3(BRCA1):c.212G>T (p.Arg71Met) rs80356913
NM_007294.3(BRCA1):c.213-15A>G rs886040903
NM_007294.3(BRCA1):c.243delA (p.Gln81Hisfs) rs273899684
NM_007294.3(BRCA1):c.2507_2508delAA (p.Glu836Glyfs) rs273899686
NM_007294.3(BRCA1):c.301+1G>A rs587782173
NM_007294.3(BRCA1):c.301+1G>C rs587782173
NM_007294.3(BRCA1):c.301+2dupT rs273899694
NM_007294.3(BRCA1):c.3342_3345delAGAA (p.Glu1115Terfs) rs397509058
NM_007294.3(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.3(BRCA1):c.4050_4051insG (p.Leu1351Valfs) rs483353092
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.3(BRCA1):c.4357+6T>C rs80358143
NM_007294.3(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.3(BRCA1):c.4485-2A>G rs80358054
NM_007294.3(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.3(BRCA1):c.4885dup (p.Glu1629Glyfs) rs886040254
NM_007294.3(BRCA1):c.4903G>T (p.Glu1635Ter) rs200432771
NM_007294.3(BRCA1):c.4963T>C (p.Ser1655Pro) rs1057518639
NM_007294.3(BRCA1):c.4964C>T (p.Ser1655Phe) rs80357390
NM_007294.3(BRCA1):c.4986+5G>A rs397509211
NM_007294.3(BRCA1):c.4987-5T>C rs397509214
NM_007294.3(BRCA1):c.5053A>G (p.Thr1685Ala) rs80356890
NM_007294.3(BRCA1):c.5054C>T (p.Thr1685Ile) rs80357043
NM_007294.3(BRCA1):c.5062_5064delGTT (p.Val1688del) rs80358344
NM_007294.3(BRCA1):c.5066T>G (p.Met1689Arg) rs80357061
NM_007294.3(BRCA1):c.5072C>T (p.Thr1691Ile) rs80357034
NM_007294.3(BRCA1):c.5074+3A>G rs80358181
NM_007294.3(BRCA1):c.5078_5080delCTG (p.Ala1693del) rs80358345
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5116G>A (p.Gly1706Arg) rs886040864
NM_007294.3(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.3(BRCA1):c.5143A>C (p.Ser1715Arg) rs80357222
NM_007294.3(BRCA1):c.5145C>G (p.Ser1715Arg) rs80357094
NM_007294.3(BRCA1):c.5152+5G>A rs80358165
NM_007294.3(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.3(BRCA1):c.5193+3_5193+15del rs273901752
NM_007294.3(BRCA1):c.5194-12G>A rs80358079
NM_007294.3(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.3(BRCA1):c.5212G>A (p.Gly1738Arg) rs80356937
NM_007294.3(BRCA1):c.5213G>A (p.Gly1738Glu) rs80357450
NM_007294.3(BRCA1):c.5216A>T (p.Asp1739Val) rs80357227
NM_007294.3(BRCA1):c.5246C>G (p.Pro1749Arg) rs80357462
NM_007294.3(BRCA1):c.5277G>A (p.Lys1759=) rs80356854
NM_007294.3(BRCA1):c.5291T>C (p.Leu1764Pro) rs80357281
NM_007294.3(BRCA1):c.5297T>G (p.Ile1766Ser) rs80357463
NM_007294.3(BRCA1):c.5324T>G (p.Met1775Arg) rs41293463
NM_007294.3(BRCA1):c.5332G>A (p.Asp1778Asn) rs80357112
NM_007294.3(BRCA1):c.5339T>C (p.Leu1780Pro) rs80357474
NM_007294.3(BRCA1):c.5359T>A (p.Cys1787Ser) rs80357065
NM_007294.3(BRCA1):c.5363G>A (p.Gly1788Asp) rs80357069
NM_007294.3(BRCA1):c.5406+4_5406+7delAGTA rs1555575073
NM_007294.3(BRCA1):c.5406+5G>A rs80358073
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5434C>G (p.Pro1812Ala) rs1800751
NM_007294.3(BRCA1):c.5453A>G (p.Asp1818Gly) rs80357477
NM_007294.3(BRCA1):c.5464_5465insT (p.His1822Leufs) rs273902769
NM_007294.3(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.3(BRCA1):c.5513T>A (p.Val1838Glu) rs80357107
NM_007294.3(BRCA1):c.5524_5531delGTAGCACT (p.Val1842Leufs) rs879255287
NM_007294.3(BRCA1):c.594-2A>C rs80358033
NM_007294.3(BRCA1):c.61delA (p.Ile21Serfs) rs273902778
NM_007294.3(BRCA1):c.65T>C (p.Leu22Ser) rs80357438
NM_007294.3(BRCA1):c.670+1G>T rs398122706
NM_007294.3(BRCA1):c.670+1delG rs886040922
NM_007294.3(BRCA1):c.671-2A>G rs80358108
NM_007294.3(BRCA1):c.70T>C (p.Cys24Arg) rs80357410
NM_007294.3(BRCA1):c.80+5G>A rs80358045
NM_007315.3(STAT1):c.796G>A (p.Val266Ile) rs41473544
NM_007327.3(GRIN1):c.2479G>A (p.Gly827Arg) rs1451230055
NM_007373.3(SHOC2):c.519G>A (p.Met173Ile) rs730881020
NM_007375.3(TARDBP):c.1150G>C (p.Gly384Arg) rs797044594
NM_007375.3(TARDBP):c.506A>G (p.Asp169Gly) rs80356717
NM_007375.3(TARDBP):c.859G>A (p.Gly287Ser) rs80356719
NM_012062.4(DNM1L):c.1048G>A (p.Gly350Arg) rs879255689
NM_012082.3(ZFPM2):c.1632G>A (p.Met544Ile) rs187043152
NM_012123.3(MTO1):c.1450C>T (p.Arg484Trp) rs748152539
NM_012144.3(DNAI1):c.1490G>A (p.Gly497Asp) rs376252276
NM_012144.3(DNAI1):c.1703G>C (p.Trp568Ser) rs772686744
NM_012160.4(FBXL4):c.1790A>C (p.Gln597Pro) rs201989042
NM_012188.4(FOXI1):c.773G>A (p.Gly258Glu) rs121909340
NM_012210.3(TRIM32):c.1181G>A (p.Arg394His) rs121434447
NM_012213.2(MLYCD):c.475delG (p.Ala159Profs) rs796051991
NM_012268.4(PLD3):c.923T>C (p.Leu308Pro) rs537053537
NM_012275.2(IL36RN):c.28C>T (p.Arg10Ter) rs397514630
NM_012275.2(IL36RN):c.338C>T (p.Ser113Leu) rs144478519
NM_012434.4(SLC17A5):c.500T>C (p.Leu167Pro) rs587779410
NM_012452.2(TNFRSF13B):c.204dupA (p.Leu69Thrfs) rs72553875
NM_012452.2(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412
NM_012452.2(TNFRSF13B):c.512T>G (p.Leu171Arg) rs143027621
NM_012452.2(TNFRSF13B):c.542C>A (p.Ala181Glu) rs72553883
NM_012452.2(TNFRSF13B):c.605G>A (p.Arg202His) rs104894649
NM_012472.4(LRRC6):c.79_80delTC (p.Ser27Valfs) rs769220870
NM_012479.3(YWHAG):c.44A>C (p.Glu15Ala) rs1554618767
NM_013279.3(MYRF):c.2309+1G>A rs1057518279
NM_013334.3(GMPPB):c.1069G>A (p.Val357Ile) rs199922550
NM_013334.3(GMPPB):c.95C>T (p.Pro32Leu) rs397509426
NM_013382.5(POMT2):c.1238G>C (p.Arg413Pro) rs190285831
NM_013382.5(POMT2):c.1261C>T rs727502855
NM_013382.5(POMT2):c.2242T>C (p.Trp748Arg) rs267606964
NM_013382.5(POMT2):c.593T>A (p.Ile198Asn) rs267606972
NM_013444.3(UBQLN2):c.1525C>T (p.Pro509Ser) rs387906712
NM_014000.2(VCL):c.2923C>T (p.Arg975Trp) rs121917776
NM_014000.2(VCL):c.829C>A (p.Leu277Met) rs71579353
NM_014003.4(DHX38):c.995G>A (p.Gly332Asp) rs587777554
NM_014043.3(CHMP2B):c.311C>A (p.Thr104Asn) rs281864934
NM_014043.3(CHMP2B):c.85A>G (p.Ile29Val) rs63750818
NM_014139.2(SCN11A):c.3473T>C (p.Leu1158Pro) rs141686175
NM_014141.5(CNTNAP2):c.1249G>T (p.Asp417Tyr) rs147815978
NM_014141.5(CNTNAP2):c.2147A>G (p.Tyr716Cys) rs760930032
NM_014141.5(CNTNAP2):c.2290C>A (p.His764Asn) rs201446615
NM_014141.5(CNTNAP2):c.2651G>A (p.Arg884Gln) rs758630057
NM_014141.5(CNTNAP2):c.3577G>A (p.Ala1193Thr) rs751491210
NM_014141.5(CNTNAP2):c.755-5C>T rs369675346
NM_014159.6(SETD2):c.19C>T (p.Gln7Ter) rs541943893
NM_014165.4(NDUFAF4):c.7G>C (p.Ala3Pro) rs1554197721
NM_014191.3(SCN8A):c.1588C>T (p.Arg530Trp) rs761336234
NM_014191.3(SCN8A):c.2549G>A (p.Arg850Gln) rs587780586
NM_014191.3(SCN8A):c.3955G>T (p.Ala1319Ser) rs796053214
NM_014191.3(SCN8A):c.4351G>A (p.Gly1451Ser) rs863223345
NM_014191.3(SCN8A):c.4441A>G (p.Met1481Val) rs886041670
NM_014191.3(SCN8A):c.4850G>A (p.Arg1617Gln) rs587777721
NM_014191.3(SCN8A):c.5630A>G (p.Asn1877Ser) rs587780455
NM_014239.3(EIF2B2):c.514C>T (p.Arg172Ter) rs758398310
NM_014249.3(NR2E3):c.227G>A (p.Arg76Gln) rs104894493
NM_014251.2(SLC25A13):c.1063C>T (p.Arg355Ter) rs758827458
NM_014251.2(SLC25A13):c.1763G>A (p.Arg588Gln) rs121908532
NM_014254.2(RXYLT1):c.1016A>G (p.Tyr339Cys) rs150736997
NM_014254.2(RXYLT1):c.1019_1020delGAinsTT (p.Arg340Leu) rs397514544
NM_014362.3(HIBCH):c.196C>T (p.Arg66Trp) rs757976755
NM_014363.5(SACS):c.10907G>A (p.Arg3636Gln) rs281865119
NM_014384.2(ACAD8):c.905G>A (p.Arg302Gln) rs121908422
NM_014384.2(ACAD8):c.958G>A (p.Ala320Thr) rs200620279
NM_014384.2(ACAD8):c.988C>T (p.Arg330Trp) rs121908420
NM_014425.3(INVS):c.2782C>T (p.Arg928Ter) rs376879175
NM_014491.3(FOXP2):c.1789A>C (p.Asn597His) rs766476648
NM_014491.3(FOXP2):c.50A>T (p.Gln17Leu) rs201649896
NM_014625.3(NPHS2):c.413G>A (p.Arg138Gln) rs74315342
NM_014625.3(NPHS2):c.467dup (p.Leu156Phefs) rs528833893
NM_014625.3(NPHS2):c.686G>A (p.Arg229Gln) rs61747728
NM_014625.3(NPHS2):c.779T>A (p.Val260Glu) rs775006954
NM_014727.2(KMT2B):c.7549C>T (p.Arg2517Trp) rs1057519285
NM_014795.3(ZEB2):c.298_300delAAC (p.Asn100del) rs587776610
NM_014845.5(FIG4):c.50T>C (p.Leu17Pro) rs587777713
NM_014855.2(AP5Z1):c.412C>T (p.Arg138Ter) rs778457903
NM_014874.3(MFN2):c.1403G>A (p.Arg468His) rs138382758
NM_014874.3(MFN2):c.311G>T (p.Arg104Leu) rs863224068
NM_014941.3(MORC2):c.521A>G (p.Glu174Gly) rs886037934
NM_014946.3(SPAST):c.1276C>T (p.Leu426Phe) rs1060502227
NM_014946.3(SPAST):c.1496G>A (p.Arg499His) rs878854991
NM_014946.3(SPAST):c.1676G>A (p.Gly559Asp) rs864622179
NM_014956.4(CEP164):c.4228C>T (p.Gln1410Ter) rs147398904
NM_014985.3(CEP152):c.2034T>G (p.Tyr678Ter) rs182018947
NM_015041.2(CLUAP1):c.817C>T (p.Leu273Phe) rs751218423
NM_015047.2(EMC1):c.1411G>C (p.Gly471Arg) rs879253819
NM_015047.2(EMC1):c.245C>T (p.Thr82Met) rs869320625
NM_015047.2(EMC1):c.2602G>A (p.Gly868Arg) rs869320626
NM_015100.3(POGZ):c.1180_1181delAT (p.Met394Valfs) rs1057518170
NM_015141.3(GPD1L):c.247G>A (p.Glu83Lys) rs72552292
NM_015141.3(GPD1L):c.817C>T (p.Arg273Cys) rs72552294
NM_015141.3(GPD1L):c.839C>T (p.Ala280Val) rs72552291
NM_015166.3(MLC1):c.839C>T (p.Ser280Leu) rs121908341
NM_015213.3(DENND5A):c.1622A>G (p.Asp541Gly) rs1057519309
NM_015231.2(NUP160):c.2407G>A (p.Glu803Lys)
NM_015231.2(NUP160):c.2728C>T (p.Arg910Ter)
NM_015265.3(SATB2):c.674G>A (p.Trp225Ter) rs1553493553
NM_015268.3(DNAJC13):c.2564A>G (p.Asn855Ser) rs387907571
NM_015272.2(RPGRIP1L):c.2614C>T (p.Gln872Ter) rs121918203
NM_015272.2(RPGRIP1L):c.697A>T (p.Lys233Ter) rs121918197
NM_015272.4(RPGRIP1L):c.685G>A (p.Ala229Thr) rs61747071
NM_015284.3(SZT2):c.5344C>T (p.Arg1782Cys) rs147748994
NM_015295.2(SMCHD1):c.1655G>A (p.Arg552Gln) rs886042392
NM_015335.4(MED13L):c.752A>G (p.Glu251Gly) rs28940309
NM_015338.5(ASXL1):c.1544_1545delTG (p.Val515Glyfs) rs777537805
NM_015386.2(COG4):c.1546G>A (p.Gly516Arg) rs1555575860
NM_015474.3(SAMHD1):c.1324C>T (p.Arg442Ter) rs369587937
NM_015474.3(SAMHD1):c.602T>A (p.Ile201Asn) rs138603088
NM_015506.2(MMACHC):c.271dupA rs398124292
NM_015506.2(MMACHC):c.82-11_82-8delTTCT rs751236442
NM_015559.3(SETBP1):c.2612T>C (p.Ile871Thr) rs267607038
NM_015560.2(OPA1):c.1146A>G (p.Ile382Met) rs143319805
NM_015627.2(LDLRAP1):c.605C>A (p.Ser202Tyr) rs121908326
NM_015636.3(EIF2B4):c.1067G>A (p.Arg356Gln) rs113994033
NM_015681.3(B9D1):c.95A>G (p.Tyr32Cys) rs771170000
NM_015681.4(B9D1):c.285C>A (p.Phe95Leu) rs373478202
NM_015697.8(COQ2):c.683A>G (p.Asn228Ser) rs121918232
NM_015713.4(RRM2B):c.431C>T (p.Thr144Ile) rs515726189
NM_015713.4(RRM2B):c.606T>A (p.Phe202Leu) rs515726194
NM_015713.4(RRM2B):c.817G>A (p.Gly273Ser) rs387906891
NM_015713.4(RRM2B):c.97C>T (p.Pro33Ser) rs387906892
NM_015723.4(PNPLA8):c.2275_2276delCT (p.Leu759Alafs) rs774184465
NM_015836.3(WARS2):c.298_300delCTT (p.Leu100del) rs772867219
NM_015836.3(WARS2):c.797delC (p.Pro266Argfs) rs746478253
NM_015836.3(WARS2):c.938A>T (p.Lys313Met) rs145867327
NM_015869.4(PPARG):c.1484C>T (p.Pro495Leu) rs121909244
NM_015910.6(WDPCP):c.160G>A (p.Asp54Asn) rs200322968
NM_015915.4(ATL1):c.196G>C (p.Glu66Gln) rs200314808
NM_015915.4(ATL1):c.478T>C (p.Ser160Pro) rs886041897
NM_015981.3(CAMK2A):c.704C>T (p.Pro235Leu) rs864309606
NM_016035.4(COQ4):c.202G>C (p.Asp68His) rs758522459
NM_016038.3(SBDS):c.24C>A (p.Asn8Lys) rs28942099
NM_016038.3(SBDS):c.505C>T (p.Arg169Cys) rs113993996
NM_016042.3(EXOSC3):c.475-12A>G rs370087266
NM_016111.3(TELO2):c.2159A>T (p.Asp720Val) rs878853271
NM_016180.4(SLC45A2):c.1076_1077delAG (p.Glu359Valfs) rs753485165
NM_016180.4(SLC45A2):c.1082T>C (p.Leu361Pro) rs121912619
NM_016188.5(ACTL6B):c.1027G>A (p.Gly343Arg) rs1131692228
NM_016203.3(PRKAG2):c.1148A>G (p.His383Arg) rs121908988
NM_016203.3(PRKAG2):c.1592G>T (p.Arg531Leu) rs121908991
NM_016218.3(POLK):c.410C>T (p.Ser137Phe) rs863225454
NM_016222.3(DDX41):c.3G>A (p.Met1Ile) rs141601766
NM_016239.3(MYO15A):c.5925G>A (p.Trp1975Ter) rs375290498
NM_016239.3(MYO15A):c.6589C>T (p.Gln2197Ter) rs779445819
NM_016239.3(MYO15A):c.6764+2T>A rs763975867
NM_016239.3(MYO15A):c.9861C>T (p.Gly3287=) rs372466080
NM_016327.2(UPB1):c.209G>C (p.Arg70Pro) rs121908066
NM_016335.4(PRODH):c.1322T>C (p.Leu441Pro) rs2904551
NM_016335.4(PRODH):c.1357C>T (p.Arg453Cys) rs3970559
NM_016335.4(PRODH):c.865T>A (p.Leu289Met) rs137852934
NM_016373.3(WWOX):c.1115G>A (p.Gly372Glu) rs1064793798
NM_016373.3(WWOX):c.990C>G (p.Asn330Lys) rs117209694
NM_016434.3(RTEL1):c.2957G>A (p.Arg986Gln) rs146221660
NM_016464.4(TMEM138):c.389A>G (p.Tyr130Cys) rs387907135
NM_016579.3(CD320):c.262_264delGAG (p.Glu88del) rs150384171
NM_016725.2(FOLR1):c.493+2T>C rs144637717
NM_016941.3(DLL3):c.618delC (p.Cys207Alafs) rs786200902
NM_017534.5(MYH2):c.2725G>T (p.Glu909Ter) rs780124402
NM_017547.3(FOXRED1):c.612_615dupAGTG (p.Ala206Serfs) rs398124308
NM_017563.4(IL17RD):c.392A>C (p.Lys131Thr) rs184758350
NM_017617.5(NOTCH1):c.1669+5G>A rs771590616
NM_017635.4(KMT5B):c.791G>C (p.Trp264Ser) rs1555028104
NM_017636.3(TRPM4):c.1294G>A (p.Ala432Thr) rs201907325
NM_017636.3(TRPM4):c.1744G>A (p.Gly582Ser) rs172149856
NM_017636.3(TRPM4):c.2531G>A (p.Gly844Asp) rs200038418
NM_017646.5(TRIT1):c.1204C>T (p.Arg402Ter) rs367752391
NM_017646.5(TRIT1):c.1256A>C (p.His419Pro) rs566435653
NM_017646.5(TRIT1):c.22C>T (p.Arg8Ter) rs184469579
NM_017646.5(TRIT1):c.848T>G (p.Ile283Ser) rs199622789
NM_017646.5(TRIT1):c.856A>G (p.Lys286Glu) rs1060505019
NM_017646.5(TRIT1):c.968G>A (p.Arg323Gln) rs1047420796
NM_017653.4(DYM):c.259G>A (p.Glu87Lys) rs120074164
NM_017654.4(SAMD9):c.3381C>A (p.Tyr1127Ter) rs572380130
NM_017721.4(CC2D1A):c.1739C>T (p.Thr580Ile) rs202057391
NM_017721.4(CC2D1A):c.2657G>A (p.Arg886His) rs201921029
NM_017739.3(POMGNT1):c.1285-2A>G rs386834012
NM_017739.3(POMGNT1):c.1895+1G>T rs386834024
NM_017777.3(MKS1):c.1382A>G (p.Tyr461Cys) rs730882120
NM_017777.3(MKS1):c.1408-34_1408-6del29 rs386834043
NM_017777.3(MKS1):c.1476T>G (p.Cys492Trp) rs137853105
NM_017777.3(MKS1):c.1601G>A (p.Arg534Gln) rs199910690
NM_017777.3(MKS1):c.233T>G (p.Ile78Ser) rs786204222
NM_017777.3(MKS1):c.417G>A (p.Glu139=) rs386834048
NM_017780.3(CHD7):c.5405-17G>A rs794727423
NM_017791.2(FLVCR2):c.329_334delACATCT (p.Asn110_Phe112delinsIle) rs746459536
NM_017791.2(FLVCR2):c.839C>G (p.Pro280Arg) rs267606823
NM_017825.3(ADPRHL2):c.1004T>G (p.Val335Gly)
NM_017831.3(RNF125):c.488C>T (p.Ser163Leu) rs373764886
NM_017841.2(SDHAF2):c.165G>A (p.Trp55Ter) rs774508076
NM_017882.2(CLN6):c.139C>T (p.Leu47Phe) rs154774635
NM_017882.2(CLN6):c.307C>T (p.Arg103Trp) rs201095412
NM_017882.2(CLN6):c.308G>A (p.Arg103Gln) rs154774634
NM_017882.2(CLN6):c.755G>A (p.Arg252His) rs374681194
NM_017882.2(CLN6):c.794_796delCCT (p.Ser265del) rs768422260
NM_017890.4(VPS13B):c.2591C>A (p.Ser864Ter) rs140936527
NM_017890.4(VPS13B):c.5983+2dupT rs587777381
NM_017890.4(VPS13B):c.6370_6371delAT rs748404277
NM_017890.4(VPS13B):c.7934G>A (p.Gly2645Asp) rs120074153
NM_017890.4(VPS13B):c.8978A>G (p.Asn2993Ser) rs28940272
NM_017909.3(RMND1):c.713A>G rs144972972
NM_017929.5(PEX26):c.134T>C (p.Leu45Pro) rs61752132
NM_017934.5(PHIP):c.2902C>T (p.Arg968Ter) rs200788163
NM_017947.3(MOCOS):c.1255C>T (p.Arg419Ter) rs142150953
NM_017950.3(CCDC40):c.1312A>T (p.Lys438Ter)
NM_018006.4(TRMU):c.37_48dupGGCGGCGTGGAC (p.Asp16_Ser17insGlyGlyValAsp) rs863224243
NM_018051.4(WDR60):c.1777C>T (p.Arg593Trp) rs776300442
NM_018055.4(NODAL):c.548G>A (p.Arg183Gln) rs104894169
NM_018060.3(IARS2):c.1821G>A (p.Trp607Ter) rs373436822
NM_018060.3(IARS2):c.2122G>A (p.Glu708Lys) rs143722284
NM_018062.3(FANCL):c.1007_1009delTAT (p.Ile336_Cys337delinsSer) rs747253294
NM_018075.4(ANO10):c.1843G>A (p.Asp615Asn) rs138000380
NM_018082.5(POLR3B):c.1244T>C (p.Met415Thr) rs199504211
NM_018100.3(EFHC1):c.1612C>T (p.Arg538Ter) rs149998588
NM_018127.6(ELAC2):c.1641dup (p.His548Alafs) rs387906327
NM_018127.6(ELAC2):c.2342G>A (p.Arg781His) rs119484086
NM_018127.6(ELAC2):c.297-2_297-1delinsT rs1060502161
NM_018129.3(PNPO):c.686G>A (p.Arg229Gln) rs773450573
NM_018136.4(ASPM):c.9539A>C (p.Gln3180Pro) rs193251130
NM_018249.5(CDK5RAP2):c.524_528delAGGCA (p.Gln175Argfs) rs587783393
NM_018344.5(SLC29A3):c.1087C>T (p.Arg363Trp) rs387907067
NM_018344.5(SLC29A3):c.73C>T (p.Arg25Ter) rs746408350
NM_018389.4(SLC35C1):c.503_505delTCT (p.Phe168del) rs587777655
NM_018400.3(SCN3B):c.29T>C (p.Leu10Pro) rs121918282
NM_018400.3(SCN3B):c.328G>A (p.Val110Ile) rs147205617
NM_018400.3(SCN3B):c.389C>T (p.Ala130Val) rs587777556
NM_018451.3(CENPJ):c.2704C>T (p.Arg902Ter) rs374057641
NM_018451.4(CENPJ):c.2462C>T (p.Thr821Met) rs144938364
NM_018486.2(HDAC8):c.958G>A (p.Gly320Arg) rs398122909
NM_018706.5(DHTKD1):c.2185G>A rs117225135
NM_018718.2(CEP41):c.107T>C (p.Met36Thr) rs368178632
NM_018848.3(MKKS):c.830T>C (p.Leu277Pro) rs74315398
NM_018849.2(ABCB4):c.1637C>A (p.Ala546Asp) rs121918441
NM_018849.2(ABCB4):c.2906G>A (p.Arg969His) rs752916287
NM_018849.2(ABCB4):c.3502C>T (p.Pro1168Ser) rs121918442
NM_018896.4(CACNA1G):c.2881G>A (p.Ala961Thr) rs886041505
NM_018941.3(CLN8):c.703delC (p.Val236Serfs) rs761621368
NM_018972.3(GDAP1):c.692C>T (p.Pro231Leu) rs121908114
NM_019074.4(DLL4):c.799C>A (p.Pro267Thr) rs796065349
NM_019098.4(CNGB3):c.1148delC (p.Thr383Ilefs) rs397515360
NM_019098.4(CNGB3):c.1208G>A rs147876778
NM_019098.4(CNGB3):c.1405T>G (p.Tyr469Asp) rs35365413
NM_019105.6(TNXB):c.3322G>A (p.Val1108Met) rs121912575
NM_019892.5(INPP5E):c.944C>T (p.Pro315Leu) rs754637179
NM_020041.2(SLC2A9):c.1138C>T (p.Arg380Trp) rs121908321
NM_020070.3(IGLL1):c.258delG (p.Gln88Asnfs) rs532338576
NM_020166.3(MCCC1):c.640_641delGG (p.Gly214Asnfs) rs886058209
NM_020166.4(MCCC1):c.137G>A (p.Gly46Glu) rs199517715
NM_020191.2(MRPS22):c.404G>A (p.Arg135Gln) rs774237195
NM_020247.4(COQ8A):c.1844dupG (p.Ser616Leufs) rs764847439
NM_020247.4(COQ8A):c.811C>T (p.Arg271Cys) rs145034527
NM_020247.4(COQ8A):c.993C>T (p.Phe331=) rs41303129
NM_020297.3(ABCC9):c.4512+814C>T rs387906805
NM_020320.4(RARS2):c.35A>G (p.Gln12Arg) rs147391618
NM_020361.4(CPA6):c.557A>G (p.Lys186Arg) rs199576384
NM_020361.4(CPA6):c.619C>G (p.Gln207Glu) rs35993949
NM_020361.4(CPA6):c.799G>A (p.Gly267Arg) rs61738009
NM_020361.4(CPA6):c.809C>T (p.Ala270Val) rs114402678
NM_020366.3(RPGRIP1):c.1611G>A (p.Gln537=) rs1064797181
NM_020366.3(RPGRIP1):c.2302C>T (p.Arg768Ter)
NM_020458.3(TTC7A):c.211G>A (p.Glu71Lys) rs147914967
NM_020549.4(CHAT):c.1061C>T (p.Thr354Met) rs769234940
NM_020549.4(CHAT):c.406G>A (p.Val136Met) rs201479289
NM_020549.4(CHAT):c.620G>A (p.Arg207His) rs764497513
NM_020630.4(RET):c.3116C>T (p.Pro1039Leu) rs79853121
NM_020630.5(RET):c.1942G>A (p.Val648Ile) rs77711105
NM_020630.5(RET):c.2372A>T (p.Tyr791Phe) rs77724903
NM_020630.5(RET):c.874G>A (p.Val292Met) rs34682185
NM_020632.2(ATP6V0A4):c.1571C>T (p.Pro524Leu) rs121908368
NM_020638.2(FGF23):c.211A>G (p.Ser71Gly) rs104894342
NM_020639.2(RIPK4):c.488G>A (p.Gly163Asp)
NM_020686.6(ABAT):c.1394G>A (p.Gly465Asp) rs1057523345
NM_020705.2(TBC1D24):c.845C>G (p.Pro282Arg) rs747538224
NM_020732.3(ARID1B):c.4110G>A (p.Pro1370=) rs797045277
NM_020774.3(MIB1):c.1588C>T (p.Arg530Ter) rs201850378
NM_020778.4(ALPK3):c.3781C>T (p.Arg1261Ter) rs749465164
NM_020800.2(IFT80):c.1093A>G (p.Thr365Ala) rs140202230
NM_020800.2(IFT80):c.721G>C (p.Gly241Arg) rs138004478
NM_020806.4(GPHN):c.28A>T (p.Asn10Tyr) rs121908539
NM_020822.2(KCNT1):c.1066C>T (p.Arg356Trp) rs752514808
NM_020822.2(KCNT1):c.2794T>A (p.Phe932Ile) rs886044717
NM_020822.2(KCNT1):c.2849G>A (p.Arg950Gln) rs886043455
NM_020822.2(KCNT1):c.3641G>A (p.Arg1214Gln) rs138282349
NM_020937.3(FANCM):c.5791C>T (p.Arg1931Ter) rs144567652
NM_020964.2(EPG5):c.4007G>A (p.Gly1336Glu) rs1085308061
NM_020971.2(SPTBN4):c.2709G>A (p.Trp903Ter) rs864309618
NM_020975.4(RET):c.1947G>A (p.Ser649=) rs377767412
NM_020975.4(RET):c.1998G>C (p.Lys666Asn) rs146646971
NM_020975.4(RET):c.2342A>G (p.Gln781Arg) rs377767416
NM_020975.4(RET):c.2647G>A (p.Ala883Thr) rs377767428
NM_020975.5(RET):c.1642G>A (p.Gly548Ser) rs374461212
NM_020988.2(GNAO1):c.118G>C (p.Gly40Arg) rs886041715
NM_021007.2(SCN2A):c.3457G>A (p.Glu1153Lys) rs200138205
NM_021007.2(SCN2A):c.4877G>A (p.Arg1626Gln) rs796053155
NM_021007.2(SCN2A):c.4879G>A (p.Val1627Met) rs796053156
NM_021007.2(SCN2A):c.4886G>A (p.Arg1629His) rs796053157
NM_021007.2(SCN2A):c.5645G>A (p.Arg1882Gln) rs794727444
NM_021008.3(DEAF1):c.791A>C (p.Gln264Pro) rs587777407
NM_021629.3(GNB4):c.229G>A (p.Gly77Arg) rs1553851490
NM_021815.4(SLC5A7):c.313C>T (p.Pro105Ser) rs886039766
NM_021830.4(TWNK):c.1196A>G (p.Asn399Ser) rs863223921
NM_021830.4(TWNK):c.1519G>A (p.Val507Ile) rs369588002
NM_021957.3(GYS2):c.1436C>A (p.Pro479Gln) rs121918420
NM_021957.3(GYS2):c.1472T>G (p.Met491Arg) rs121918422
NM_022068.3(PIEZO2):c.5895G>A (p.Trp1965Ter) rs1555627917
NM_022089.3(ATP13A2):c.348-9_351del rs749798211
NM_022095.3(ZNF335):c.2171_2173delTCT (p.Phe724del) rs773283542
NM_022095.4(ZNF335):c.3998A>G (p.Glu1333Gly)
NM_022124.5(CDH23):c.2866G>A (p.Glu956Lys) rs756147087
NM_022124.5(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.5(CDH23):c.6442G>A (p.Asp2148Asn) rs111033271
NM_022124.5(CDH23):c.7903G>T (p.Val2635Phe) rs763721044
NM_022124.5(CDH23):c.902G>A (p.Arg301Gln) rs121908355
NM_022124.5(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_022132.4(MCCC2):c.1015G>A (p.Val339Met) rs150591260
NM_022132.4(MCCC2):c.1309A>G (p.Ile437Val) rs119103224
NM_022132.4(MCCC2):c.1367_1368inv (p.Ala456Val) rs1554138479
NM_022132.4(MCCC2):c.499T>C (p.Cys167Arg) rs119103222
NM_022132.4(MCCC2):c.568C>T (p.His190Tyr) rs773774134
NM_022132.4(MCCC2):c.803G>C (p.Arg268Thr) rs119103223
NM_022154.5(SLC39A8):c.1019T>A rs864309659
NM_022154.5(SLC39A8):c.610G>T rs779241085
NM_022336.3(EDAR):c.259T>C (p.Cys87Arg) rs121908451
NM_022370.3(ROBO3):c.733C>T (p.Arg245Trp) rs121918277
NM_022437.2(ABCG8):c.788G>A (p.Arg263Gln) rs137852990
NM_022437.2(ABCG8):c.965-1G>C rs957176669
NM_022445.3(TPK1):c.119T>C (p.Leu40Pro) rs387906936
NM_022454.3(SOX17):c.532G>T (p.Gly178Cys) rs267607082
NM_022726.3(ELOVL4):c.215delC (p.Pro72Leufs)
NM_022844.2(MYH11):c.2135G>A (p.Arg712Gln) rs267606902
NM_022912.2(REEP1):c.*43G>T rs377637314
NM_023073.3(CPLANE1):c.2624C>T (p.Ser875Phe) rs794727154
NM_023073.3(CPLANE1):c.3599C>T (p.Ala1200Val) rs141153181
NM_023073.3(CPLANE1):c.424G>A (p.Glu142Lys) rs756856188
NM_023073.3(CPLANE1):c.6700C>T (p.Gln2234Ter)
NM_023073.3(CPLANE1):c.7957+288G>A rs111294855
NM_023073.3(CPLANE1):c.968C>T (p.Thr323Met) rs373704405
NM_023110.2(FGFR1):c.1880G>C (p.Arg627Thr) rs869025671
NM_023110.2(FGFR1):c.443G>A (p.Arg148His) rs515726222
NM_023110.2(FGFR1):c.899T>C (p.Ile300Thr) rs121909633
NM_024009.2(GJB3):c.196_198del (p.Asp66del) rs786200895
NM_024009.2(GJB3):c.538C>T (p.Arg180Ter) rs74315319
NM_024009.2(GJB3):c.547G>A (p.Glu183Lys) rs74315318
NM_024022.2(TMPRSS3):c.325C>T (p.Arg109Trp) rs201632198
NM_024079.4(ALG8):c.856T>G (p.Trp286Gly) rs794727931
NM_024301.4(FKRP):c.1433T>C (p.Ile478Thr) rs1301397800
NM_024301.4(FKRP):c.400C>T (p.Arg134Trp) rs104894690
NM_024301.4(FKRP):c.946C>A (p.Pro316Thr) rs28937901
NM_024306.4(FA2H):c.703C>T (p.Arg235Cys) rs387907039
NM_024312.4(GNPTAB):c.1774G>A (p.Ala592Thr) rs149390820
NM_024312.4(GNPTAB):c.569A>T (p.Asp190Val) rs34946266
NM_024334.2(TMEM43):c.169G>A (p.Ala57Thr) rs151010429
NM_024334.2(TMEM43):c.271A>G (p.Ile91Val) rs144811578
NM_024339.4(THOC6):c.748A>C (p.Thr250Pro) rs1555498821
NM_024408.3(NOTCH2):c.5857C>T (p.Arg1953Cys) rs312262796
NM_024408.3(NOTCH2):c.5858G>A (p.Arg1953His) rs312262797
NM_024494.2(WNT2B):c.313C>T (p.Arg105Ter) rs879255420
NM_024531.4(SLC52A2):c.1088C>T (p.Pro363Leu) rs797045202
NM_024531.4(SLC52A2):c.935T>C (p.Leu312Pro) rs754320812
NM_024577.3(SH3TC2):c.1384G>T (p.Glu462Ter) rs749850181
NM_024577.3(SH3TC2):c.505T>C (p.Tyr169His) rs80359890
NM_024580.6(EFL1):c.3284G>A (p.Arg1095Gln) rs376095522
NM_024589.2(ROGDI):c.45+9_45+20delCGCGGGCCAGCG rs772340154
NM_024592.4(SRD5A3):c.603G>A (p.Trp201Ter) rs765191836
NM_024596.3(MCPH1):c.2145G>A (p.Trp715Ter) rs201599657
NM_024649.4(BBS1):c.1553T>C (p.Leu518Pro) rs121917778
NM_024649.4(BBS1):c.416G>A (p.Trp139Ter) rs878855095
NM_024675.3(PALB2):c.172_175delTTGT (p.Gln60Argfs) rs180177143
NM_024675.3(PALB2):c.3113G>A (p.Trp1038Ter) rs180177132
NM_024675.3(PALB2):c.3201+1G>C rs587776423
NM_024675.3(PALB2):c.3350+4A>G rs180177136
NM_024685.4(BBS10):c.101G>C (p.Arg34Pro) rs137852836
NM_024685.4(BBS10):c.32T>G (p.Val11Gly) rs137852838
NM_024685.4(BBS10):c.530A>G (p.Tyr177Cys) rs1555202700
NM_024747.5(HPS6):c.238dup (p.Asp80Glyfs) rs281865108
NM_024809.4(TCTN2):c.1117G>A (p.Gly373Arg) rs187433682
NM_024844.4(NUP85):c.1430C>T (p.Ala477Val)
NM_024887.3(DHDDS):c.110G>A (p.Arg37His) rs1553121073
NM_024921.3(POF1B):c.986G>A (p.Arg329Gln) rs75398746
NM_025074.6(FRAS1):c.5419_5424delTTCTCT (p.Phe1807_Ser1808del) rs730882178
NM_025074.7(FRAS1):c.7551T>A (p.Tyr2517Ter) rs745597204
NM_025114.3(CEP290):c.4437+1G>A rs760915898
NM_025132.3(WDR19):c.3533G>A (p.Arg1178Gln) rs79436363
NM_025132.4(WDR19):c.781dup (p.Thr261Asnfs) rs748656635
NM_025137.3(SPG11):c.1550_1551delTT (p.Cys518Serfs) rs312262730
NM_025137.3(SPG11):c.2146C>T (p.Gln716Ter) rs312262737
NM_025137.3(SPG11):c.6157G>A (p.Val2053Met) rs149003934
NM_025152.2(NUBPL):c.311T>C (p.Leu104Pro) rs201430951
NM_025152.2(NUBPL):c.815-27T>C rs118161496
NM_025180.4(CEP63):c.31C>T (p.Arg11Ter) rs763001827
NM_025216.2(WNT10A):c.637G>A (p.Gly213Ser) rs147680216
NM_030632.2(ASXL3):c.3349C>T (p.Arg1117Ter) rs868044680
NM_030632.2(ASXL3):c.4330C>T (p.Arg1444Ter) rs1555744282
NM_030653.4(DDX11):c.1133G>C (p.Arg378Pro) rs368266910
NM_030777.3(SLC2A10):c.313C>T (p.Arg105Cys) rs767864243
NM_030777.3(SLC2A10):c.394C>T (p.Arg132Trp) rs121908173
NM_030777.3(SLC2A10):c.692G>A (p.Arg231Gln) rs771028960
NM_030787.3(CFHR5):c.486dupA (p.Glu163Argfs) rs565457964
NM_030787.3(CFHR5):c.993C>A (p.Cys331Ter) rs751010317
NM_030813.5(CLPB):c.1882C>T (p.Arg628Cys) rs150343959
NM_030813.5(CLPB):c.803C>T (p.Thr268Met) rs200032855
NM_030964.3(SPRY4):c.530A>G (p.Lys177Arg) rs78310959
NM_030973.3(MED25):c.1004C>T (p.Ala335Val) rs145770066
NM_031220.3(PITPNM3):c.1878G>C (p.Gln626His) rs76024428
NM_031407.6(HUWE1):c.12067C>T (p.Arg4023Cys) rs1556914274
NM_031407.6(HUWE1):c.328C>T (p.Arg110Trp) rs1057520538
NM_031433.3(MFRP):c.642-2A>G rs376898612
NM_031471.5(FERMT3):c.922G>A (p.Gly308Arg)
NM_031475.2(ESPN):c.2230G>A (p.Asp744Asn) rs121908135
NM_031844.2(HNRNPU):c.2299_2302delAACA (p.Asn767Glufs) rs878855133
NM_031850.3(AGTR1):c.356G>A (p.Trp119Ter) rs398122935
NM_031885.3(BBS2):c.401C>G (p.Pro134Arg) rs376306240
NM_031885.3(BBS2):c.943C>T (p.Arg315Trp) rs121908178
NM_031885.3(BBS2):c.98C>A (p.Ala33Asp) rs797045155
NM_031955.5(SPATA16):c.848G>A (p.Arg283Gln) rs137853118
NM_032043.2(BRIP1):c.139C>G (p.Pro47Ala) rs28903098
NM_032043.2(BRIP1):c.2392C>T (p.Arg798Ter) rs137852986
NM_032043.2(BRIP1):c.897G>A (p.Met299Ile) rs137852985
NM_032237.4(POMK):c.905T>A (p.Val302Asp) rs199756983
NM_032322.3(RNF135):c.1015delG (p.Val339Serfs) rs724159978
NM_032354.4(TMEM107):c.*755C>T rs75008470
NM_032374.4(COA8):c.353T>C (p.Phe118Ser) rs587777786
NM_032380.3(GFM2):c.1728T>A (p.Asp576Glu) rs140077535
NM_032387.4(WNK4):c.3553C>T (p.Arg1185Cys) rs137853095
NM_032409.2(PINK1):c.1196C>T (p.Pro399Leu) rs119451946
NM_032520.4(GNPTG):c.857C>T (p.Thr286Met) rs193302860
NM_032578.3(MYPN):c.2882C>T (p.Pro961Leu) rs864621995
NM_032578.3(MYPN):c.3169C>T (p.Arg1057Ter) rs1057519572
NM_032578.3(MYPN):c.3263G>A (p.Arg1088His) rs71584501
NM_032578.3(MYPN):c.3335C>T (p.Pro1112Leu) rs71534278
NM_032578.3(MYPN):c.3583G>A (p.Val1195Met) rs71534280
NM_032578.3(MYPN):c.59A>G (p.Tyr20Cys) rs140148105
NM_032601.3(MCEE):c.178A>C (p.Lys60Gln) rs147401037
NM_032601.3(MCEE):c.427C>T (p.Arg143Cys) rs138436961
NM_032609.2(COX4I2):c.412G>A (p.Glu138Lys) rs119455950
NM_032645.4(RAPSN):c.264C>A (p.Asn88Lys) rs104894299
NM_032682.5(FOXP1):c.1574G>A (p.Arg525Gln) rs1553663084
NM_032682.5(FOXP1):c.1652+5G>A rs794727216
NM_032810.3(ATAD1):c.162G>C (p.Gln54His) rs1554884979
NM_032861.3(SERAC1):c.1577G>A (p.Gly526Glu) rs1554261079
NM_032957.4(RTEL1):c.1523C>T (p.Pro508Leu) rs786205700
NM_032957.4(RTEL1):c.2213+5G>A rs398123050
NM_032957.4(RTEL1):c.2288G>T (p.Gly763Val) rs398123016
NM_032957.4(RTEL1):c.3724+78T>C rs587777037
NM_032957.4(RTEL1):c.823G>A (p.Glu275Lys) rs398123019
NM_032977.3(CASP10):c.1216A>C (p.Ile406Leu) rs80358239
NM_033028.4(BBS4):c.712-1G>A rs377031435
NM_033056.3(PCDH15):c.2367_2369delTGT (p.Val790del) rs483352837
NM_033071.3(SYNE1):c.12371delA (p.Lys4124Argfs) rs886042380
NM_033071.3(SYNE1):c.226-2dupA rs774388631
NM_033071.3(SYNE1):c.25237G>A (p.Glu8413Lys) rs119103248
NM_033109.4(PNPT1):c.1519G>T (p.Ala507Ser) rs143712760
NM_033118.3(MYLK2):c.260C>T (p.Ala87Val) rs121908107
NM_033163.3(FGF8):c.77C>T (p.Pro26Leu) rs137852660
NM_033337.2(CAV3):c.191C>G (p.Thr64Ser) rs121909280
NM_033337.2(CAV3):c.216C>G (p.Cys72Trp) rs116840776
NM_033337.2(CAV3):c.233C>T (p.Thr78Met) rs72546668
NM_033337.2(CAV3):c.260T>C (p.Leu87Pro) rs28936685
NM_033337.2(CAV3):c.277G>A (p.Ala93Thr) rs28936686
NM_033337.2(CAV3):c.290_292delTCT (p.Phe97del) rs199476335
NM_033337.2(CAV3):c.6_7delGG (p.Met2Ilefs) rs1060502318
NM_033360.3(KRAS):c.15A>T (p.Lys5Asn) rs104894361
NM_033360.3(KRAS):c.34G>A (p.Gly12Ser) rs121913530
NM_033409.3(SLC52A3):c.106G>A (p.Glu36Lys) rs267606686
NM_033409.3(SLC52A3):c.1238T>C (p.Val413Ala) rs267606687
NM_033409.3(SLC52A3):c.1371C>G (p.Phe457Leu) rs145431028
NM_033409.3(SLC52A3):c.394C>T (p.Arg132Trp) rs267606684
NM_033409.3(SLC52A3):c.403A>G (p.Thr135Ala) rs527853872
NM_033409.3(SLC52A3):c.62A>G (p.Asn21Ser) rs199588390
NM_033409.3(SLC52A3):c.796C>T (p.Arg266Trp) rs370499474
NM_033409.3(SLC52A3):c.935C>T (p.Ala312Val) rs752218005
NM_033419.4(PGAP3):c.320C>T (p.Ser107Leu) rs202146344
NM_033453.3(ITPA):c.452G>A (p.Trp151Ter) rs200086262
NM_033629.4(TREX1):c.907A>C (p.Thr303Pro) rs76224909
NM_033629.5(TREX1):c.218C>T (p.Pro73Leu) rs755919767
NM_052844.3(WDR34):c.1177G>A (p.Gly393Ser) rs587777096
NM_052845.3(MMAB):c.403G>A (p.Ala135Thr) rs35648932
NM_052845.3(MMAB):c.548A>T (p.His183Leu) rs752866643
NM_052845.3(MMAB):c.656A>G (p.Tyr219Cys) rs765547005
NM_052985.3(IFT122):c.1636G>A (p.Gly546Arg) rs397515568
NM_052985.3(IFT122):c.718C>T (p.Arg240Ter)
NM_054012.3(ASS1):c.929A>G (p.Lys310Arg) rs199751308
NM_054021.1(GPR101):c.1098C>A (p.Asp366Glu) rs1556379508
NM_054021.1(GPR101):c.924G>C (p.Glu308Asp) rs73637412
NM_057176.3(BSND):c.35T>C (p.Ile12Thr) rs121908144
NM_058195.3(CDKN2A):c.193+5G>A rs587782083
NM_078480.2(PUF60):c.541G>A (p.Glu181Lys) rs1085307135
NM_080680.2(COL11A2):c.1861C>A (p.Pro621Thr) rs121912952
NM_080680.2(COL11A2):c.966dup (p.Thr323Hisfs) rs748440351
NM_080916.2(DGUOK):c.155C>T (p.Ser52Phe) rs1204316787
NM_080916.2(DGUOK):c.462T>A (p.Asn154Lys) rs144181978
NM_080916.2(DGUOK):c.509A>G (p.Gln170Arg) rs74874677
NM_130799.2(MEN1):c.1308G>T (p.Trp436Cys) rs398124435
NM_130799.2(MEN1):c.467G>A (p.Gly156Asp) rs794728648
NM_130837.2(OPA1):c.740G>A (p.Arg247His) rs138350727
NM_130838.1(UBE3A):c.1805A>G (p.Asn602Ser) rs587784521
NM_133259.3(LRPPRC):c.1489_1582del rs863225446
NM_133378.4(TTN):c.10361-1G>A rs869312099
NM_133378.4(TTN):c.12556C>T (p.Arg4186Ter) rs772235481
NM_133378.4(TTN):c.25513C>T (p.Gln8505Ter) rs746721983
NM_133378.4(TTN):c.32854G>C (p.Val10952Leu) rs587780488
NM_133378.4(TTN):c.6555_6556insTGTAAGGAAACAGACA (p.Lys2186Cysfs) rs587780494
NM_133433.3(NIPBL):c.6646T>C (p.Tyr2216His) rs587784020
NM_133443.3(GPT2):c.815C>T (p.Pro272Leu) rs886038199
NM_133459.4(CCBE1):c.472C>T (p.Arg158Cys) rs121908253
NM_133499.2(SYN1):c.1699A>G (p.Thr567Ala) rs200533370
NM_138361.5(LRSAM1):c.2093_2104delAGTGCTGCCAGC (p.Gln698_Gln701del) rs1554763017
NM_138387.3(G6PC3):c.778G>C (p.Gly260Arg) rs200478425
NM_138413.3(HOGA1):c.208C>T (p.Arg70Ter) rs758304537
NM_138413.3(HOGA1):c.221T>G (p.Val74Gly) rs796052084
NM_138413.3(HOGA1):c.289C>T (p.Arg97Cys) rs267606762
NM_138413.3(HOGA1):c.337G>A (p.Glu113Lys) rs150702945
NM_138413.3(HOGA1):c.529G>T (p.Asp177Tyr) rs777601935
NM_138413.3(HOGA1):c.535C>A (p.Pro179Thr) rs374327791
NM_138477.2(CDAN1):c.3128A>T (p.Asp1043Val) rs80338698
NM_138638.4(CFL2):c.19G>A (p.Val7Met) rs397515451
NM_138694.3(PKHD1):c.10036T>C (p.Cys3346Arg) rs149798764
NM_138694.3(PKHD1):c.10658T>C (p.Ile3553Thr) rs137852948
NM_138694.3(PKHD1):c.2414C>T (p.Pro805Leu) rs199531851
NM_138694.3(PKHD1):c.4870C>T (p.Arg1624Trp) rs200391019
NM_138694.3(PKHD1):c.5221G>A (p.Val1741Met) rs137852946
NM_138694.3(PKHD1):c.9530T>C (p.Ile3177Thr) rs200511261
NM_138715.2(MSR1):c.877C>T (p.Arg293Ter) rs41341748
NM_138736.2(GNAO1):c.626G>A (p.Arg209His) rs797044878
NM_139025.4(ADAMTS13):c.1423C>T (p.Pro475Ser) rs11575933
NM_139058.2(ARX):c.428_451dup24 (p.Ala150_Ala151insGlyAlaAlaAlaAlaAlaAlaAla) rs387906493
NM_139076.2(ABRAXAS1):c.1032dupT (p.Lys345Terfs) rs587780261
NM_139276.2(STAT3):c.1919A>T (p.Tyr640Phe) rs769031989
NM_144499.2(GNAT1):c.904C>T (p.Gln302Ter) rs374913800
NM_144573.3(NEXN):c.1955A>G (p.Tyr652Cys) rs137853197
NM_144573.3(NEXN):c.835C>T (p.Arg279Cys) rs146245480
NM_144612.6(LOXHD1):c.2497C>T (p.Arg833Ter) rs188119157
NM_144631.5(ZNF513):c.1015T>C (p.Cys339Arg) rs267607182
NM_144687.3(NLRP12):c.1054C>T (p.Arg352Cys) rs199881207
NM_144687.3(NLRP12):c.1854C>G (p.Tyr618Ter) rs142487599
NM_144773.3(PROKR2):c.253C>T (p.Arg85Cys) rs141090506
NM_144773.3(PROKR2):c.254G>A (p.Arg85His) rs74315418
NM_144773.3(PROKR2):c.518T>G (p.Leu173Arg) rs74315416
NM_144966.5(FREM1):c.1493G>A (p.Arg498Gln) rs184394424
NM_144997.5(FLCN):c.1177-5_1177-3delCTC rs767671406
NM_144997.5(FLCN):c.1333G>A (p.Ala445Thr) rs41419545
NM_144997.5(FLCN):c.763C>T (p.His255Tyr) rs879255664
NM_145046.4(CALR3):c.564delT (p.Gln189Serfs) rs747656642
NM_145064.2(STAC3):c.432+4A>T rs751033943
NM_145207.2(SPATA5):c.1A>C (p.Met1Leu) rs552219028
NM_145207.2(SPATA5):c.2531C>T (p.Ala844Val) rs796051892
NM_145239.2(PRRT2):c.647C>G (p.Pro216Arg) rs76335820